IRE1alpha protein or coding gene thereof as hepatitis B virus infection treatment target and inhibitor and application of IRE1alpha protein or coding gene thereof

Abstract

The invention belongs to the technical field of medicines, and discloses application of IRE1alpha protein or a coding gene thereof as a new target spot for treating hepatitis B virus. The invention reveals for the first time that IRE1alpha protein weakens the recruitment and function of HBV specific CD8 + T cells by promoting macrophages to be polarized to anti-inflammatory phenotypes and inhibiting secretion of chemotactic factors CCL5, and the IRE1alpha protein is a key host factor for maintaining immune tolerance. On the basis, the invention provides an application of a small-molecule inhibitor targeting IRE1alpha in resisting HBV, and provides a new molecular mechanism and a candidate drug for functional healing of HBV.

Description

Technical Field

[0001] This invention belongs to the field of medicine, specifically relating to an IRE1α protein or its encoding gene as a therapeutic target and inhibitor for hepatitis B virus infection and its application. Background Technology

[0002] Hepatitis B virus (HBV) infection is a significant global public health problem. Chronic infection can progress to cirrhosis and hepatocellular carcinoma, seriously threatening patients' lives and health. One of the typical characteristics of chronic HBV infection is immune tolerance, where the host's immune system is unable to effectively clear the virus, leading to long-term viral replication and persistent antigens. Although existing nucleoside (acid) analogues and interferon therapies can effectively suppress viral replication, achieving a functional cure remains a major challenge.

[0003] In the liver's immune microenvironment of chronic HBV infection, multiple immunosuppressive mechanisms work synergistically to impair virus-specific T cell function. Anti-inflammatory macrophages, regulatory T cells, and other immunosuppressive cells infiltrate the liver in large numbers and inhibit CD8 by expressing checkpoint molecules such as PD-L1 / PD-1 and CTLA-4, and secreting inhibitory cytokines such as IL-10. + T cell recruitment and cytotoxicity promote viral persistence. Meanwhile, endoplasmic reticulum stress (ER stress) and the unfolded protein response (UPR) have been shown to play important roles in the polarization and functional regulation of immune cells. Key sensors in the UPR pathway include IRE1α, which, due to its combined kinase and RNase activity, has become a potential hub for regulating cell fate and immune function.

[0004] However, there is currently no literature reporting that IRE1α protein regulates macrophage-CCL5-CD8 in HBV immune tolerance. + The mechanism of action of the T cell axis is unknown, and no publicly available technology reveals its application as a target for hepatitis B treatment. Summary of the Invention

[0005] The primary objective of this invention is to overcome the aforementioned deficiencies of the prior art and to provide an IRE1α protein or its encoding gene as a therapeutic target for hepatitis B virus infection, an inhibitor, and its application.

[0006] The first aspect of the present invention is to provide the application of the IRE1α protein or its encoding gene as a therapeutic target for hepatitis B virus infection.

[0007] Preferably, the IRE1α protein or its encoding gene exerts its antiviral effect through at least one of the following regulatory mechanisms:

[0008] (a) Regulating macrophage polarization;

[0009] (b) Regulation of HBV-specific CD8 + T-cell function enables antiviral activity.

[0010] Preferably, the regulation of HBV-specific CD8 + T cell functions include: inhibiting CCL5 secretion, thereby weakening HBV-specific CD8+. + T cell recruitment and cytotoxic function.

[0011] This invention is the first to discover and validate IRE1α protein as a novel therapeutic target for hepatitis B. In HBV infection, IRE1α protein weakens HBV-specific CD8+ by promoting macrophage anti-inflammatory polarization and inhibiting CCL5 secretion. + T cell recruitment and function work together to maintain viral immune tolerance; therefore, the IRE1α protein or its encoding gene is a potential new therapeutic target for hepatitis B virus (HBV) infection.

[0012] A second aspect of the present invention provides a method for screening inhibitors targeting the IRE1α protein, comprising the following steps:

[0013] Step 1: Select the crystal structure of the IRE1α protein domain from the PDB database, perform preprocessing and energy minimization, and use virtual screening technology to dock, score and cluster the Specs and ChemDiv small molecule libraries to screen out a variety of candidate compounds;

[0014] Step 2: Detect the cytotoxicity of the candidate compounds to THP-1 cells and determine the highest concentration at which each candidate compound has no significant toxicity to THP-1 cells;

[0015] Step 3: PMA-induced THP-1 macrophages were co-incubated with the candidate compound, and the reaction was carried out using HepG2.2.15 and CD8. + The T-cell co-culture system was used to detect HBsAg and HBeAg levels, assess anti-hepatitis B activity, and the selected compounds were the inhibitors targeting the IRE1α protein.

[0016] A third aspect of the present invention is to provide an inhibitor targeting the IRE1α protein, said inhibitor being selected from compounds represented by any of the following general formulas I to V, pharmaceutically acceptable salts, esters, solvates or prodrugs thereof;

[0017] .

[0018] Preferably, the inhibitor is a compound of formula IV, a pharmaceutically acceptable salt, ester, solvate, or prodrug thereof.

[0019] A fourth aspect of the invention is to provide the use of the aforementioned inhibitor targeting the IRE1α protein in the preparation of a medicament for the prevention and / or treatment of hepatitis B virus infection.

[0020] Preferably, inhibitors targeting the IRE1α protein achieve their anti-HBV effect through at least one of the following mechanisms:

[0021] (1) Inhibits IRE1α protein activity;

[0022] (2) Inhibit IRE1α protein expression.

[0023] A fifth aspect of the invention is to provide a pharmaceutical composition for the prevention and / or treatment of hepatitis B virus infection, comprising a therapeutically effective amount of the inhibitor targeting the IRE1α protein, and a pharmaceutically acceptable carrier or excipient.

