A method for improving the symbiotic nitrogen fixation ability of legumes using soybean rhizobia

Abstract

The present invention provides a method for improving the symbiotic nitrogen fixation ability of legumes using soybean rhizobia, belonging to the field of microbial technology. The method for improving the symbiotic nitrogen fixation ability of legumes using soybean rhizobia is achieved by the following steps: isolating and purifying rhizobia; extracting total DNA of rhizobia, amplifying the 16S rDNA gene sequence, and performing gene sequence comparison on the NCBI website; and screening rhizobia for back-inoculation and nodulation. The method provided by the present invention has the effect of promoting the growth of soybean plants. The promoting effect is reflected in increasing the number of soybean nodules, plant height, and root length, and also increasing the fresh weight of the plant and the fresh weight of the roots. It has important application value in promoting soybean cultivation and production.

Description

Technical Field

[0001] The invention relates to a method for improving the symbiotic nitrogen-fixing ability of legumes, and belongs to the technical field of microorganisms. Background Art

[0002] In soybean production, high yields are influenced by multiple factors, including genotype, symbiotic rhizobia, biophysical environment, and agronomic management. Symbiotic nitrogen fixation is a crucial process, closely linked to high soybean yields. Soybeans have a high nitrogen demand, and symbiotic nitrogen fixation can meet their growth needs while reducing reliance on industrial nitrogen fertilizers, boosting soil microbial activity, and improving soil properties. To better utilize symbiotic nitrogen fixation, countries are intensifying research on both theoretical and technological fronts, with rhizobium agents attracting widespread attention.

[0003] Rhizobia establish a symbiotic relationship with soybeans, forming root nodules that fix nitrogen in the air and convert it into ammoniacal nitrogen that the plant can use. In this process, the use of rhizobia can improve the nitrogen supply in soybeans and increase yields. Research on rhizobia agents uses advanced molecular research techniques to identify and classify rhizobia, uncovering more rhizobia resources.

[0004] Based on the host plant specificity and phylogenetic type of symbiotic genes, rhizobia can be divided into different genera, such as Azorhizobium, Bradyrhizobium, Mesorhizobium, Rhizobium, and Sinorhizobium.

[0005] Legumes face environmental pressures, and rhizobia must adapt to both the host and the environment. Only rhizobia strains that are well-adapted to the local environment are likely to survive. Therefore, the symbiotic relationship between legumes and nodules is a multifaceted process, fostered through the coordinated efforts of the host plant, key genes regulating the symbiotic effect, and environmental factors, exhibiting both diversity and heterogeneity. Screening for high-affinity rhizobia within the ecological zones where major soybean varieties are being promoted is one effective approach to achieving efficient symbiotic nitrogen fixation in the field.

[0006] Due to differences in soybean varieties and root microbial communities across different ecological zones, the effectiveness of externally applied rhizobia inoculations is often difficult to achieve. Currently, rhizobia inoculations cover less than 8% of soybean cultivation in China. This is primarily due to a lack of highly effective rhizobia resources compatible with the main cultivated varieties, resulting in inefficient rhizobia inoculation techniques and a certain impact on soybean yields.

[0007] Therefore, it is crucial to screen soybean rhizobia with high affinity to local soybean varieties and adapted to local conditions. This helps ensure the adaptability of rhizobia agents, improve symbiotic effects, and ultimately promote high soybean yields. Summary of the Invention

[0008] The present invention aims to solve the problem that the existing rhizobium inoculation technology has low efficiency and has a certain impact on soybean yield, and further provides a method for improving the symbiotic nitrogen fixation ability of legumes by utilizing soybean rhizobia.

[0009] In order to achieve the above technical objectives, the present invention relates to the following technical solutions:

[0010] The steps of the present invention include:

[0011] Step 1, isolating and purifying rhizobia;

[0012] Step 2: extract total DNA from rhizobia, amplify 16S rDNA gene sequence, and compare gene sequences on the NCBI website;

[0013] Step 3: Re-inoculation of rhizobia and nodulation.

[0014] Preferably, the step of separating and purifying nodules in step 1 comprises:

[0015] Step 101: In a clean bench, use sterilized scissors to cut fresh, plump nodules, and wash the nodules in sterile water for 3 to 5 times to remove any stains on the nodules' surfaces.

