A viral gene therapy vector for clearing hepatitis b virus and application thereof

By constructing a viral gene therapy vector containing the PGLYRP2 protein functional domain, targeting hepatitis B virus cccDNA and nucleocapsid, the complete elimination of hepatitis B virus is achieved, solving the problem that existing vectors cannot eliminate cccDNA, and realizing long-lasting, specific and safe gene therapy effects.

CN117904201BActive Publication Date: 2026-03-27GUANGZHOU CHASER BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-19
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing viral gene therapy vectors cannot effectively eliminate hepatitis B virus cccDNA, resulting in incomplete suppression of hepatitis B virus replication and a high risk of relapse.

Method used

A viral gene therapy vector was designed, comprising the nuclear localization signal (NLS) domain, HBV DNA binding domain, secretion signal peptide domain, and HBV nucleocapsid binding domain of the PGLYRP2 protein. This vector was delivered via an adeno-associated virus (AAV) vector to target HBV cccDNA and HBV nucleocapsid, thereby achieving a dual mechanism for clearing hepatitis B virus.

Benefits of technology

It significantly clears HBV cccDNA in mice, achieving a complete cure for hepatitis B virus. It exhibits long-term expression and liver tissue specificity, ensuring the safety and effectiveness of gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117904201B_ABST
    Figure CN117904201B_ABST
Patent Text Reader

Abstract

A viral gene therapy vector for removing hepatitis B virus and application, relates to the field of biological medicine, especially to a gene therapy vector and its preparation method and application. To solve the problem that the existing viral gene therapy vector can only inhibit hepatitis B virus replication and cannot remove viral cccDNA. The vector comprises a promoter, an intron, an enhancer, a PGLYRP2 protein nuclear localization signal NLS functional domain coding gene, a PGLYRP2 protein HBV DNA binding domain coding gene, a PGLYRP2 protein secretion signal peptide functional domain coding gene, a PGLYRP2 protein HBV nuclear envelope binding functional domain coding gene and an IRES fragment. The viral gene therapy vector of the application can significantly promote the removal of HBV in the liver of mice. The viral gene therapy vector of the application is used for treating hepatitis B virus infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a gene therapy vector, its preparation method, and its application. Background Technology

[0002] Adeno-associated virus (AAV) is a single-stranded virus with an icosahedral structure. Recombinant AAV (rAAV) consists of the same capsid sequence and structure found in wild-type AAV. Compared to other viral delivery systems, rAAV has advantages such as long-lasting expression levels, extremely low immunogenicity, a wide range of infecting hosts, strong infectious diffusion capacity, and high specificity. However, many problems still exist in clinical applications. For example, the overexpression of the exogenous rAAV gene in the liver can cause the expression level of the target protein to exceed the physiological safety threshold, resulting in severe liver toxicity. How to achieve long-lasting and controllable expression of rAAV within the safety threshold is a key issue that needs to be addressed in the clinical application of rAAV.

[0003] Hepatitis B virus (HBV) is the pathogen that causes hepatitis B (HBV for short), belonging to the genus *Hepatotropic DNA Viruses*. HBV primarily infects human hepatocytes, and infection can significantly increase the incidence of cirrhosis and liver cancer. Clinically, treatments for HBV-infected individuals mainly include interferon-alpha and nucleoside analogs, or polyclonal antibodies targeting its surface antigen. Patent CN101906417A discloses a recombinant adeno-associated virus (AAV) gene therapy vector, which uses gene recombination technology to clone shRNA with inhibitory activity against HBV into the backbone plasmid of the AAV vector, and co-transfects packaging cells with helper plasmids to obtain recombinant AAV. Although this recombinant AAV can effectively inhibit HBV replication and expression, it cannot eliminate viral cccDNA, only slowing the disease progression, leading to a high relapse rate after discontinuation of treatment. Summary of the Invention

[0004] The present invention aims to address the problem that existing viral gene therapy vectors can only inhibit hepatitis B virus replication but cannot eliminate viral cccDNA, and provides a viral gene therapy vector for eliminating hepatitis B virus and its application.

[0005] This invention provides a viral gene therapy vector for clearing hepatitis B virus, comprising a promoter, introns, enhancers, a gene encoding the nuclear localization signal NLS domain of PGLYRP2 protein, a gene encoding the HBV DNA binding domain of PGLYRP2 protein, a gene encoding the secretion signal peptide domain of PGLYRP2 protein, a gene encoding the HBV nucleocapsid binding domain of PGLYRP2 protein, and an IRES fragment.

[0006] The promoter is a truncated version M of the PGLYRP2 gene promoter, and its nucleotide sequence is shown in SEQ ID NO: 1 in the sequence listing.

[0007] The enhancers are CMV enhancers and HBV EnII elements. The nucleotide sequence of the CMV enhancer is shown in SEQ ID NO: 2 in the sequence listing, and the nucleotide sequence of the HBV EnII element is shown in SEQ ID NO: 3 in the sequence listing.

[0008] The gene encoding the nuclear localization signal (NLS) domain of the PGLYRP2 protein is the gene encoding amino acids 550-576 at the C-terminus of the PGLYRP2 protein, and its nucleotide sequence is shown in SEQ ID NO: 4 in the sequence listing.

[0009] The nucleotide sequence of the gene encoding the HBV DNA binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 5 in the sequence listing.

[0010] The nucleotide sequence of the gene encoding the secretion signal peptide functional domain of the PGLYRP2 protein is shown in SEQ ID NO: 6 in the sequence listing.

[0011] The nucleotide sequence of the gene encoding the HBV nucleocapsid binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 7 in the sequence listing.

[0012] Furthermore, the vector backbone of the viral gene therapy vector is an adeno-associated virus vector, an adenovirus vector, a lentivirus vector, or a retrovirus vector; the adeno-associated virus vector is AAV2, AAV5, AAV7, AAV8, AAV9, or AAV-DJ type adeno-associated virus vector.

[0013] The present invention also provides the application of the above-mentioned viral gene therapy vector in the preparation of drugs for treating hepatitis B virus infection.