[0024] Preferably, the pharmaceutical composition further comprises one or more other anti-HBV drugs, such as an effective amount of entecavir.

[0025] The terms "therapeutic effective amount," "therapeutic effective dose," "effective amount," or "effective dose" all refer to an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals. The term "pharmaceutically acceptable" refers to a substance suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio. The term "pharmaceuticalally acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents. More preferably, the carrier is an injection buffer, liposome, or nanoparticle delivery system.

[0026] Pharmaceutically acceptable carriers include, but are not limited to: water, saline, buffer solutions, glycerol, ethanol, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be appropriate for the route of administration, as is well known to those skilled in the art.

[0027] The pharmaceutical compositions of the present invention contain a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Generally, pharmaceutical formulations should be matched to the route of administration; the dosage forms of the pharmaceutical compositions of the present invention are injections, oral formulations (tablets, capsules, oral liquids), transdermal formulations, and sustained-release formulations. They are prepared, for example, using physiological saline or an aqueous solution containing glucose and other excipients by conventional methods. The pharmaceutical compositions are preferably manufactured under aseptic conditions. More preferably, the dosage forms of the pharmaceutical compositions are injections (e.g., intravenous injection, intramuscular injection) or oral dosage forms (e.g., tablets, capsules, oral liquids).

[0028] The effective amount of the active ingredient described in this invention can vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: the pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.

[0029] Compared with the prior art, the beneficial effects of this application are:

[0030] (1) The IRE1α protein was discovered and validated for the first time as a novel target for anti-HBV therapy: This invention reveals for the first time that IRE1α is a key host factor regulating HBV infection and elucidates its mechanism of action through immune regulation. It weakens HBV-specific CD8 by promoting macrophage anti-inflammatory polarization and inhibiting CCL5 secretion. + The recruitment and function of T cells, working together to maintain viral immune tolerance, provide a novel strategy and target for achieving functional cure of hepatitis B.

[0031] (2) A novel and highly effective inhibitor targeting the IRE1α protein was discovered: Through structure-activity relationship analysis, the structures of general formula compounds with the same mechanism of action were summarized, providing a clear direction for the development of more IRE1α inhibitors, especially compound C9, which provides a lead compound for the development of new anti-HBV drugs that directly target the IRE1α protein.

[0032] (3) Provides a new synergistic treatment option: This invention confirms that the combination of IRE1α protein and existing standard drugs can produce a synergistic effect, significantly improving the effect of inhibiting HBV DNA and HBsAg, which lays a solid foundation for developing more effective combination treatment options;

[0033] (4) This strategy focuses on reversing immune tolerance, providing a new path for achieving functional cure of hepatitis B. Attached Figure Description

[0034] Figure 1Knockdown of IRE1α in macrophages inhibits HBV replication and antigen expression in vitro; where A represents the IRE1α mRNA expression level detected by qRT-PCR; B represents the IRE1α protein expression level detected by Western Blot; C represents the percentage of CD86-positive cells after IRE1α knockdown detected by flow cytometry; D represents the percentage of CD206-positive cells after IRE1α knockdown detected by flow cytometry; E represents a schematic diagram of the co-culture system of THP-1 and HepG2.2.15 cells; F represents the HBsAg expression level in the cell supernatant after co-culturing THP-1 and HepG2.2.15 cells for 48 hours; G represents the HBeAg expression level in the cell supernatant after co-culturing THP-1 and HepG2.2.15 cells for 48 hours; H represents the HBcAg expression level in HepG2.2.15 cells after co-culturing THP-1 and HepG2.2.15 cells for 48 hours. I represents THP-1, HepG2.2.15, and CD8. + Schematic diagram of T cell co-culture system; J represents THP-1, HepG2.2.15 and CD8. + The expression level of HBsAg in the cell supernatant after T cell co-culture for 48 hours; K represents THP-1, HepG2.2.15, and CD8. + The expression level of HBeAg in the cell supernatant after T cell co-culture for 48 hours; L represents THP-1, HepG2.2.15, and CD8. + The expression level of HBcAg in HepG2.2.15 cells after 48 hours of T cell co-culture.

[0035] Figure 2 Knocking out IRE1α in macrophages inhibits HBV replication and antigen expression in vivo; where A represents the animal experimental procedure; B represents the detection of mouse serum HBsAg by ELISA; C represents the detection of mouse serum HBeAg by ELISA; D represents the detection of mouse serum HBV DNA by qRT-PCR; E represents the detection of HBcAg and HBsAg in mouse liver tissue by IHC; F represents the relative quantitative analysis of HBcAg and HBsAg in mouse liver tissue; G represents the detection of the proportion of CD86-positive and CD206-positive macrophages in mouse liver tissue by flow cytometry; H represents the detection of HBV-specific CD86 in mouse liver tissue by flow cytometry. + T cell percentage.

[0036] Figure 3 During HBV infection, IRE1α in macrophages limits CD8 secretion by inhibiting CCL5 secretion. + T cell function; where A represents IFN-γ-positive CD8+ cells detected by flow cytometry after 48 hours of co-culture.+ T cell percentage; B indicates GZMB-positive CD8+ cells detected by flow cytometry after 48 hours of co-culture. + T cell percentage; C indicates Tim-3 positive CD8+ cells detected by flow cytometry after 48 hours of co-culture. + T cell percentage; D indicates PD-1 positive CD8+ after 48 hours of co-culture as detected by flow cytometry. + T cell percentage; E indicates CD8+ after 48 hours of co-culture as detected by flow cytometry. + T cell proliferation rate; F represents CD8+ after co-culture for 48 hours as detected by flow cytometry. + The number of T cells that migrated; G represents the detection of mouse serum HBsAg by ELISA; H represents the detection of mouse serum HBeAg by ELISA; I represents the detection of mouse serum HBV DNA by qRT-PCR.