[0016] Step 102: Place the nodules in a disinfectant for disinfection, and rinse repeatedly with sterile water several times until the surface of the nodules is cleaned;

[0017] Step 103: Cut the nodule in half with a sterilized knife to expose the internal structure of the rhizobium, clamp the nodule with sterilized tweezers, and streak it on YMA medium;

[0018] Step 104: Select colonies that meet the characteristics of rhizobium colonies based on their morphology, viscosity, color, borders, and other apparent characteristics, and perform plate streaking separation multiple times until the single colonies are phenotypically consistent, thereby preliminarily obtaining purified single colonies.

[0019] Preferably, in step 102, the nodules are first immersed in anhydrous ethanol for disinfection for 3 to 5 minutes, and then immersed in 3.5% NaClO for disinfection for 8 minutes.

[0020] Preferably, the culture medium streaked in step 103 is placed in a constant temperature incubator at 28° C. and cultured, and clear colonies grow after 2 to 3 days.

[0021] Preferably, the step of extracting total DNA of rhizobia in step 2 comprises:

[0022] Step 201: extracting, separating and purifying the total DNA of rhizobia using the TIANamp Bacteria DNA Kit;

[0023] Step 202: PCR amplification is performed on the total genomic DNA of Rhizobium using primers for amplifying the conserved region of the existing 16S rDNA gene of Rhizobium as a template to detect the target gene band by agarose gel electrophoresis;

[0024] Step 203: Finally, the PCR product is sequenced.

[0025] Preferably, the back-nodulation of rhizobia in step 3 is achieved by the following steps:

[0026] Step 301: preparing a bacterial suspension;

[0027] Step 302, potting medium: the vermiculite used as the culture medium is sterilized in a high pressure steam sterilizer at 121° C. for 30 minutes;

[0028] Step 303: Nodulation experiment;

[0029] Step 304: Determine the symbiotic index.

[0030] Preferably, the step of preparing the bacterial suspension in step 301 includes:

[0031] Step 3011: Streak the soybean rhizobium JMS3-5-1 on a YMA plate with resistance, and culture it in a constant temperature incubator at 28° C. until clear colonies grow;

[0032] Step 3012: simultaneously selecting Bradyrhizobium USDA110 and Fast-growing Rhizobium HH103 as controls;

[0033] Step 3013: Pick a few colonies from each type of rhizobium plate and place them in YMA liquid culture medium, culture them with shaking at 28°C, collect the bacteria by centrifugation, and resuspend the bacteria in sterile water to an OD value of 0.8-1.0 to prepare a bacterial suspension.

[0034] Preferably, the nodulation experiment in step 303 comprises the following steps: fresh and plump Heihe 43 seeds of uniform size are cleaned with sterile water, adsorbed on water-soaked sterilized filter paper, and placed in a greenhouse for germination; after 1 to 2 days, strong and uniformly growing soybean seedlings are selected and planted in pots filled with sterilized vermiculite; a suspension of rhizobia is inoculated along the roots of each plant using a pipette; the temperature in the plant culture room is maintained at 25° C.; and the plants are harvested 3 days, 18 days, and 28 days after inoculation to investigate the symbiotic phenotype.

[0035] Preferably, the method for determining the symbiotic index in step 304 is:

[0036] Root length: Wash the roots with clean water and use a ruler to measure the length from the bottom of the plant rhizome to the root tip in cm;

[0037] Plant height: Use a ruler to measure the length from the top to the bottom of the plant stem in cm;

[0038] Fresh root weight: clean the roots, dry them and weigh them with an electronic balance in g.

[0039] Fresh weight of aboveground part of plant: weigh the fresh weight of aboveground part of soybean plant using an electronic balance in g;

[0040] Nodule number: Wash the roots of each soybean plant with clean water, then carefully peel off the nodules and count them;

[0041] The beneficial effects of the present invention are:

[0042] 1. The method provided by the present invention for improving the symbiotic nitrogen fixation ability of legumes by utilizing soybean rhizobia can significantly promote the growth of plant height and root length, and also increase the fresh weight of plants and roots, and can effectively promote the number of soybean nodules, thereby achieving the effect of promoting growth and increasing yield.