[0014] The beneficial effects of this invention are:

[0015] The viral gene therapy vector of the present invention contains the gene therapy delivery vector pAAV-EnII-EnCMV-M. The gene therapy delivery vector pAAV-EnII-EnCMV-M constructed by the present invention has the characteristics of long-term expression and liver tissue-specific expression in mice, and has a self-feedback mechanism, which gives the gene therapy product better safety.

[0016] This invention identified four functional domains of the PGLYRP2 protein: the HBV DNA-binding domain, the nuclear localization signal NLS, the secretion signal peptide SP, and the nucleocapsid domain. These functionally combine to form two novel fusion proteins. The viral gene therapy vector of this invention can simultaneously express two fusion proteins in hepatocytes—the PGLYRP2 HBV DNA-binding domain + nuclear localization signal NLS fusion protein (PGLYRP2). 209~377aa SP-PGLYRP2 is a fusion protein containing the secretory signal peptide SP+ nucleocapsid binding domain of PGLYRP2 and NLS. PGRP This invention targets HBV cccDNA, integrated chromosomal DNA, and HBV nucleocapsid respectively, acting as a transcriptional inhibitor of HBV cccDNA and integrated chromosomal DNA and a regulator of HBV capsid assembly. This achieves a dual mechanism and synergistic effect in clearing HBV from host cells, significantly promoting HBV clearance in mouse livers. The viral gene therapy vector of this invention can significantly clear cccDNA within 14 weeks, indicating that this method has great potential to achieve a complete cure for hepatitis B. Attached Figure Description

[0017] Figure 1 A schematic diagram of the pAAV-EnII-EnCMV-M vector;

[0018] Figure 2 To identify the enhancement of vector expression ability by the promoter and enhancer EnII-EnCMV-M;

[0019] Figure 3 The gene therapy delivery vector pAAV-EnII-EnCMV-M was specifically and highly expressed in hepatocytes.

[0020] Figure 4 This demonstrates the positive regulatory effect of PGLYRP2 protein on the backbone carrier pAAV-EnCMV-M;

[0021] Figure 5 This demonstrates the self-feedback regulatory effect of the PGLYRP2 protein on the gene therapy delivery vector pAAV-EnII-EnCMV-M.

[0022] Figure 6 The results of silver staining of rAAV-EnII-EnCMV-M-Luciferase virus;

[0023] Figure 7 The relative luciferase activity of different cells infected with rAAV-EnII-EnCMV-M-Luciferase virus;

[0024] Figure 8In vivo imaging results of mice injected with rAAV-EnII-EnCMV-M-Luciferase virus via tail vein;

[0025] Figure 9 To observe the nuclear localization of PGLYRP2 protein using confocal microscopy;

[0026] Figure 10 To observe and analyze the role of the nuclear localization signal domain (NLS) of the PGLYRP2 protein using confocal microscopy;

[0027] Figure 11 To observe and analyze the role of the SP domain of the secretion signal peptide in the PGLYRP2 protein using confocal microscopy;

[0028] Figure 12 Flowchart of the Flag pull-down technique for cell culture supernatant;

[0029] Figure 13 The result of Flag pull-down for cell culture supernatant;

[0030] Figure 14 The HBV DNA-strep pull-down mechanism recognizes the HBV DNA-binding domain of PGLYRP2.

[0031] Figure 15 Analysis of the HBV replication inhibition function of the HBV DNA binding domain PGLYRP2209-377 of PGLYRP2;

[0032] Figure 16 To detect the binding of PGLYRP2 protein to HBV nucleocapsid using immunoprecipitation and non-denaturing protein electrophoresis;

[0033] Figure 17 To analyze the interaction between the PGLYRP2 and PGRP functional domains of the PGLYRP2 protein and the HBV core antigen using immunoprecipitation;

[0034] Figure 18 This is a schematic diagram of the four PGLYRP2 functional domains identified in this invention;

[0035] Figure 19 This is a schematic diagram of the adeno-associated virus gene therapy vector of the present invention;

[0036] Figure 20 To demonstrate the HBV virus clearance effect of adeno-associated virus gene therapy vector in a mouse infection model;

[0037] Figure 21 The expression of the target gene in the liver of mice 14 weeks after tail vein injection of adeno-associated virus gene therapy vector-packaged virus;

[0038] Figure 22 The relative content of hepatitis B cccDNA in the liver of mice 14 weeks after tail vein injection of adeno-associated virus gene therapy vector-packaged virus.

[0039] Figure 23 The level of HBsAg in mouse serum 14 weeks after tail vein injection of adeno-associated virus (AAV) gene therapy vector-packaged virus. Detailed Implementation

[0040] The embodiments of the present invention will be described in detail below. The following embodiments are implemented based on the technical solution of the present invention, and detailed implementation schemes and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0041] This invention first constructs a gene therapy delivery vector pAAV-EnII-EnCMV-M, which is a gene therapy vector with liver-specific expression and self-feedback inhibition of overexpression. Then, based on this, an adeno-associated virus (AAV) gene therapy vector is constructed, expressing four PGLYRP2 functional domains: a fusion protein of the PGLYRP2 HBV DNA-binding domain and the nuclear localization signal NLS (HBV cccDNA and chromosomal integrated DNA transcription inhibitor), and a fusion protein of the PGLYRP2 secretion signal peptide SP and the nucleocapsid binding domain (HBV capsid assembly regulator). The tissue specificity and safety of this AAV gene therapy vector are achieved through the specific interaction between the vector and the PGLYRP2 gene or its truncated functional domain expression products. This gene therapy drug can express the PGLYRP2 truncated functional domain fusion protein in HBV-infected hepatocytes in a long-term, specific, and controllable manner, targeting HBV cccDNA and HBV nucleocapsid respectively, synergistically acting as an HBV cccDNA inhibitor and an HBV capsid assembly regulator.