[0037] Figure 4 Screening of anti-hepatitis B efficacy of 10 small molecule compounds; where A represents the cytotoxicity of the compounds detected by CCK8; B represents a schematic diagram of co-culture; C represents the detection of HBsAg in the cell supernatant after co-culture by ELISA; and D represents the detection of HBeAg in the cell supernatant after co-culture by ELISA.

[0038] Figure 5 The study investigated the anti-hepatitis B efficacy of compound C9 and its IRE1α-mediated mechanism of action. A represents HBsAg in cell supernatants after administration of different concentrations of compound C9 via ELISA; B represents HBeAg in cell supernatants after administration of different concentrations of compound C9 via ELISA; C represents Total HBV RNA in cells after administration of compound C9 via qRT-PCR; D represents HBV 3.5kb RNA in cells after administration of compound C9 via qRT-PCR; E represents HBV DNA in cells after administration of compound C9 via qRT-PCR; F represents HBcAg in cells after administration of compound C9 via Western Blot; G represents the docking results of compound C9 with IRE1α; H represents the affinity of compound C9 for IRE1α as determined by SPR assay; I represents the expression levels of p-IRE1α and IRE1α in cells after administration of compound C9 via Western Blot; J represents HBsAg in cell supernatants after co-administration of compound C9 and ETV via ELISA. K indicates the detection of intracellular HBV DNA by qRT-PCR after co-administration of compound C9 with ETV.

[0039] Figure 6 for Figure 5Enlarged view of point a in G. Detailed Implementation

[0040] The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments. The implementation conditions used in the embodiments can be further adjusted according to different requirements of specific use, and the implementation conditions not specified are those in conventional experiments.

[0041] The compounds C1-C10 (supplier: Specs) and APY29 (supplier: MCE) in this invention are commercially available or can be prepared using conventional synthetic methods in the art.

[0042] Example 1: Validation of macrophage IRE1α anti-hepatitis B virus function in vitro

[0043] To investigate the function of IRE1α protein in HBV infection, a shRNA sequence (target sequence: ACGCTTGGAAGCAAGAATAA) was designed targeting IRE1α and constructed into the lentiviral vector pTSB-U6-shRNA-EF1-copGFP-2A-PURO. After packaging the lentivirus, THP-1 cells were infected, and cell lines with stable IRE1α knockdown were obtained after selection with puromycin. After obtaining stable cell lines, RNA was extracted for qRT-PCR detection, and protein was extracted for Western blotting. The results showed that the shRNA fragment could knock down IRE1α expression levels by more than 70%, which can be used for subsequent experiments. Figure 1 (A, B in the original text).

[0044] To assess macrophage polarization, cells with stable IRE1α knockdown or control THP-1 cells were first collected and counted. 1×10⁶ cells were then used to measure the polarization of macrophages. 6 One THP-1 cell was seeded in a 6-well plate, and PMA (final concentration 100 ng / mL) was added for induction for 24 hours. Simultaneously, the cell supernatant of HepG2.2.15 cells cultured for 48 hours was collected, with HBV DNA titers greater than 10. 5 IU / mL was added as HBV conditioned medium. After 24 hours, HBV conditioned medium was added again, and the cells were cultured for another 48 hours. After 48 hours, cells were collected and stained at 4°C with a fluorescent dye-conjugated antibody against surface markers in FACS buffer (498ml PBS + 2.5g BSA + 2ml 0.5MEDTA). Data were acquired using a Sony ID7000 flow cytometer and analyzed using FlowJo software. The results showed that compared with the control group, the proportion of CD86 positive cells was increased and the proportion of CD206 positive cells was decreased in macrophages with stable IRE1α knockdown, exhibiting pro-inflammatory polarization. Figure 1(C, D in the original text).

[0045] 1. Co-culture of macrophages and hepatitis B cells

[0046] To assess the function of IRE1α in macrophages during chronic HBV infection, such as Figure 1 As shown in Figure C, we constructed a non-contact co-culture system between THP-1-induced macrophages and hepatitis B cell lines. The hepatitis B cell line used was the stable transgenic HepG2.2.15, containing the full-length HBV genome, for hepatitis B function verification. All cells were cultured in DMEM containing 10% FBS and 1% penicillin antibody at 37°C and 5% CO2. First, stably knocked-down IRE1α or control THP-1 cells were collected and counted. Cells were cultured in 1×10⁶ cells... 6 One THP-1 cell was seeded in a 6-well plate and induced for 24 h with PMA (final concentration 100 ng / mL). Then, 5 × 10⁶ cells were seeded... 5 HepG2.2.15 cells were seeded into the upper chamber of a co-culture system and co-cultured non-contactly for 48 hours. Finally, the cell culture supernatant was collected, and the levels of HBsAg and HBeAg were detected by ELISA. Simultaneously, HepG2.2.15 cells were collected for Western blotting to assess intracellular HBcAg expression.

[0047] 2. Macrophages, CD8 + T cells and hepatitis B cells co-culture

[0048] To further evaluate the antiviral effect of IRE1α on macrophages in the hepatitis B immune microenvironment, we constructed THP-1-induced macrophages and CD8+ cells. + A co-culture system of T cells and HepG2.2.15 cells was established. First, stably knocked-down IRE1α or control THP-1 cells were collected and counted. 1×10⁶ cells were then cultured. 6 One THP-1 cell was seeded in a 6-well plate, and PMA (final concentration 100 ng / mL) was added for induction for 24 hours. Next, 2 × 10⁶ cells were seeded... 6 5 × 10⁸ CD8+ T suspension cells were seeded in a 6-well plate. 5 HepG2.2.15 cells were seeded into the upper chamber of a co-culture system and co-cultured for 48 hours. Finally, the cell culture supernatant was collected, and the levels of HBsAg and HBeAg were detected by ELISA. Simultaneously, HepG2.2.15 cells were collected for Western blotting to assess intracellular HBcAg expression.