[0043] 2. The above technical solution was used in the Heihe 43 high-yield demonstration field of the Jiamusi Branch of the Heilongjiang Academy of Agricultural Sciences to carry out a study on the effect of rhizobium (Rhizobium sp.) JMS3-5-1 application in the field. The results were good and it has a good development and application prospect.

[0044] 3. Based on the synergistically excellent phenotypes of the promoted varieties, including high yield, multi-resistance, and high nodulation and nitrogen fixation, in the demonstration and promotion areas, this study screened for highly efficient rhizobia with high affinity for these varieties. This research approach and results provide an important theoretical foundation for enriching rhizobia strain resources and guiding the efficient implementation of symbiotic nitrogen fixation in soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a flow chart of the method for improving the symbiotic nitrogen fixation ability of legumes using soybean rhizobia according to the present invention;

[0046] Figure 2 The growth of the rhizobium JMS3-5-1 colony in the present invention;

[0047] Figure 3 is the 16S rDNA sequence of the rhizobium JMS3-5-1 of the present invention;

[0048] Figure 4 Other sequences found in the sequence alignment process of the present invention that have significant similarity to the Rhizobium JMS3-5-1 sequence;

[0049] Figure 5 is a phylogenetic tree diagram of the 16S rDNA sequence of the rhizobium JMS3-5-1 of the present invention;

[0050] Figure 6 This is the phenotype of the seedlings grown 18 days after infection in the present invention;

[0051] Figure 7 This is the phenotype of the seedlings grown 28 days after infection in the present invention;

[0052] Figure 8 This is the phenotype of the seedling roots 18 days after infection in the present invention;

[0053] Figure 9 This is the phenotype of the seedling roots 28 days after infection in the present invention;

[0054] Figure 10 This is a comparison of the root length and plant height 3 days, 18 days, and 28 days after infection in the present invention;

[0055] Figure 11 This is a comparison chart of the root fresh weight and total fresh weight after 3 days, 18 days, and 28 days of infection in the present invention;

[0056] Figure 12 This is a comparison chart of the nodule numbers after 18 and 28 days of infection in the present invention. DETAILED DESCRIPTION

[0057] The present invention will be further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0058] like Figure 1 As shown, in a specific embodiment of the present invention, a method for improving the symbiotic nitrogen fixation ability of legumes using soybean rhizobia is carried out according to the following steps.

[0059] Step 1, separation and purification of rhizobia.

[0060] Step 2: Extract total DNA of rhizobia, amplify 16S rDNA gene sequence, and compare gene sequences on the NCBI website.

[0061] Step 3: Re-inoculation of rhizobia and nodulation.

[0062] Fresh, plump soybean nodules were collected from the high-yield demonstration field of Heihe 43 (a soybean variety) at the Jiamusi Branch of the Heilongjiang Academy of Agricultural Sciences. Isolation and purification were performed using the following steps to obtain a preliminarily purified single colony and a soybean rhizobium strain, named Rhizobium sp. JMS3-5-1.

[0063] The Rhizobium sp. JMS3-5-1 was deposited at the China General Microbiology Center (CGMCC) on April 25, 2023. The address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC No. 27196.

[0064] The specific steps for isolating and purifying rhizobia are as follows:

[0065] The surface of the fresh, plump soybean nodules collected was disinfected. To ensure the sterility of the operating environment, the operation was carried out in a clean bench and sterilized tools and reagents were used.

[0066] Step 101: In a clean bench, use sterilized scissors to cut the collected fresh and plump soybean nodules, and wash the soybean nodules in sterile water for 3 to 5 times to clean and remove stains on the surface of the soybean nodules.

[0067] Step 102: Soak the soybean nodules in anhydrous ethanol for 3-5 minutes and then in a 3.5% NaClO solution for 8 minutes. Then, rinse the soybean nodules repeatedly with sterile water several times until the surface of the soybean nodules is clean (including removing residual disinfectant).

[0068] In step 103, the soybean nodules are first cut in half using a sterilized knife to expose the internal structure of the rhizobia. Sterilized tweezers are then used to grasp the nodules and streak them onto YMA medium. Finally, the streaked medium is placed in a 28°C incubator and incubated for 2-3 days. Clear rhizobia colonies are then inspected for growth.