[0042] The PGLYRP2 gene is constitutively highly expressed in normal human hepatocytes, but its expression is low in hepatocytes with high hepatitis B virus indices. This invention utilizes a self-feedback element carrying part of the PGLYRP2 gene promoter element and PGLYRP2 protein regulation to target hepatocytes for self-feedback expression of the PGLYRP2 protein functional domain fusion protein, thereby restoring the moderately high level of the PGLYRP2 protein functional domain in virus-infected hepatocytes. Therefore, this invention has theoretical safety.

[0043] Example 1: Construction and expression identification of gene therapy delivery vector pAAV-EnII-EnCMV-M

[0044] The Luciferase gene was amplified using BamHI-luciferase F and HindIII-luciferase R as primers and plasmid PGL4-PGLYRP2(1--2005) as a template. The upstream primer BamHI-luciferase F: CGGGATCCCGATGGAAGACGCCAAAAACATAAAGAAA, and the downstream primer HindIII-luciferase R: CCAAGCTTGGTTACACGGCGATCTTTCCGCCCTTC. The nucleotide sequence of the Luciferase gene is shown in SEQ ID NO: 9 in the sequence listing.

[0045] Using MluI-M F and NcoI-M R as primers and plasmid PGL4-PGLYRP2(1--2005) as a template, the truncated promoter M of the PGLYRP2 gene was amplified. The upstream primer MluI-M F: CGACGCGTCGGTGGCGCATGCCTGTAACCTGA, and the downstream primer NcoI-M R: CATGCCATGGCATGGATTTCAAGCCACCAGCAGTAGCTG. The nucleotide sequence of the truncated promoter M of the PGLYRP2 gene is shown in SEQ ID NO: 1 in the sequence listing.

[0046] The plasmid PGL4-PGLYRP2(1--2005) used to amplify the Luciferase gene and the truncated M promoter of the PGLYRP2 gene has been published in the article Hepatology. 2020 May; 71(5): 1626-1642.

[0047] HBV EnII elements were amplified using MluI-HBV-EnII F and SacI-HBV-EnII R as primers and plasmid pBB4.5-HBV1.2,genotypeC as a template. The upstream primer MluI-HBV-EnII F is: CGAGCGCGTCGTCCTGCCCAAGGTCTTACATAA, and the downstream primer SacI-HBV-EnII R is: CGAGCTCGCAGCTCCTCCCAGTCCTTAAAC. The nucleotide sequence of the HBV EnII element is shown in SEQ ID NO: 3 in the sequence listing.

[0048] The plasmid pBB4.5-HBV1.2,genotype C used to amplify the HBV EnII element was donated by someone else and has been published in the article Emerg Microbes Infect. 2022 Dec; 11(1):1356-1370. The AAV-MCS empty vector was purchased from the Miaoling plasmid platform (P0244, containing the CMV promoter).

[0049] The empty AAV-MCS vector was double-digested with restriction endonucleases MluI and NcoI to remove the CMV promoter, retaining the CMV enhancer, and then ligated with the truncated PGLYRP2 gene promoter M to obtain pAAV-EnCMV-M. The nucleotide sequence of EnCMV is shown in SEQ ID NO: 2 in the sequence listing. pAAV-EnCMV-M was then double-digested with restriction endonucleases MluI and SacI, and ligated with the HBV EnII element to finally construct the pAAV-EnII-EnCMV-M vector. A schematic diagram of the vector is shown below. Figure 1 As shown.

[0050] After verifying the inserted sequence information through vector sequencing, the gene therapy delivery vector pAAV-EnII-EnCMV-M was double-digested with restriction endonucleases BamHI and HindIII, and then ligated with the Luciferase gene sequence to obtain the pAAV-EnII-EnCMV-M-Luciferase recombinant, which was used to identify the expression level of the gene therapy delivery vector. The same molar amount of the control group pAAV-Basic-Luciferase (Con group) plasmid or the pAAV-EnII-EnCMV-M-Luciferase recombinant was transfected into the Huh7 hepatocyte cell line. Cells were lysed 12 hours after transfection, and luciferase substrate was added to the cell lysis buffer at a 1:1 volume ratio. Luciferase intensity was detected using a fluorescence meter. Luciferase reporter gene assay analysis showed that compared with the control group pAAV-Basic-Luciferase (Con group) without promoter and enhancer, the pAAV-EnII-EnCMV-M-Luciferase group showed significantly higher luciferase activity in Huh7 hepatocytes. Figure 2 Furthermore, in cells from different tissue sources, the same dose of pAAV-EnII-EnCMV-M-Luciferase recombinant and sea cucumber luciferase plasmid were transfected. Cells were lysed 12 hours after transfection, and luciferase substrate was added to the cell lysis buffer at a 1:1 volume ratio. The luciferase intensity was detected using a fluorescence meter. The results showed that pAAV-EnII-EnCMV-M-Luciferase had higher expression specificity in hepatocytes compared to non-hepatocytes (e.g., ...). Figure 3 ).

[0051] Example 2: Analysis of the hepatocyte-specific expression and self-feedback regulation of PGLYRP2 protein in the gene therapy delivery vector pAAV-EnII-EnCMV-M

[0052] First, the gene therapy delivery vectors pAAV-EnII-EnCMV-M-Luciferase and pAAV-EnCMV-M-Luciferase were cultured overnight and plasmids were extracted (according to the kit instructions, Omega, D6943-02). The obtained plasmids were purified as follows: 1 / 10 volume of sodium acetate (3M, pH 5.2) and 7 / 10 volume of isopropanol were added to the extracted plasmids, mixed well, and incubated at room temperature for 5 minutes. Then, the mixture was centrifuged at 12,000 rpm for 10 minutes. A white DNA precipitate was observed. Then, 1 mL of 70% ethanol was added, and the mixture was centrifuged at 12,000 rpm for 10 minutes. The supernatant was discarded, the residual ethanol was dried, and about 500 μL of physiological saline was added to dissolve the DNA. The concentration was measured and labeled. The plasmid pLVSIN-PGLYRP2 used for co-transfection has been disclosed in the article Hepatology. 2020 May; 71(5):1626-1642. Huh7 cells cultured in 12-well cell culture plates were divided into two groups, designated Group 1 and Group 2. Each group had three experimental wells and one control well. Group 1 wells were transfected with 0.5 μg pAAV-EnII-EnCMV-M-Luciferase, and Group 2 wells were transfected with 0.5 μg pAAV-EnCMV-M-Luciferase. The control wells in each group were transfected with 0.5 μg of the PLVSIN empty vector plasmid (purchased from Takara). The experimental wells in each group were transfected with 0.1 μg, 0.2 μg, and 0.4 μg of the pLVSIN-PGLYRP2 plasmid, respectively. Luciferase levels were measured using a luciferase reporter gene assay kit after 24 hours.