[0049] Experimental results showed that, using the Transwell co-culture system, co-culturing with IRE1α-stably knocked-down THP-1 cells significantly reduced HBsAg and HBeAg levels in HepG2.2.15 cells (HBsAg inhibition rate approximately 20%, p<0.0001, HBeAg inhibition rate approximately 20%, p<0.01), as well as intracellular HBcAg levels (inhibition rate approximately 30%-40%, p<0.0001). Figure 1 (EH in the text). Macrophage IRE1α showed clear anti-HBV activity, suggesting its potential application value in the treatment of hepatitis B. (Adding CD8...) + In the three-component co-culture system of T cells, the inhibitory effect on viral antigens is more significant. Figure 1 Among the IRE1α molecules in macrophages, the inhibition rate of HBsAg was approximately 50%-70% (p<0.01), the inhibition rate of HBeAg was approximately 20% (p<0.05), and the inhibition rate of HBcAg was approximately 50%-60% (p<0.0001). This suggests that the antiviral efficacy of IRE1α on macrophages may require the mediated action of CD8. + T cells play a role.

[0050] Example 2: In vivo verification of the anti-hepatitis B virus function of macrophage IRE1α

[0051] To further verify the function of IRE1α in HBV replication, i.e., HBV infection, macrophage IRE1α gene knockout mice were obtained using CRISPR / Cas9 technology. fl / fl Lyz2-Cre). Based on relevant references, 4-6 week old male mice were selected, including 10 wild-type mice (IRE1α). fl / fl ), IRE1α fl / fl Ten Lyz2-Cre mice were used. AAV-HBV (3 × 10⁻⁶) was injected via the tail vein. 10 A HBV infection model was established by collecting blood samples from each mouse ( / animal). On day 7 post-AAV-HBV infection, all mice had serum HBsAg levels >1000 IU / mL, indicating successful model establishment. Serum was collected weekly via the orbital vein for detecting virological markers (...). Figure 2 (A) Observe and record the mice's mental state, activity level, food intake, and fur luster daily, and record any abnormal behavior.

[0052] Four weeks later, mice were euthanized, and serum was obtained via ocular blood collection to detect the levels of HBsAg, HBeAg, and HBV DNA. Simultaneously, major organs such as the liver were removed, fixed in paraformaldehyde, embedded in paraffin, and tissue sections were prepared. Immunohistochemical staining (IHC) was performed on the tissue sections to observe the expression of hepatitis B virus antigens (HBsAg, HBcAg). Meanwhile, a portion of fresh liver tissue was harvested, and the mouse liver tissue was dissociated into a single-cell suspension using collagenase IV and DNase. Immune cells were further separated using Percoll and stained at 4°C with fluorescent dyes conjugated to surface markers in FACS buffer. For intracellular staining, cells were fixed and incubated with antibodies targeting intracellular targets. Data were acquired using a Sony ID7000 flow cytometer and analyzed using FlowJo software to analyze the infiltration and function of major immune cells in the liver.

[0053] With IRE1α fl / fl Compared to the control group, macrophage-specific IRE1α knockout mice (IRE1α fl / fl Following HBV infection, Lyz2-Cre significantly reduced serum HBsAg, HBeAg, HBV DNA, and viral antigens in liver tissue. Serum HBsAg levels decreased significantly (inhibition rate approximately 70%-95% at week 4, p<0.0001), HBeAg levels decreased (inhibition rate approximately 40%-70% at week 4, p<0.0001), and HBV DNA levels decreased (inhibition rate approximately 80%-95% at week 4, p<0.0001). Figure 2 The study showed that the inhibition rates of HBsAg (approximately 70%-80%, p<0.001) and HBcAg (approximately 70%-90%, p<0.0001) in liver tissue were significantly increased. Simultaneously, the number of pro-inflammatory macrophages (CD86-positive) in the liver increased significantly (approximately 2.5-fold, p<0.01), while the number of anti-inflammatory macrophages (CD206-positive) decreased significantly (decreased by approximately 10%-40%, p<0.001), and the proportion of HBV-specific CD8⁺ T cells increased (approximately 3-fold, p<0.01). These results demonstrate that the macrophage IRE1α target plays a crucial role in maintaining HBV immune tolerance and persistent viral infection, and possesses good antiviral potential in vivo.

[0054] Example 3: Verification of the mechanism by which macrophage IRE1α restricts CD8⁺ T cell function by inhibiting CCL5 secretion during HBV infection.

[0055] To further elucidate the molecular mechanism by which macrophage IRE1α regulates the immune response in HBV infection, this example mainly explores the regulatory role of IRE1α on macrophage secretory phenotype and its effect on CD8. + The impact on T cell function.

[0056] 1. Macrophages and CD8 + T co-culture experiment

[0057] (1) Obtaining mononuclear cells: Take 10 mL of peripheral blood from a healthy person and place it in a 15 mL centrifuge tube. After removing the plasma, add pre-cooled PBS to the original blood volume and mix well. Slowly add the diluted blood along the tube wall to the surface of the separation liquid. The blood to separation liquid volume ratio is 1:1. After centrifuging at room temperature, remove the white cloud layer between the upper and middle layers, which is the mononuclear cells.