[0069] The method for culturing the rhizobium comprises inoculating the rhizobium into a YMA (yeast mannitol agar) medium for culturing. The formula and preparation method of the rhizobium culture medium used in the present invention are as follows:

[0070] The rhizobium culture medium used in the present invention is yeast mannitol agar (YMA).

[0071] (1) Liquid culture medium (YMA liquid culture medium) formula:

[0072] The YMA liquid medium specifically comprises: 10.0 g mannitol, 0.4 g yeast extract, 0.5 g K2HPO4 (dipotassium hydrogen phosphate), 0.2 g MgSO4·7H2O, 0.1 g NaCl, and 1000 ml distilled water. The pH is adjusted to 6.8-7.0. Finally, the medium is sterilized at 121°C for 30 minutes.

[0073] (2) Preparation of solid culture medium (YMA solid culture medium):

[0074] On the basis of YMA liquid culture medium, 1.5-2% agar was added.

[0075] Add 10 ml of 0.5% Congo red and sterilize at 121°C for 30 minutes to prepare a solid plate for isolating, culturing and studying rhizobia.

[0076] When cultured on YMA medium, rhizobia strains form single colonies, typically 3 to 8 mm in diameter. The colonies are round with neat edges and a slightly raised center. They are translucent, milky white, and contain mucus, making them quite sticky.

[0077] In step 104, colonies that meet the characteristics of rhizobium colonies are selected based on their appearance, such as colony morphology, viscosity, color, and borders, and are streaked multiple times on plates to ensure the degree of purification until a single, consistent single colony phenotype is obtained, thereby achieving the purpose of obtaining a preliminarily purified single colony.

[0078] A single colony was picked and streaked twice on new YMA medium for purification. A single colony was picked and transferred to YMA slant, and the obtained strain was named JMS3-5-1.

[0079] The characteristics of the rhizobium JMS3-5-1 are as follows:

[0080] 1) Morphological characteristics:

[0081] like Figure 2 As shown, the rhizobium JMS3-5-1 has moist, smooth, viscous, and translucent colonies, and has neat colony edges and a slightly raised center. Its growth phenotype is consistent with the basic characteristics of rhizobia.

[0082] 2) Cultivation characteristics:

[0083] Bradyrhizobium USDA110 and fast-growing rhizobium HH103 were selected as controls to preliminarily classify rhizobium JMS3-5-1. The three rhizobia were streaked on YMA plates and their growth was observed after 2-3 days of culture.

[0084] If it is fast-growing rhizobia, it needs to be cultured for 2 to 3 days, and if it is slow-growing rhizobia, it needs to be cultured for 5 to 7 days.

[0085] Results JMS3-5-1 had the same phenotype as the fast-growing rhizobium HH103 and grew faster.

[0086] Therefore, JMS3-5-1 was preliminarily identified as a fast-growing rhizobium.

[0087] Extract total DNA from purified rhizobia, perform agarose gel electrophoresis, amplify the 16S rDNA gene by PCR, sequence the PCR product, and ultimately identify the rhizobia by comparing the sequence with sequences in the GenBank database. The specific steps for extracting total rhizobia DNA, amplifying the 16S rDNA gene sequence, and comparing the gene sequence on the NCBI website are as follows:

[0088] Step 201, extracting total DNA from the isolated and purified rhizobium ITS sequence using the TIANamp Bacteria DNA Kit (spin column type);

[0089] Step 202 , performing agarose gel electrophoresis on the extracted total DNA; a single bright band is observed after electrophoresis on a 1.0% agarose gel; PCR amplification is performed using primers targeting the conserved region of the rhizobium 16S rDNA gene, using the total DNA of the rhizobium as a template, to detect the target gene band;

[0090] The total volume of the PCR amplification reaction was 50 μL, including 2 μL of DNA template, 2 μL of each primer (i.e., 2 μL each of the forward primer and the reverse primer), 19 μL of ddH2O (deionized water), and 25 μL of I-5TM 2X high-Fidelity Mix enzyme (polymerase mixture).

[0091] The PCR amplification reaction program performed included 34 cycles of pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1.5 min, followed by extension at 72°C for 5 min and storage at 12°C.