[0053] Result: As Figure 4 As shown, PGLYRP2 protein promotes the protein expression activity of the backbone vector pAAV-EnCMV-M-Luciferase in a dose-dependent manner, and even low doses of PGLYRP2 protein have a certain expression-promoting effect on the backbone vector; considering that PGLYRP2 protein has the characteristic of hepatocyte-specific expression, it suggests that the backbone vector has the ability to be expressed in hepatocytes specifically.

[0054] Based on the backbone vector pAAV-EnCMV-M, the PGLYRP2 protein negative regulatory element EnII was added to form the complete gene therapy delivery vector pAAV-EnII-EnCMV-M. Expression results in hepatocytes showed that under low PGLYRP2 protein expression conditions, PGLYRP2 protein mainly positively regulated the expression of the gene therapy delivery vector pAAV-EnII-EnCMV-M; while high PGLYRP2 protein expression, due to its inhibitory effect on EnII, significantly reduced the protein expression level of the gene therapy delivery vector, exerting a negative regulatory effect. Therefore, the regulation of the gene therapy delivery vector pAAV-EnII-EnCMV-M by PGLYRP2 protein exhibits a bidirectional feedback regulatory effect. Given that this bidirectional regulatory mechanism originates from the PGLYRP2 protein, the PGLYRP2 promoter M, and the PGLYRP2 regulatory element, it is termed a self-feedback regulatory effect (e.g., Figure 5 ).

[0055] Example 3: Viral packaging, viral titer detection, and silver staining detection of viral characteristics of the gene therapy delivery vector rAAV-EnII-EnCMV-M-Luciferase.

[0056] (1) Viral packaging of gene therapy delivery vector rAAV-EnII-EnCMV-M-Luciferase

[0057] One day in advance, HEK 293T cells were seeded. At packaging, the cell density was 85%-90%, and the cells were evenly distributed and in good condition. One hour beforehand, the medium was changed to serum-free DMEM (1% HEPES and 1% P / S). When changing the medium, the pipette should be close to the inner wall of the culture dish but not touching it. DMEM was added slowly to prevent blowing up already adhered cells. Care should be taken to avoid contaminating the medium and cells with the pipette during the medium change. DMEM was added sequentially to centrifuge tubes, followed by phelper, RC8, pAAV-EnII-EnCMV-M-Luciferase plasmid, and PEI transfection reagent at a molar ratio of 1:1:1 (phelper and RC8 were purchased from Addgene, catalog numbers 112867 and 112864, respectively). After vortexing to mix, the mixture was incubated at room temperature for 30 minutes. Add the settled liquid evenly to HEK293T cells and label them carefully. Add the liquid slowly and gently, ensuring the cells adhere to the cell wall, avoiding blowing them up. After adding, gently shake to mix (horizontal cross-mixing). Incubate the cells at 37°C in a 5% CO2 incubator for 10 hours, then change the medium. After 72 hours, collect the virus-producing cells along with the culture medium into a 15ml centrifuge tube. When collecting the cells, tilt the culture dish at a certain angle to scrape the cells into the culture medium. Centrifuge at 1000rpm / min for 3 minutes to separate the cells and supernatant. Store the supernatant separately, and resuspend the cells in 1ml PBS. Repeatedly transfer the cell suspension between an ultra-low temperature freezer (-80°C) and room temperature, performing three freeze-thaw cycles. Shake after each thaw. Centrifuge at 8000rpm for 1 hour, discard the supernatant, and dissolve the virus pellet in an appropriate amount of PBS. After complete dissolution, filter through a 0.45μm filter and collect the filtrate, which is the concentrated AAV virus.

[0058] Prepare 15%, 25%, 40%, and 60% iodixanol buffer solutions according to Table 1 below. Take an ultracentrifuge tube (BECKMAN, catalog number 331372) and add different concentrations of iodixanol layer by layer. First add 4.2 ml of the 60% layer, then 5 ml of the 40% layer, followed by 6 ml of the 25% layer, and finally 9 ml of the 15% layer. Add the prepared crude virus solution to the top layer carefully and slowly, and cap the tube tightly. Before centrifugation, balance the corresponding ultracentrifuge tubes, ensuring the error is within 0.02 g. Use an SW41Ti rotor and centrifuge at 36,300 rpm at 16°C for 3 hours.

[0059] Table 1. Preparation methods and dosage per tube for different concentrations of iodixanol buffer.

[0060]

[0061] Insert a syringe needle into the outside of the centrifuge tube, perpendicular to the tube wall. Aspirate the portion between the 40% and 60% iodixanol (the "white line") and transfer the aspirated liquid to a clean 50ml centrifuge tube. Place the tube on ice. Since there is a possibility of viral contamination during PEG8000 precipitation of the supernatant, dilute to 15ml with PBS + 0.001% PF68 and filter through a 0.45µm filter membrane to achieve sterilization. Transfer the filtered liquid to a 15ml ultrafiltration tube (100kDa) and centrifuge at 3500rcf, 4°C for 30min. After repeatedly blowing and aspirating the remaining liquid in the ultrafiltration tube into the virus storage tube, add a certain volume of PBS + 0.001% PF68 to the concentration tube, mix thoroughly by repeated blowing and aspirating, and then aspirate the liquid. Generally, after AAV concentration and centrifugation, aspirate the remaining liquid and wash twice with PBS + 0.001% PF68, about 150 μl of PBS + 0.001% PF68 each time. Aliquot the virus solution into 200 μl EP tubes in 50 μl units, and label the tube wall with the name and date.