[0058] (2) CD8 + T cell sorting: After washing the mononuclear cells obtained in step (1) with pre-chilled PBS, resuspend them in 1 mL of cell sorting buffer and count them; add the corresponding volume of STEMCELL CD8⁺ T cell separation kit reagent according to the number of cells, mix well and let stand at room temperature for 5 min; add RapidSpheres that have been inverted and mixed, add sorting buffer to a total volume of 2.5 mL and gently invert 2-3 times; place the test tube on a magnetic rack and let stand at room temperature for 3 min, collect the supernatant to obtain CD8⁺ T cells. + T cells, adjusted to a concentration of 1×10⁻⁶ 6 / mL;

[0059] (3) CD8 + T cell activation and expansion: The CD8 cells obtained in step (2) + T cells were seeded into six-well plates, with 1 mL of RPMI 1640 complete medium and 25 μL of activating factor containing CD3 / CD28 / CD2 added to each well. The cells were then activated and cultured for 3 days. Cells were centrifuged and counted every 2-3 days, and the cell concentration was adjusted to 1 × 10⁻⁶ cells / well. 6 / mL, resuspend in fresh RPMI 1640 complete medium containing IL-2 for amplification; repeat the above activation procedure after 7-10 days to achieve long-term amplification;

[0060] (4) T cell migration detection: 5×10 5 One THP-1 cell was seeded in the lower layer of a 24-well Transwell chamber; the next day, the CD8 cells obtained in step (3) were resuspended in serum-free RPMI 1640 medium. + T cells, 1×10 5 One culture medium was inoculated into the upper layer of the chamber; after incubation at 37°C for 6 hours, the lower layer of culture medium was collected, centrifuged, resuspended in PBS, and counted to determine the migrating CD8+. + T cell count.

[0061] (5) T cell proliferation assay: First, prepare the CFSE stock solution. The CFSE lyophilized powder needs to be dissolved before use. Bring the kit to room temperature, add 36 μL of DMSO to the CFSE lyophilized powder bottle, and dissolve completely to prepare a 5mM solution. This is the prepared CFSE stock solution. Protect from light. Wash the target cells (T cells) twice with PBS to remove residual FBS / serum protein. Centrifuge and discard the supernatant. Resuspend the T cells in PBS at a cell concentration of 1×10⁻⁶ cells / mL. 7 -3×10 7 Cells / mL (cell count: 10 × 10) 6 -100×10 6 (cells / mL); Add CFSE to the single-cell suspension to a final concentration of 1 μM. Wrap the centrifuge tube / EP tube containing cells in aluminum foil to protect from light, and place in 37°C with shaking / sprinkling every 5 minutes for 15-20 minutes. Add complete culture medium (containing 10% FBS) at least 5 times the chromosome volume to stop staining, centrifuge, and discard the supernatant. Add 10 mL of complete culture medium (containing 10% FBS), centrifuge, discard the supernatant, and directly feed a portion of the stained target cells as a positive control. Take a portion of unstained cells in advance as a negative control and adjust the parameters to an appropriate size (FITC channel). Seed the remaining stained cells into well plates, set up groups according to different treatments, and co-culture with macrophages for 72 h.

[0062] (6) T cell function experiment: In order to convert CD8 + T cells were co-cultured with control or IRE1α-knockdown macrophages, at a ratio of 1 x 10⁻⁶ cells. 6 One THP-1 cell was seeded in the lower layer of a 6-well Transwell chamber; the next day, 5 × 10⁶ cells were seeded... 5 CD8 + T cells were seeded in the upper layer of the chamber and cultured at 37°C for 72 hours. CD8+ cells were collected from the upper layer of the chamber after 72 hours. + T cells were centrifuged, the supernatant was discarded, and PD-1 and Tim-3 flow cytometry antibodies were added for staining. The cells were then fixed and perforated, followed by IFN-γ and GZMB flow cytometry antibody staining. After staining, the cells were washed with PBS and resuspended in 300 μL for further staining.

[0063] 2. CCL5 in vivo functional experiments

[0064] Male mice aged 4-6 weeks were selected, including 6 wild-type mice (IRE1α). fl / fl ), IRE1α fl / fl Twelve Lyz2-Cre mice were used. AAV-HBV (3 × 10⁻⁶) was injected via the tail vein. 10 (6 animals), to construct an HBV infection model. Among them, 6 IRE1α animals... fl / flLyz2-Cre mice were simultaneously injected with CCL5 neutralizing antibodies, 250 μg per mouse via intraperitoneal injection, every 3 days. Serum was collected weekly via orbital vein for virological marker detection. The mice's mental state, activity level, food intake, and coat luster were observed and recorded daily, along with any abnormal behavior.

[0065] Experimental results showed that co-culturing with IRE1α-knockdown macrophages significantly promoted CD8+. + T cell function is activated. Specifically, after co-culture, CD8 + T cell secretion of IFN-γ and GZMB increased significantly. Figure 3 (A, B in the original text), while the expression of depletion markers PD-1 and Tim-3 was significantly decreased ( Figure 3 (C, D in the original text). Furthermore, IRE1α knockdown of macrophages can also enhance CD8... + T cell proliferation and migration capacity, with CFSE cell proliferation assays showing that IRE1α deficiency promotes CD8 cell proliferation. + T cell proliferation ( Figure 3 (E in the text), migration experiments further confirmed its significantly enhanced migration ability ( Figure 3 The above effects all depend on the CCL5 signaling pathway. After combined knockdown of CCL5 under IRE1α knockdown, CD8... + T cell cytokine secretion decreases, exhaustion marker expression rebounds, and proliferation and migration abilities also weaken accordingly. Figure 3 In vivo, administration of CCL5 neutralizing antibodies also reversed the antiviral effect induced by IRE1α knockout. Figure 3 These results indicate that IRE1α deficiency promotes macrophage-mediated CD8+ upregulation by upregulating CCL5. + T cell activation and antiviral effects are linked to the blocking of CCL5 signaling, which can reverse this effect.