[0092] Primer sequence (5'-3'):

[0093] The primers for the 16S rDNA gene were used, including AGAGTTTGATCCTGGCTCAG for 16S rDNA-F and AAGGAGGTGATCCAGCC for 16SrDNA-R;

[0094] Step 203, the target gene band obtained by PCR amplification (i.e., PCR product) is sequenced. The PCR product sequencing results show that the 16S rDNA gene sequence of Rhizobium JMS3-5-1 is as follows Figure 3 , and the gene sequence length is 1420bp.

[0095] The PCR products were sent to Shanghai Bioengineering for sequencing. The 16S rDNA gene sequence obtained by sequencing was compared with the species sequence in the National Center for Biotechnology Information (NCBI) GenBank database using the Blast program (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) ( Figure 4 ); strain sequences with high similarity to the isolates were retrieved from the NCBI sequence database and the phylogenetic tree was constructed using the neighbor-joining method in MEGA software (e.g. Figure 5 ), and preliminary classification and identification of the isolated rhizobium strains were performed; the results showed that the conserved 16S rDNA sequence of JMS3-5-1 had a sequence similarity of 99.0% with those of Rhizobium leucaenae NR 118993.1 and Rhizobium leucaenae NR 116335.1, thus confirming that strain JMS3-5-1 was Rhizobium sp. (Rhizobium genus);

[0096] This strain was deposited at the General Microbiology Center of the China Culture Collection of Microorganisms (CGMCC) on April 25, 2023. Its address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. The deposit number is CGMCC No. 27196.

[0097] To evaluate the effects of Rhizobium leucaenae JMS3-5-1 on plant symbiosis, a nodulation experiment was conducted. The nodulation experiment was conducted in the plant culture room of the Institute of Microbiology, Heilongjiang Academy of Sciences. The specific steps for nodulation by rhizobium nodulation are as follows:

[0098] Step 301, preparing a bacterial suspension;

[0099] The specific steps for preparing bacterial suspension are as follows:

[0100] Step 3011: Streak the soybean rhizobium JMS3-5-1 on a YMA plate with resistance, place the streaked medium in a 28°C constant temperature incubator, and wait for 2 to 3 days until clear colonies grow.

[0101] Step 3012, simultaneously select Bradyrhizobium USDA110 and Fast Rhizobium HH103 as controls, such as Figures 6 to 12 As shown; CK is the control (no addition), H or HH103 is infected with the fast-growing rhizobium HH103, and J or JMS3-5-1 is infected with the rhizobium JMS3-5-1.

[0102] Step 3013: Use sterilized tools to pick a few individual colonies from each type of rhizobium plate (culture medium); place the picked colonies in a culture dish containing YMA liquid culture medium; then culture at 28° C. with shaking to ensure that the bacteria are fully suspended in the culture medium; then centrifuge and collect the suspended bacteria to obtain a bacterial precipitate; resuspend the precipitated bacteria into a liquid using sterile water, and adjust the concentration of the suspension by measuring the optical density (OD value) to adjust the OD value to 0.8 to 1.0 to prepare a bacterial suspension;

[0103] Step 302, potting medium: vermiculite is used as the culture medium, and it is sterilized in a high-pressure steam sterilizer at a temperature of 121° C. for 30 minutes;

[0104] Step 303: Nodulation experiment; the specific operations are as follows:

[0105] (1) Wash fresh, plump Heihe 43 soybean seeds of uniform size with sterile water;

[0106] (2) Place the cleaned seeds on soaked sterilized filter paper in a greenhouse (temperature around 25°C) to allow the seeds to absorb water and germinate;

[0107] (3) After 1 to 2 days, select healthy and uniformly growing soybean seedlings and plant them in pots filled with sterilized vermiculite substrate;

[0108] (4) Use a pipette to inoculate different proportions of rhizobium suspension into the roots of each plant; the temperature in the plant culture room is maintained at 25°C;

[0109] (5) The plants were harvested 3 days, 18 days, and 28 days after inoculation to investigate their symbiotic phenotypes.

[0110] like Figure 6 and Figure 7 As shown in the figure, the comparison of seedling growth after 18 days and 28 days shows that the plant heights of rhizobia JMS3-5-1 and fast-growing rhizobia HH103 are higher than those of the control group (CK) whether 18 days after infection or 28 days after infection, and the plant height of rhizobia JMS3-5-1 is also higher than that of fast-growing rhizobia HH103.