[0062] (2) Virus titer detection

[0063] 5 μl of viral solution was taken for viral titer detection. 5 μl of the original viral solution was added to 45 μl of ddH2O to obtain a 10-fold diluted AAV, denoted as AAV1. 5 μl of the 10-fold diluted viral solution was added to 45 μl of ddH2O to obtain a 100-fold diluted AAV, denoted as AAV2. 5 μl of the 100-fold diluted viral solution was added to 45 μl of ddH2O to obtain a 1000-fold diluted AAV, denoted as AAV3. The DNA concentration of pAAV-EnCMV-M-Luciferase was detected. After detection, the copy number per μl of pAAV-EnCMV-M-Luciferase was calculated using the following formula. The calculated copy number per μl of pAAV-EnCMV-M-Luciferase was 7.8 × 10⁻⁶. 10 copies / μl.

[0064] (6.02×10 23 )×(ng / μl×10 -9 ) / (DNA length×660)=copies / μl

[0065] Take 2 μl of pAAV-EnCMV-M-Luciferase plasmid stock solution, add 18 μl of ddH2O, and obtain a copy number of 10. 9 Orders-of-magnitude plasmid dilutions. Prepare copy numbers of 10-10 using the same method. 3 -10 9 The plasmid dilution solution is prepared for use.

[0066] Absolute quantitative PCR was used to determine viral titers. Virus solutions and plasmids at different dilutions were used as templates for real-time quantitative PCR detection. The upstream primer used for PCR was 5'-GATGAGCACTTTTAAAGTTCT-3', and the downstream primer was 5'-GTTGTCAGAAGTAAGTTGG-3'. The reaction mixture was as follows: 5 μL of 2×traSYBR Mixture (Kangwei Century, CW0655M), 1 μL of 10 μM upstream and downstream primer mixture, 2 μL of deionized water, and 2 μL of template. The reaction program was set up according to the ABI high-throughput quantitative PCR analysis system (VIIA7) instructions, including the sample name, the name of the gene to be detected, and the name of the internal reference gene. The program was run and the results were exported. A standard curve was prepared based on the copy number and Ct value of the plasmid at different dilutions, and the copy number of the virus solution was calculated by substituting the viral Ct value.

[0067] (3) Silver staining detection method for the characteristics of rAAV-EnII-EnCMV-M-Luciferase virus

[0068] Prepare a 12% stacking gel according to the following formulation: sodium dodecyl sulfate / sulfonate (SDS), 30% acrylamide (acrylamide:methylenebisacrylamide = 29:1 by mass), tetramethylethylenediamine (TEMED), stacking gel 3-hydroxyaminomethane hydrochloride buffer (Tris-HCl), ddH2O, and ammonium persulfate (APS); prepare a 10% separating gel according to the following formulation: SDS, 30% acrylamide (acrylamide:methylenebisacrylamide = 29:1 by mass), TEMED, separating gel Tris-HCl, ddH2O, and APS. Perform silver staining on viruses at different dilutions (follow the kit instructions, Biosharp, BL620A).

[0069] Results: A standard curve was plotted, and the calculated viral copy number was 3.3 × 10⁻⁶. 11 copies / ml. Silver staining results of viral characteristic proteins are as follows: Figure 6 As shown, the VP1, VP2, and VP3 proteins of the virus are clearly visible, indicating that the recombinant adeno-associated virus was successfully packaged.

[0070] Example 4: Detection of specific and long-term expression of rAAV-EnII-EnCMV-M-Luciferase virus

[0071] Prepare 24-well cell culture plates and seed HEK293T and Huh7 cells. When cell confluence reaches 50%-70%, i.e., the cell count is approximately 2.5 × 10⁻⁶ cells / well... 5 Up to 3.5×10 5Count the cells intermittently. After aspirating the culture medium, wash the cells with serum-free fetal bovine serum-free medium. Digest the cells in the wells with trypsin, and after stopping the digestion, count the cells and set the MOI (number of virus particles infected per cell) as 10⁻⁶. 5 Calculate the required volume of rAAV to be added. Mix 2.5–3.5 μl of virus solution with 250 μl of culture medium in a sterile 1.5 ml centrifuge tube. Add the virus-culture medium mixture sequentially to the corresponding cell lines in each well. After adding the virus mixture, return the 24-well plate to a cell culture incubator at 37°C and 5% CO2. After 2 hours, add 250 μl of complete culture medium to each well and return the plate to the incubator. After 12 hours, aspirate the culture medium from the 24-well plate and add 500 μl of fresh complete culture medium to each well. Observe the cell status daily under a microscope. 60 hours after adeno-associated virus infection, collect the supernatant and cells for luciferase reporter gene assays.

[0072] C57BL / 6J mice were selected, and each mouse was injected via tail vein with 1×10- rAAV-EnII-EnCMV-M-Luciferase virus. 11 Copies were prepared by diluting 10 μl of viral solution with PBS to a volume of 100 μl. After intravenous injection of the virus into mice via the tail vein, the distribution of viral expressed proteins in the mice was detected at different time points following injection using a PE IVIS Spectrum small animal in vivo imaging system. For small animal in vivo imaging, sterile DPBS (w / o MgSO4) was used. 2+ Ca 2 + Prepare a stock solution of 15 mg / mL fluorescein and mix well. Filter sterilize using a 0.2 μm filter membrane. Use immediately, or aliquot and store at -20°C protected from light, avoiding repeated freeze-thaw cycles. Inject at a fluorescein / body weight concentration of 150 mg / kg. Perform imaging analysis 10-15 minutes after injection (until the light signal reaches its strongest stable plateau).

[0073] Results: The luciferase intensity of rAAV-EnII-EnCMV-M-Luciferase virus infecting different cell types is shown in Figure 7. The luciferase intensity in Huh7 cells was significantly higher than that in HEK293T cells (p<0.001), suggesting that the packaged rAAV-EnII-EnCMV-M-Luciferase virus has good hepatocyte specificity. In vivo imaging results of mice after tail vein injection of the virus are shown in Figure 7. Figure 8 As shown in the figure, #1 represents an injection of 1×10 11 AAV virus with high copy number, #2 is injected with 0.5 × 10⁻⁶. 11AAV virus copy number. In vivo imaging results showed that the packaged rAAV-EnII-EnCMV-M-Luciferase virus exhibited good liver tissue localization and long-term expression in mice.