[0066] Example 4: Screening method for inhibitors targeting IRE1α protein

[0067] 1. High-throughput screening of small molecule inhibitors targeting IRE1α

[0068] (1) Selection of crystal structure and pretreatment of complex

[0069] Crystal structures of IRE1α kinase domain complexes containing small molecule ligands were collected from the RCSB PDB database, yielding 22 structures. However, most structures exhibited conformational incompleteness in the αC helical region, potentially affecting the regulatory effect of the co-crystal ligands on RNase activity. Therefore, 3FBV, 4Z7H, and 4YZC structures were ultimately selected as docking templates for subsequent virtual screening. The Protein Preparation Wizard module in the Schrödinger 2020-3 software package was used for protein structure preprocessing, specifically including bond order correction, addition of hydrogen atoms, and partial charge addition. Subsequently, the Prime module was used to complete missing side chains and loop regions, and redundant chains and solvent molecules were removed. After optimizing the hydrogen bond network and adding hydrogen atoms, the OPLS_2005 force field was used to minimize the energy of the system until the root mean square deviation (RMSD) of atoms converged to 0.3 Å.

[0070] (2) Virtual Filtering

[0071] First, based on the PAINS and REOS rules in the Canvas software, the Specs library (approximately 200,000 small molecules) and the Chemdiv library (approximately 1.53 million small molecules) were initially filtered to exclude molecules containing interfering functional groups. Subsequently, the Lipinski and Opera rules were further applied to screen for non-drug-like molecules, removing those with ≥3 violations of the Opera rule and ≥2 violations of the Lipinski rule.

[0072] Next, the LigPrep module of the Schrödinger software package was used to prepare the structure of the compound, determining its possible ionization states, tautomers, stereoisomers, and low-energy conformations. Specifically, the Epik method was used to generate possible ionization states and tautomers at pH = 7.0 ± 2.0, with a maximum of 32 stereoisomers generated per molecule, while other parameters remained at default settings. After the above preprocessing, approximately 2.46 million molecular conformations were finally obtained for subsequent docking.

[0073] Using three crystal structures as docking templates, the Glide SP module in the Schrödinger software package was used to dock small molecules into protein-binding pockets. Molecules from the Specs and Chemdiv libraries were scored and ranked (6 groups in total). The top 3000 conformations with the highest Glide SP scores from each group were retained, and cluster analysis was performed based on MACCS molecular fingerprints and the Tanimoto coefficient (threshold set at 0.80). A total of 11158 conformations were obtained after merging. The binding mode of each conformation was evaluated, focusing on whether key hydrogen bond interactions were formed with the kinase hinge region residues CYS645 and GLU643. Finally, based on the docking score, the top 10 compounds were selected as candidate compounds for further validation. Specific information on the candidate compounds is shown in Tables 1-3.

[0074] Table 1. Detailed information on candidate compounds C1 and C2

[0075]

[0076] Table 2. Detailed information on candidate compounds C3-C9

[0077]

[0078] Table 3. Detailed information on candidate compounds C10 and APY29

[0079]

[0080] 2. Functional screening of small molecule inhibitors targeting IRE1α

[0081] (1) Confirm the safe concentration range of the compound.

[0082] To test the functional effects of 10 compounds in vitro, THP-1 cells in the logarithmic growth phase were selected. The resulting cell suspension was centrifuged at 900 rpm for 3 minutes at room temperature, the supernatant was discarded, and the cell pellet was resuspended in fresh medium containing PMA. Cells were seeded at a density of 10,000 cells per well in 96-well plates and pre-cultured at 37°C with 5% CO2 for 24 hours to ensure full adhesion. After adhesion, the cells were treated with 10 compounds (five concentration gradients for each small molecule compound) and incubated under the same conditions for another 48 hours. After treatment, 10% CCK-8 working solution was prepared using serum-free 1640 basal medium, and 100 μL of the working solution was added to each well. The cells were incubated at 37°C in the dark for 1 hour. After incubation, the absorbance (OD value) of each well was measured at 450 nm using a microplate reader to assess cell viability.

[0083] (2) Confirmation of the efficacy of the compound against hepatitis B

[0084] First, THP-1 cells were induced into macrophages using PMA, and then incubated with the highest concentration of the compound that showed no significant cytotoxicity for 48 hours. Simultaneously, a group incubated with the known IRE1α kinase inhibitor APY29 was also incubated for 48 hours. Afterward, the culture medium containing the compound was removed, and fresh 1640 complete medium was added for further culture for 24 hours. After 24 hours, the supernatant from the THP-1 cells was collected as conditioned medium for subsequent experiments. HepG2.2.15 and CD8+ were added to the conditioned medium. + In a co-culture system of T cells, cells were co-cultured for 48 hours, and the cell culture supernatant was collected. The levels of HBsAg and HBeAg were detected by ELISA.