[0111] like Figure 8 and Figure 9As shown in the figure, the comparison of the roots of the seedlings after 18 days showed that the root systems of the rhizobium JMS3-5-1 and the fast-growing rhizobium HH103 were more developed than those of the control group (CK) whether 18 days after infection or 28 days after infection, and the root system of the rhizobium JMS3-5-1 was more developed and dense than that of the fast-growing rhizobium HH103;

[0112] Step 304, measuring symbiotic indicators;

[0113] The specific measurement indicators are as follows:

[0114] root length, plant height, root fresh weight, plant aboveground fresh weight, and number of nodules;

[0115] The specific operations of each indicator are as follows:

[0116] Root length: Wash the roots with clean water and use a ruler to measure the length from the base of the plant rhizome to the root tip (in cm) to assess root growth;

[0117] Plant height: Use a ruler to measure the length from the top to the bottom of the plant stem (in cm) to assess the overall growth of the plant;

[0118] Root fresh weight: The roots were cleaned and dried, and the root weight (in g) was measured using an electronic balance to evaluate the effect of rhizobium symbiosis on plant root biomass.

[0119] Fresh weight of aboveground parts of soybean plants: The fresh weight of aboveground parts of soybean plants (in g) was measured using an electronic balance to assess the growth status of the plants.

[0120] Nodule number: Wash the roots of each soybean plant with clean water, then carefully peel off the nodules and count the number of nodules to evaluate the formation of nodules.

[0121] In the present invention, a control group (CK) was set up in which no rhizobium was infected, fast-growing rhizobium HH103 and rhizobium JMS3-5-1 were inoculated with Heihe 43. Their symbiotic matching abilities were compared in terms of root length, plant height, root fresh weight and total fresh weight.

[0122] The results of various indicators are as follows:

[0123] Root length: Root length data for the control group, rhizobium JMS3-5-1, and fast-growing rhizobium HH103, 3 days, 18 days, and 28 days after infection. (Each data is the average of three samples, in cm)

[0124] Table 1

[0125]

[0126] Plant height: Plant height data for the control group, rhizobium JMS3-5-1, and fast-growing rhizobium HH103 after infection for 3 days, 18 days, and 28 days, respectively. (Each data is the average of three samples, in cm)

[0127] Table 2

[0128]

[0129] Root fresh weight: Root fresh weight data for the control group, rhizobium JMS3-5-1, and fast-growing rhizobium HH103, 3 days, 18 days, and 28 days after infection. (Each data is the average of three samples, in g)

[0130] Table 3

[0131]

[0132] Total fresh weight: Total fresh weight of the control group, Rhizobium JMS3-5-1, and Fast-growing Rhizobium HH103, 3 days, 18 days, and 28 days after infection. (Each data is the average of three samples, in g)

[0133] Table 4

[0134]

[0135] Nodule count: Data for the control group, the rhizobium JMS3-5-1, and the fast-growing rhizobium HH103, 18 days after infection and 28 days after infection. (Each data is the average of three samples)

[0136] Table 5

[0137]

[0138]

[0139] Combining Table 1 and Table 2, we can obtain Figure 10 ; Combine Table 3 and Table 4 to obtain Figure 11 ; Obtained from Table 5 Figure 12 .

[0140] like Figure 10 As shown in the figure, the comparison of the root length and plant height 3 days, 18 days and 29 days after infection showed that 3 days after infection: the root length of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 were both longer than that of the control group (CK), and the root length of fast-growing rhizobium HH103 was significantly higher than that of rhizobium JMS3-5-1; the plant height of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 were both greater than that of the control group (CK), and the plant height of fast-growing rhizobium HH103 was greater than that of rhizobium JMS3-5-1.

[0141] 18 days after infection: the root length of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 were both shorter than that of the control group (CK), and the root length of rhizobium JMS3-5-1 was greater than that of fast-growing rhizobium HH103; the plant height of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 were both greater than that of the control group (CK), and the plant height of rhizobium JMS3-5-1 was greater than that of fast-growing rhizobium HH103.