[0074] Example 5: Identification of the nuclear localization signaling domain of the PGLYRP2 protein

[0075] The nuclear localization of PGLYRP2 protein in stable Huh7 / PGLYRP2 cells was observed using laser confocal microscopy. Bioinformatics was then used to predict the nuclear localization signal of PGLYRP2 protein. The predicted nuclear localization signal was fused with two red fluorescent proteins (2*RFP), and the subcellular localization of the 2*RFP-NLS fusion protein was observed using laser confocal microscopy to identify the function of the PGLYRP2 protein nuclear localization signal NLS domain. The nucleotide sequence of the gene encoding the PGLYRP2 protein nuclear localization signal NLS functional domain is shown in SEQ ID NO: 4 in the sequence listing.

[0076] Results: In Huh7 / PGLYRP2 hepatocytes that were stably transfected with PGLYRP2, laser confocal microscopy revealed that the PGLYRP2 protein was mainly located in the cell nucleus. Figure 9 Bioinformatics analysis predicted the nuclear localization signal of the PGLYRP2 protein to be located at amino acids 550-576 of the C-terminus. Further analysis of the nuclear localization of NLS using laser confocal microscopy revealed that the 2*RFP protein was primarily located in the cytoplasm, while the 2*RFP-NLS fusion protein was primarily located in the nucleus. Figure 10 This finding clarifies that the C-terminal 550-576 amino acids of the PGLYRP2 protein are the nuclear localization signal domain of the PGLYRP2 protein.

[0077] Example 6: Identification of the secretion signal peptide functional domain of PGLYRP2 protein

[0078] Bioinformatics was used to predict the secretion signal peptide domain (SP) of the PGLYRP2 protein, and then this SP was fused with green fluorescent protein (EGFP-3*Flag) to form the SP-EGFP-3*Flag fusion protein. Laser confocal microscopy was used to analyze the fluorescence level of green fluorescent protein in HEK293 cells transfected with pAAV-SP-EGFP-3*Flag and pAAV--EGFP-3*Flag; immunoprecipitation (Flag pull-down) was used to analyze the content of SP-EGFP-3*Flag fusion protein in the cell culture supernatant of HEK293 cells transfected with the above two plasmids. The nucleotide sequence of the gene encoding the secretion signal peptide domain of the PGLYRP2 protein is shown in SEQ ID NO: 6 in the sequence listing.

[0079] Results: Laser confocal microscopy revealed that in HEK293 cells transfected with the two plasmids, the intracellular green fluorescent protein level in the pAAV--EGFP-3*Flag group was significantly higher than that in the pAAV-SP-EGFP-3*Flag group. Figure 11 This suggests that SP-EGFP-3*Flag may be secreted into the cell culture supernatant. The flag pull-down technique is as follows: Figure 12 As shown, the results revealed that the content of SP-EGFP-3*Flag fusion protein in the cell culture supernatant of HEK293 cells transfected with the above two plasmids was significantly higher than that of EGFP-3*Flag fusion protein. Figure 13 This study further clarified the role of the secretory signal peptide domain SP of the PGLYRP2 protein.

[0080] Example 7: Identification of the HBV DNA binding domain of the PGLYRP2 protein

[0081] The HBV DNA-strep pull-down technique was used to identify the HBV DNA-binding domain of PGLYRP2, and then the HBV DNA-binding domain of PGLYRP2 was analyzed using an HBV promoter luciferase reporter gene assay system. 209-377 Analysis of the HBV virus replication inhibition function of the PGLYRP2 protein. The nucleotide sequence of the gene encoding the HBV DNA binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 5 in the sequence listing.

[0082] Results: Using the HBV core promoter DNA-strep pull-down technique, PGLYRP2 protein and its truncated variant PGLYRP2 were detected. 209-377 Able to recognize and bind to HBV core promoter DNA ( Figure 14 ), prompting PGLYRP2 209-377 The functional domain is the HBV DNA-binding domain of the PGLYRP2 protein. Further analysis using an HBV promoter luciferase reporter gene assay system revealed the regulatory role of the PGLYRP2 protein and its truncated form on HBV viral replication, confirming that the HBV DNA-binding domain of the PGLYRP2 protein is... 209-377 The protein has a clear inhibitory effect on HBV viral replication. Figure 15 ).

[0083] Example 8: Identification of the HBV nucleocapsid binding domain of the PGLYRP2 protein

[0084] Methods: PGLYRP2-Flag and HA-wild-type (WT) HBc or its mutants HA-HBc mutC61G (preferring nucleocapsid form) and HA-HBc mutY132A (HBc hexamer form rather than nucleocapsid form) were co-transfected into HEK293 cells. Immunoprecipitation and non-denaturing protein electrophoresis were used to identify the binding of PGLYRP2 protein to the HBV nucleocapsid. Further, HA-HBc and PGLYRP2-Flag or their truncated variant PGLYRP2 were co-transfected into HEK293 cells. PGRP - Flag expression plasmid was used to analyze PGLYRP2 protein and its truncated form PGLYRP2 using co-immunoprecipitation technique. PGRP Interaction with the HBV core antigen HBc. The nucleotide sequence of the gene encoding the HBV nucleocapsid binding domain of the PGLYRP2 protein is shown in SEQ ID NO: 7 in the sequence listing.

[0085] Results: Immunoprecipitation and non-denatured protein electrophoresis analysis showed that PGLYRP2 protein could bind to HA-HBc WT with HBV nucleocapsid and its mutant HA-HBc mutC61G, but not to the non-nucleocapsid HA-HBc mutY132A mutant. Figure 16 This indicates that the binding of PGLYRP2 protein to the HBV core antigen HBc is HBV nucleocapsid-dependent. Further analysis of PGLYRP2 protein and its truncated form PGLYRP2 was performed using immunoprecipitation. PGRP The interaction with the HBV core antigen HBc revealed the PGLYRP2 protein. PGRP The functional domain is the HBV nucleocapsid binding functional domain. Figure 17 ).