[0085] Candidate compounds C1-C10 were obtained from the compound library through virtual screening combined with in vitro functional validation (including CCK-8 cytotoxicity assay and antigen inhibition assay). CCK-8 assay results showed that the highest non-toxic concentrations (NDCs) for each compound were: C1 25 µM, C2 25 µM, C3 1.25 µM, C4 1.75 µM, C5 100 µM, C6 2.5 µM, C7 25 µM, C8 12.5 µM, C9 100 µM, and C10 50 µM. Figure 4 (A) Further analysis of HBsAg and HBeAg levels in the supernatant of HepG2.2.15 cells revealed that compound C9 (i.e., compound C9 in Table 1) exhibited significant inhibitory effects on both HBsAg and HBeAg at non-toxic concentrations, with inhibition rates reaching 30%-40% (p<0.001). Figure 4 Compounds C and D in the formula are shown in Formula I. Using compound APY29 (structure shown in Formula I, CAS: 1216665-49-4) as a positive control, it showed some inhibitory activity at a non-toxic concentration. The remaining tested compounds C6 (structure shown in Formula II), C7 (structure shown in Formula III), and C10 (structure shown in Formula V) showed only weak inhibitory effects on HBeAg, all less effective than compound C9 (structure shown in Formula IV).

[0086] Example 5: Validation of the anti-hepatitis B virus activity of compound C9 and confirmation of its anti-hepatitis B mechanism mediated by IRE1α

[0087] 1. Dose-dependent assays of compound C9 and detection of intracellular hepatitis B transcription levels and HBcAg content.

[0088] Select THP-1 cells in the logarithmic growth phase, centrifuge the resulting cell suspension at room temperature, discard the supernatant, and resuspend the cell pellet in fresh medium containing PMA. Arrange the cells at 1 × 10⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well into 6-well plates and pre-cultured at 37°C with 5% CO2 for 24 hours to ensure full adhesion. After adhesion, cells were treated with compound C9 (0, 6.25 μM, 12.5 μM, 25 μM, 50 μM, 100 μM) and incubated under the same conditions for another 48 hours. After 48 hours of compound treatment, the medium containing the compound was discarded, and fresh medium was added for 24 hours of further culture. After 24 hours, the supernatant was collected as conditioned medium for subsequent experiments. The collected conditioned medium was then mixed with HepG2.2.15 and CD8 [component name missing]. + In a T-cell co-culture system, after 48 hours of further incubation, cell supernatant was collected, and the levels of HBsAg and HBeAg in the supernatant were detected by ELISA. Total RNA was extracted from HepG2.2.15 cells, and cDNA was synthesized via reverse transcription for subsequent qRT-PCR analysis of related gene expression levels. Simultaneously, a portion of the treated cells was lysed with RIPA lysis buffer, and total protein was extracted. Protein quantification was performed using the BCA method, followed by Western blotting to assess intracellular HBcAg protein expression levels.

[0089] Experimental results: such as Figure 5 As shown in Figures AB, treatment with compound C9 (CAS: 325476-23-1) significantly reduced the levels of HBsAg and HBeAg in the supernatant of HepG2.2.15, exhibiting a clear dose-dependent effect (inhibition rate approximately 10%-40%, p<0.0001). Figure 5 As shown in CF, after treatment with compound C9 (100 μM), the total HBV RNA (inhibition rate approximately 30%-40%, p<0.0001) and HBV 3.5kb RNA in HepG2.2.15 cells were significantly reduced (inhibition rate approximately 20%-40%, p<0.01), intracellular HBV DNA was significantly reduced (inhibition rate approximately 20%-40%, p<0.01), and intracellular HBcAg expression was also significantly inhibited (approximately 50%-60%, p<0.01).

[0090] 2. Verification of the binding of compound C9 to IRE1α

[0091] Molecular docking simulation: The IRE1α protein crystal structure (PDB ID: 6W39) was downloaded from the RCSB PDB database, and the SDF file of compound C9 was downloaded from PubChem. Both were uploaded to the CB-Dock online service website (http: / / clab.labshare.cn / cb-dock / ) for automatic docking. The conformation with the highest Vina score was selected, and a protein-ligand complex interaction diagram and a binding pocket surface topology diagram were generated. For example... Figure 5 The G value in the figure shows that the docking fraction of compounds C9 and IRE1α is -8.3 kcal / mol, indicating that the two have a good direct binding interaction.

[0092] Surface plasmon resonance (SPR): The interaction between the test compound C9 and the IRE1α protein was analyzed using the Biacore3000, a novel biomolecular interaction analysis instrument from Amersham Bioscience based on the surface plasmon resonance (SPR) principle. The recombinantly expressed active IRE1α protein was covalently coupled to the FC2 channel of the CM5 sensor chip using a standard amino-coupling method (pH 4.6). A working buffer of 5% DMSO in PBS buffer (pH 7.4) was used. A series of different concentrations of compound C9 were dissolved in the working buffer, centrifuged, and then automatically injected for 60 s at a flow rate of 10 µL / min. Dissociation was allowed for 120 s, and solvent correction was performed according to the manufacturer's instructions. Experimental data were analyzed using BIA Evaluation 3.0 software in a 1:1 binding mode. The SPR experiment determined the equilibrium dissociation constant (KD) of compound C9 binding to IRE1α protein to be 1.24 μM, directly confirming the specific binding between the two.

[0093] 3. Effect of compound C9 on IRE1α expression

[0094] THP-1 cells in logarithmic growth phase were induced by PMA and then uniformly seeded in 6-well plates. After cell adhesion, 100 μM compound C9 was added to treat the cells for 48 hours. After treatment, cells were collected and Western blot experiments were performed to detect the regulatory effect of compound C9 on IRE1α expression. The results showed that after treatment with compound C9, the expression level of phosphorylated IRE1α (p-IRE1α) decreased significantly (approximately 60%, p < 0.0001), while the total IRE1α protein level did not change significantly, suggesting that compound C9 mainly inhibited IRE1α kinase activity. Figure 5 (I in the middle).