[0142] 28 days after infection: the root length of rhizobium JMS3-5-1 was shorter than that of the control group (CK), and the root length of fast-growing rhizobium HH103 was longer than that of the control group (CK); the plant heights of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 were both greater than that of the control group (CK), and the plant height of rhizobium JMS3-5-1 was greater than that of fast-growing rhizobium HH103.

[0143] like Figure 11 As shown, 18 days after infection, the total fresh weight of the plants of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 were higher than that of the control group (CK), and the total fresh weight of the plants of rhizobium JMS3-5-1 was significantly higher than that of fast-growing rhizobium HH103.

[0144] After 28 days of infection, the total fresh weight of the plants of rhizobium JMS3-5-1 and fast-growing rhizobium HH103 was higher than that of the control group (CK), and the total fresh weight of the plants of rhizobium JMS3-5-1 was slightly higher than that of fast-growing rhizobium HH103.

[0145] like Figure 12 As shown, the comparison of the nodule number after 18 days of infection and the nodule number after 28 days of infection shows that, whether it is 18 days after infection or 28 days after infection, the rhizobium JMS3-5-1 shows a significantly higher number of nodules than the unadded and fast-growing rhizobium HH103.

[0146] The reason why the number of nodules after 28 days of infection is lower than that after 18 days of infection is that the results after 18 days and 28 days of infection are not from the same batch. Instead, they are from different batches, different plants, and different conditions. However, regardless of the batch, under the same parameters, the rhizobium JMS3-5-1 strain produced significantly more nodules than the unadulterated strain and the fast-growing rhizobium HH103 strain.

[0147] Adding rhizobia to a soybean rhizobium symbiotic system can promote stem elongation and root development, increasing the number of nodules. Adding JMS3-5-1 and HH103 to the Heihe 43 variety showed that JMS3-5-1 was significantly more effective than HH103.

[0148] The results of the back-grafting experiment showed that the best symbiotic effect was achieved in the Heihe 43 plant inoculated with Rhizobium leucaenae JMS3-5-1. Different types of Rhizobia can produce different symbiotic effects with the same host.

[0149] In this study, the symbiotic phenotypes of plants inoculated with HH103 and JMS3-5-1 were generally better than those of uninfected plants, while the plants infected with JMS3-5-1 were significantly better than those infected with HH103, and the yield and quality also showed a significant increase, indicating that Rhizobium leucaenae JMS3-5-1 is a highly efficient rhizobium for Heihe 43.

[0150] This study, by isolating a rhizobium strain from field nodules and verifying it through back-inoculation, provides a theoretical basis and guidance for the future application of rhizobium inoculation technology. The production of inoculants using soybean rhizobia screened in Heilongjiang Province represents a significant resource innovation for inoculant production in Heilongjiang Province.

[0151] The research results have enriched my country's rhizobium resources and provided an important theoretical basis for the promotion and application of soybean rhizobium mixed inoculation technology in the field and the study of its relationship with soybean high yield and multi-resistance.

[0152] Finally, it should be noted that the above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes using the technical content disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent replacement and improvement of the above embodiments made according to the technical essence of the present invention, within the spirit and principles of the present invention, without departing from the content of the technical solution of the present invention, shall still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A soybean rhizobium, characterized in that The rhizobium ( Rhizobium sp.) was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on April 25, 2023, with the deposit number CGMCC No.27196.

2. A method for improving the symbiotic nitrogen fixation ability of legumes using the soybean rhizobium according to claim 1, characterized in that: The specific steps of the method for improving the symbiotic nitrogen fixation ability of leguminous plants by using soybean rhizobia include: Step 1: Isolate and purify rhizobia; Step 2: Extract the total DNA of rhizobia, amplify the 16S rDNA gene sequence, and perform gene sequence alignment on the NCBI website; Step 3: Re-inoculate and nodulate rhizobia; The re-inoculation and nodulation of rhizobia are achieved through the following steps: Step 301: Prepare a bacterial suspension; Step 302: Potting substrate; The vermiculite used as the culture substrate is sterilized at 121 °C for 30 min in a high-pressure steam sterilizer; Step 303: Nodulation experiment; The specific operation is as follows: (1) Wash the fresh and plump Heihe 43 soybean seeds of the same size with sterile water; (2) In the greenhouse, place the washed seeds on a wet sterilized filter paper to allow the seeds to absorb water and germinate; (3) After 1-2 days, plant the selected strong and uniformly growing soybean seedlings in pots filled with sterilized vermiculite substrate; (4) Use a pipette to inoculate different proportions of rhizobia suspension to the roots of each plant; The temperature in the plant culture room is maintained at 25 °C; (5) Harvest the plants 3 days, 18 days, and 28 days after inoculation respectively, and investigate their symbiotic phenotypes; Step 304: Determine symbiotic indicators.