[0086] Example 9: Construction of an adeno-associated virus gene therapy vector.

[0087] The nuclear localization signal NLS and secretion signal peptide SP of the PGLYRP2 protein can be used to localize the functional domains of PGLYRP2 to the nucleus and extracellular environment, respectively. Specifically, NLS binds to the HBV DNA-binding domain PGLYRP2. 209-377 Functional domain fusion is beneficial to the fusion protein PGLYRP2. 209~377aa -NLS binding to HBV DNA and its inhibitory effect on HBV replication; SP binding domain PGLYRP2 to HBV nucleocapsid PGRP The fusion is beneficial to the fusion protein SP-PGLYRP2 PGRPInhibits the assembly of HBV nucleocapsid and HBV nucleic acid. The pLVSIN-PGLYRP2 vector for amplifying the four functional domains of PGLYRP2 has been published in Hepatology. 2020 May; 71(5):1626-1642. A schematic diagram of the gene therapy delivery vector pAAV-EnII-EnCMV-M is shown below. Figure 1 .

[0088] The gene therapy delivery vector pAAV-EnII-EnCMV-M was double-digested with restriction endonucleases ClaI and BamHI and then ligated with PGLYRP2. 209~377aa The -NLS-3 flag fragment was converted to obtain pAAV-EnII-EnCMV-M-PGLYRP2. 209~377aa -NLS-3flag recombinant;

[0089] The PGLYRP2 209~377aa -NLS-3 flag fragment is based on ClaI-PGLYRP2 209~377aa -NLS-3flag F and BamHI-PGLYRP2 209~377aa The amplification was performed using the pLVSIN-PGLYRP2 vector as a template and primers -NLS-3flag R. The upstream primer was ClaI-PGLYRP2. 209~377aa -NLS-3 flag F: CCATCGATGGATGAAATCCCCCCCTACCAT; downstream primer BamHI-PGLYRP2 209~377aa -NLS-3flag R: CGGGATCCCGTTACTTGTCATCGTCATCCTTG;

[0090] pAAV-EnII-EnCMV-M-PGLYRP2 was inhibited using restriction endonucleases BamHI and SalI. 209~377aa The -NLS-3flag recombinant was double-digested and ligated with the IRES fragment, followed by transformation to obtain pAAV-EnII-EnCMV-M-PGLYRP2. 209~377aa -NLS-3flag-IRES recombinant;

[0091] The IRES fragment was amplified using BamHI-IRES F and SalI-IRES R as primers and plasmid pIRES (purchased from Miaoling Plasmid Platform, catalog number P0786) as a template. The upstream primer BamHI-IRES F: CGGGATCCCGGTAAGTATCAAGGTTACAAGACA; the downstream primer SalI-IRES R: ACGCGTCGACGTCGGCCATAGCGGCCGCGGAATTATCATCGTGTTTTTCAAAGG; the nucleotide sequence of the IRES fragment is shown in SEQ ID NO: 8 in the sequence listing.

[0092] Then, restriction endonucleases SalI and BglII were used to target pAAV-EnII-EnCMV-M-PGLYRP2. 209~377aa The NLS-3flag-IRES recombinant was double-digested and ligated with SP-PGLYRP2. PGRP The -3 flag fragment, when converted, yields pAAV-EnII-EnCMV-M-PGLYRP2. 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP The recombinant is an adeno-associated virus gene therapy vector.

[0093] The SP-PGLYRP2 PGRP The -3 flag fragment is based on SalI-SP-PGLYRP2 PGRP -3flag F and BglII-SP-PGLYRP2 PGRP -3 flag R is the primer, obtained by amplification using the pLVSIN-PGLYRP2 vector as a template, where the upstream primer is SalI-SP-PGLYRP2. PGRP -3flag F: ACGCGTCGACGTCGGCCATAGCGGCCGCGGAAATGGCCCAGGGCGTGCTCTGGATT; downstream primer BglII-SP-PGLYRP2 PGRP -3flag R:GAAGATCTTCTTACTTGTCATCGTCATCCTTG.

[0094] Results: The schematic diagrams of the four PGLYRP2 functional domains identified in this invention are shown below. Figure 18 HBV gene therapy drug recombinant pAAV-EnII-EnCMV-M-PGLYRP2 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP See the diagram. Figure 19 .

[0095] Example 10: Expression and virus clearance effect of adeno-associated virus gene therapy vector in mouse liver tissue.

[0096] Using 1×10 11 C57BL / 6J mice were injected intravenously with AAV / 1.2*HBV copy number virus. Four weeks after modeling, HBV-positive mice were selected for subsequent gene therapy research. The adeno-associated virus gene therapy vector pAAV-EnII-EnCMV-M-PGLYRP2 of this invention was then used. 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP Recombinant adeno-associated virus was packaged, following the same packaging procedure as in Example 3. The HBV gene therapy drug was injected intravenously into the tail vein of the aforementioned HBV-positive C57BL / 6J mice (1×10⁶). 11 The HBV viral titer (HBV DNA copy number / mouse) in mouse blood was measured at 1, 2, 3, 7, and 14 weeks after viral injection. At 14 weeks post-injection, mouse livers were harvested, and the expression level of the adeno-associated virus gene therapy vector was detected using immunoblotting. At 14 weeks post-injection, extrachromosomal cell-free DNA was extracted from mouse livers using the Hirt method, and HBV cccDNA was treated with ExoI / ExoIII / T5 exonucleases. The purified HBV cccDNA content was detected using real-time quantitative PCR. The primers used were cccDNA-specific primer_F: GTCTGTGCCTTCTCATCTGC, and cccDNA-specific primer_R: ACAAGAGATGATTAGGCAGAGG. At 14 weeks post-injection, blood was collected from mouse tails, and the level of HBsAg in mouse serum was detected using ELISA (Sangon Biotech, D711407).