[0095] 4. Efficacy analysis of compound C9 combined with entecavir in the treatment of hepatitis B virus

[0096] HepG2.2.15 cells in logarithmic growth phase were uniformly seeded in 96-well plates. The following experimental groups were established: blank control group, compound C9 (100 μM) group, entecavir (10 nM) group, and a combination group of compound C9 (100 μM) and entecavir (10 nM). The conditioned medium for the compound C9 group was prepared as described above. After HepG2.2.15 cells adhered, the compound C9 conditioned medium and ETV were added to the HepG2.2.15 and CD8 cells. + In a co-culture system of T cells, after 48 hours of further incubation, the cell supernatant was collected. The levels of HBsAg and HBeAg in the supernatant were detected by ELISA, and the level of HBV DNA was detected by qRT-PCR. Figure 5 As shown in J and K, compared with the single-drug group, the combination therapy group showed significantly enhanced inhibitory effects on HBsAg (p<0.05) and HBV DNA (p<0.01).

[0097] This invention reveals for the first time that macrophage IRE1α weakens HBV-specific CD8+ by promoting macrophage anti-inflammatory polarization and inhibiting CCL5 secretion during HBV infection. + T cell recruitment and function work synergistically to maintain viral immune tolerance. (In conjunction with CD8) + Co-culturing T cells with IRE1α-stably knocked-down THP-1 cells significantly reduced the levels of HBsAg and HBeAg in the supernatant of HepG2.2.15 cells, and significantly reduced intracellular HBcAg. Simultaneously, HBV transcription and replication were significantly inhibited in macrophage-conditionally knocked-out IRE1α mice, and hepatic macrophages exhibited pro-inflammatory polarization, with HBV-specific CD8+ showing increased activity. + Increased T cell numbers and cytotoxic function, along with an improved intrahepatic immune microenvironment. Combining in vivo and in vitro models, and using various experimental methods including immune cell co-culture and CFSE staining, results showed that during chronic HBV infection, macrophage IRE1α expression is upregulated, leading to decreased CCL5 secretion by regulating macrophage anti-inflammatory polarization, thereby weakening HBV-specific CD8+ secretion. + The recruitment and function of T cells shape a microenvironment conducive to sustained viral immune tolerance.

[0098] Compound C9, screened using the method of this invention, exhibits concentration-dependent inhibition of HBsAg and HBeAg, effectively inhibiting Total HBV RNA, HBV 3.5kb RNA, and HBV DNA, and significantly reducing intracellular HBcAg expression levels. Molecular docking simulations show a binding energy of -8.3 kcal / mol, and molecular docking and surface plasmon resonance (SPR) experiments determined the equilibrium dissociation constant (KD) of compound C9 binding to IRE1α protein to be 1.24 μM, confirming that compound C9 can bind to IRE1α protein and is a potential candidate for IRE1α inhibitor. Meanwhile, compounds C6, C7, and C10 also showed significant inhibitory effects on HBeAg, while the IRE1α kinase inhibitor APY29 inhibited both HBsAg and HBeAg. Based on the above-mentioned activity characteristics, the present invention summarizes the general formula structures shown in Formula IV. These structures collectively retain the key pharmacophore necessary for binding with IRE1α, and therefore all have the potential to inhibit IRE1α and be used for anti-HBV treatment.

[0099] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Application of IRE1α protein or its encoding gene as a therapeutic target for hepatitis B virus infection.

2. The application according to claim 1, characterized in that, The IRE1α protein or its encoding gene exerts its antiviral effect through at least one of the following mechanisms: (a) regulating macrophage polarization; (b) regulating HBV-specific CD8. + T-cell function enables antiviral activity.

3. The application according to claim 2, characterized in that, The regulation of HBV-specific CD8 + T cell functions include: inhibiting CCL5 secretion and weakening HBV-specific CD8+. + T cell recruitment and cytotoxic function.

4. A method for screening inhibitors targeting the IRE1α protein, characterized in that, Includes the following steps: Step 1: Select the crystal structure of the IRE1α protein domain from the PDB database, perform preprocessing and energy minimization, and use virtual screening technology to dock, score and cluster the molecules in the Specs and ChemDiv libraries to screen out a variety of candidate compounds. Step 2: Detect the cytotoxicity of the candidate compounds to THP-1 cells and determine the highest concentration at which each candidate compound has no significant toxicity to THP-1 cells; Step 3: PMA-induced THP-1 macrophages were co-incubated with the candidate compound, and then subjected to HepG2.2.15 and CD8... + The T-cell co-culture system was used to detect HBsAg and HBeAg levels, assess anti-hepatitis B activity, and the selected compounds were the inhibitors targeting the IRE1α protein.

5. An inhibitor targeting the IRE1α protein screened using the screening method described in claim 4, characterized in that, The inhibitor is selected from compounds represented by any of the following general formulas I to V, their pharmaceutically acceptable salts, esters, solvates, or prodrugs; 。 6. The inhibitor targeting IRE1α protein according to claim 5, characterized in that, The inhibitor is a compound of formula IV, or a pharmaceutically acceptable salt, ester, solvate, or prodrug thereof.

7. The use of the inhibitor targeting IRE1α protein as described in claim 5 or 6 in the preparation of a medicament for the prevention and / or treatment of hepatitis B virus infection.

8. The application according to claim 7, characterized in that, The inhibitor targeting the IRE1α protein achieves its anti-HBV effect through at least one of the following mechanisms: (1) Inhibits IRE1α protein activity; (2) Inhibit IRE1α protein expression.

9. A pharmaceutical composition for the prevention and / or treatment of hepatitis B virus infection, characterized in that, The invention comprises a therapeutically effective amount of the inhibitor targeting the IRE1α protein as described in claim 5 or 6, and a pharmaceutically acceptable carrier or excipient.

10. The pharmaceutical composition according to claim 9, characterized in that, The pharmaceutical composition also contains a therapeutically effective amount of entecavir.

Images