3. The method of claim 2, wherein: The steps for isolating and purifying rhizobia in Step 1 include: Step 101: In a laminar flow hood, use sterilized scissors to cut fresh and plump root nodules, place the root nodules in sterile water and wash them 3-5 times to wash away the stains on the surface of the root nodules; Step 102: First soak the root nodules in disinfectant, and repeatedly rinse them with sterile water several times until the medicine on the surface of the root nodules is washed clean; Step 103: Use a sterilized knife to cut the root nodules in half to expose the internal structure of the rhizobia, hold the root nodules with sterilized forceps, and streak on the YMA medium; Step 104: Through apparent characteristics, select colonies that conform to the colony characteristics of rhizobia and perform multiple streak plate isolations until the single colony phenotypes are consistent, and initially obtain purified single colonies. The apparent characteristics include colony morphology, viscosity, color, and boundary.

4. The method of claim 3, wherein: In Step 102, the root nodules are first soaked in absolute ethanol for disinfection for 3-5 min, and then placed in 3.5% NaClO for disinfection for 8 min.

5. The method of improving the symbiotic nitrogen fixation ability of legumes by utilizing soybean rhizobia according to claim 3, characterized in that: The streaked medium in Step 103 is placed in an incubator at 28 °C for incubation, and clear colonies grow after 2-3 days.

6. The method of claim 2, wherein: The steps for extracting the total DNA of rhizobia in Step 2 include: Step 201: Extract the total DNA of the isolated and purified rhizobia through the TIANamp Bacteria DNA Kit bacterial genomic DNA extraction kit; Step 202: Then detect it by agarose gel electrophoresis, and perform PCR amplification using the total genomic DNA of rhizobia as a template with reference to the sequence primers for amplifying the conserved region of the rhizobia 16S rDNA gene to detect the target gene band; Step 203: Finally, sequence the PCR product.

7. The method of claim 2, wherein: The steps for preparing a bacterial suspension in Step 301 include: Step 3011: Streak the soybean rhizobium JMS3-5-1 on a YMA plate with resistance, and culture it in a constant temperature incubator at 28° C. until clear colonies grow; Step 3012: simultaneously selecting Bradyrhizobium USDA110 and Fast Rhizobium HH103 as controls; Step 3013: Pick a few colonies from each type of rhizobium plate and place them in YMA liquid culture medium. Cultivate with shaking at 28° C., collect the bacteria by centrifugation, and resuspend the bacteria in sterile water to an OD value of 0.8-1.0 to prepare a bacterial suspension.

8. The method of claim 2, wherein: The nodulation experiment in step 303 is as follows: uniformly sized, fresh, and plump Heihe 43 seeds are cleaned with sterile water, adsorbed onto water-soaked sterilized filter paper, and placed in a greenhouse for germination; after 1-2 days, robust, uniformly growing soybean seedlings are selected and planted in pots filled with sterilized vermiculite; a suspension of rhizobia is inoculated along the roots of each plant using a pipette; the temperature in the plant incubation room is maintained at 25°C; and the seeds are harvested 3, 18, and 28 days after inoculation to investigate their symbiotic phenotype.

9. The method of claim 2, wherein: The method for determining the symbiotic index in step 304 is: Root length: Wash the roots with clean water and use a ruler to measure the length from the bottom of the plant rhizome to the root tip in cm; Plant height: Use a ruler to measure the length from the top to the bottom of the plant stem in cm; Fresh root weight: clean the roots, dry them and weigh them with an electronic balance in g. Fresh weight of aboveground part of plants: weigh the fresh weight of aboveground part of soybean plants using an electronic balance in g; Number of nodules: Wash the roots of each soybean plant with clean water, then carefully peel off the nodules and count them.

Images