[0097] Results: The viral suppression effect of adeno-associated virus gene therapy vector was tested in an HBV mouse model. It was found that at 1, 2, 3, 7, and 14 weeks after viral injection, the HBV viral titer (HBV DNA copy number) in the mouse blood was as follows: Figure 20 As shown in the figure, curve a represents Con and curve b represents rAAV. Compared with the control group, the number of HBV DNA copies in the serum of mice treated with the adeno-associated virus gene therapy vector decreased significantly, indicating that the adeno-associated virus gene therapy vector of the present invention can significantly inhibit viral replication. Fourteen weeks after viral injection, the expression of the target gene in the mouse liver was as follows... Figure 21 As shown, SP-PGLYRP2 fused with SP in the control group PGRP Due to its extracellular secretion properties, the protein is present in relatively small amounts within cells, while PGLYRP2, which is fused with NLS, is present in much smaller amounts.209~377aa -NLS protein has a high intracellular content; the adeno-associated virus gene therapy vector virus group of the experimental group containing the dual fusion proteins contained the above two fusion protein bands.

[0098] With 1×10 11 The AAV virus copy number dose was injected into C57BL / 6J mice. Ten mice injected with the virus showed no death or significant discomfort within 14 days, indicating that the adeno-associated virus gene therapy vector of the present invention is safe.

[0099] Fourteen weeks after viral injection, compared to the Con group (pAAV-CMV), the rAAV group (pAAV-EnII-EnCMV-M-PGLYRP2) showed significantly higher viral load. 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP The relative viral cccDNA content in the liver of mice was reduced by approximately 200-fold, suggesting that rAAV(pAAV-EnII-EnCMV-M-PGLYRP2) was associated with this disease. 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP It has a significant effect on clearing the viral cccDNA library in the body. Figure 22 ).

[0100] Fourteen weeks after viral injection, compared to the Con group (pAAV-CMV), the rAAV group (pAAV-EnII-EnCMV-M-PGLYRP2) showed significantly higher viral load. 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP The levels of viral HBsAg in the blood of mice were significantly reduced, suggesting that rAAV(pAAV-EnII-EnCMV-M-PGLYRP2) was associated with this disease. 209~377aa -NLS-IRES-SP-PGLYRP2 PGRP It has a significant effect on clearing viral surface antigens in the body. Figure 23 ).

[0101] Current treatment strategies for chronic hepatitis B can effectively suppress HBV replication, but a complete cure is difficult to achieve. This is because cell-free cccDNA persists in the cell nuclei within the liver, making it difficult for drugs to eliminate, often leading to relapse after drug discontinuation. Therefore, the long-term presence of cccDNA in infected liver cells is a key factor in the persistence of viral infection and a major obstacle to curing hepatitis B. Drugs capable of clearing the cccDNA library in the body offer hope for a complete cure of hepatitis B.

[0102] The statistical analysis results of real-time quantitative PCR data on the relative cccDNA content in mouse liver tissue 14 weeks after viral injection show that, based on an average hepatocyte turnover cycle of 12 weeks, the adeno-associated virus gene therapy vector of this invention can significantly clear cccDNA within 14 weeks, suggesting that this invention has great potential to achieve a complete cure for hepatitis B.

Claims

1. A viral gene therapy vector for clearing hepatitis B virus, characterized in that... a promoter, an intron, an enhancer, a gene encoding a PGLYRP2 protein nuclear localization signal NLS functional domain, a gene encoding a PGLYRP2 protein HBV DNA binding domain, a gene encoding a PGLYRP2 protein secretion signal peptide functional domain, a gene encoding a PGLYRP2 protein HBV nucleocapsid binding functional domain, and an IRES fragment; the nucleotide sequence of the gene encoding the PGLYRP2 protein HBV DNA binding domain is shown as SEQ ID NO: 5 in the sequence listing; the gene encoding the PGLYRP2 protein nuclear localization signal NLS functional domain is a gene encoding the C-terminal 550-576 amino acids of the PGLYRP2 protein, and the nucleotide sequence thereof is shown as SEQ ID NO: 4 in the sequence listing; the nucleotide sequence of the gene encoding the PGLYRP2 protein secretion signal peptide functional domain is shown as SEQ ID NO: 6 in the sequence listing; the nucleotide sequence of the gene encoding the PGLYRP2 protein HBV nucleocapsid binding functional domain is shown as SEQ ID NO: 7 in the sequence listing.

2. The viral gene therapy vector for clearing hepatitis B virus according to claim 1, wherein the promoter is a PGLYRP2 gene promoter truncation M, and the nucleotide sequence thereof is shown as SEQ ID NO: 1 in the sequence listing.

3. The viral gene therapy vector for use in the elimination of hepatitis B virus according to claim 2, characterized in that the enhancer is a CMV enhancer and an HBV EnII element, the nucleotide sequence of the CMV enhancer is shown as SEQ ID NO: 2 in the sequence listing, and the nucleotide sequence of the HBV EnII element is shown as SEQ ID NO: 3 in the sequence listing.

4. The viral gene therapy vector for clearing hepatitis B virus according to claim 1, wherein the vector backbone of the viral gene therapy vector is an adeno-associated virus vector, an adenovirus vector, a lentivirus vector, or a retrovirus vector; and the adeno-associated virus vector is an AAV2, AAV5, AAV7, AAV8, AAV9, or AAV-DJ type adeno-associated virus vector.

5. A medicament for treating hepatitis B virus infection, characterized by comprising the compound of claim 1. The viral gene therapy vector according to any one of claims 1-4.

6. Use of the viral gene therapy vector according to any one of claims 1-4 in the preparation of a medicament for treating hepatitis B virus infection.

Citation Information

Patent Citations

  • shRNA for hepatitis B virus and recombinant adeno-associated virus vector treating vector carrying same

    CN101906417A

  • Tumor immune biomarker and application thereof

    CN109879956A

  • Virus-like particle delivery of hepatitis b virus (HBV) vaccines

    WO2020254876A1