Application of three haplotypes of OsGSK4 gene in regulating rice grain length

Abstract

The present invention belongs to the field of genetic engineering and discloses the application of three haplotypes of OsGSK4 gene in rice grain length regulation. The three haplotype information of the gene is shown in Table 1. Overexpression of OsGSK4 A It can increase the length and width of rice grains, which is beneficial to the genetic improvement of rice grain shape. B Knockout of OsGSK4 in Nanjing 9108 increased grain length. C The knockout grain length in Nipponbare was also significantly increased; the three haplotypes of the OsGSK4 gene of the present invention can be used for genetic improvement of rice yield traits.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and relates to the application of three haplotypes of rice grain length control gene OsGSK4. Background Art

[0002] Rice (Oryza sativa L.) is the staple food for more than half of the world's population. In order to meet the food demand of the growing population, it is of great significance to increase rice yield. The yield of a single rice plant is determined by the interaction of three key factors: the number of panicles per plant, the number of grains per panicle, and the grain weight (Sakamoto and Matsuoka, 2008). Among them, the grain weight depends on the grain size and the degree of filling. The grain size is determined by the grain length, grain width and grain thickness. In rice, the signal pathways regulating grain shape are relatively conservative. The summary analysis of the reported grain shape regulation-related genes shows that these regulatory pathways include G protein signaling pathway, mitogen-activated protein kinase (MAPK) signaling pathway, ubiquitin-proteasome pathway, plant hormone signaling pathway, transcriptional regulatory factors, etc. Studies have shown that there are also interactions between different grain shape regulatory pathways.

[0003] So far, many genes related to grain size have been cloned in rice, such as GS3, qGL3, GL4, and GL7, which regulate rice grain length. GS3 is the first major QTL regulating grain length and grain weight in rice (Fan et al., 2006). This gene encodes a transmembrane protein composed of five exons. Nonsense mutations in the second exon of all large-grain varieties lead to a 178-amino acid deletion at the C-terminus of the GS3 protein, and its protein translation terminates prematurely, indicating that GS3 negatively regulates grain length (Mao et al., 2010). qGL3 / GL3.1 encodes a serine / threonine phosphatase that belongs to the PPKL protein phosphatase family. qGL3 can dephosphorylate the brassinosteroid signaling negative regulator OsGSK3 to stabilize its expression and thus negatively regulate grain length and yield (Zhang et al., 2012; Gao et al., 2019). GL7 is the main QTL controlling rice grain length, which is located on chromosome 7 and encodes a protein homologous to the Arabidopsis LONGFOLIA protein. The up-regulation of GL7 can down-regulate the expression level of its adjacent negative regulatory factors, causing cells to elongate longitudinally, thereby increasing rice grain length and changing its appearance quality (Wang et al., 2015).

[0004] Grain width is one of the main grain-shape traits of rice. Currently, only a few QTLs have been cloned that regulate grain width in rice, including GW2, GW5, GW7, GW8, etc. GW2 is the first QTL cloned for grain width in rice. It is located on the short arm of chromosome 2 and encodes a ubiquitin ligase. GW2 negatively regulates cell division by anchoring substrates to the proteasome for degradation. Mutations in GW2 cannot recognize substrates, activate the division of husk cells, and increase grain width (Song et al., 2007). GW5 encodes a calmodulin-binding protein. Studies have shown that GW5 can interact with polyubiquitin, indicating that it may regulate grain width and weight through the ubiquitin-proteasome pathway (Duan et al., 2007; Weng et al., 2008).

[0005] At present, there are few reports of genes that control both grain length and width in rice. Improving both grain length and width can effectively increase rice grain weight. Our research group found that OsGSK4 can simultaneously participate in the regulation of rice grain length and width. In addition, OsGSK4 is also involved in the regulation of traits such as plant height and tillering. Summary of the invention

[0006] The purpose of the present invention is to disclose the genetic engineering application of three haplotypes of a gene OsGSK4 regulating rice grain length and rice grain length trait.

[0007] The present invention provides that OsGSK4 has two SNP significant difference sites, forming three haplotypes, which are respectively named OsGSK4 A 、OsGSK4 B 、OsGSK4 C , the three haplotypes of OsGSK4 play an important role in the regulation of rice grain length.

[0008] Specifically: Overexpression of OsGSK4 A It can increase rice grain length and increase OsGSK4 B Knockout of OsGSK4 in Nanjing 9108 significantly increased grain length. C Knockout in Nipponbare can also significantly increase grain length, indicating that the three haplotypes of OsGSK4 can be applied to the genetic improvement of rice grain shape.

[0009] The first object of the present invention is to provide an OsGSK4 gene haplotype, characterized in that the OsGSK4 gene CDS sequence genbank accession number is LOC_Os06g35530.1;

[0010] The OsGSK4 gene haplotype is selected from one of (1) to (3):

[0011] (1) OsGSK4 gene haplotype A (OsGSK4 A ) is the OsGSK4 gene CDS sequence where the 571 bp position is mutated to A and the 1072 bp position is mutated to C;

[0012] (2) OsGSK4 gene haplotype B (OsGSK4 B ) is the mutation of 1072bp in the CDS sequence of OsGSK4 gene to C;.

[0013] (3) OsGSK4 gene haplotype C (OsGSK4 C ) is the mutation of 1072bp in the CDS sequence of OsGSK4 gene to T.

[0014] The second object of the present invention is to provide an application of the aforementioned OsGSK4 gene haplotype in improving rice yield, wherein the application comprises one of the following (1) to (3):

[0015] (1) Overexpression of OsGSK4 haplotype A (OsGSK4 A ) can increase rice grain length, grain width, reduce plant height, and increase tillering number;

[0016] (2) Knockout of haplotype B containing OsGSK4 B ) can increase rice grain length, reduce plant height, and increase tiller number; currently, more than 600 rice varieties are known to contain OsGSK4 gene haplotype B. In a specific embodiment, 'Nanjing 9108' is a representative variety of OsGSK4 gene haplotype B.

[0017] (3) Knockout of haplotype C of OsGSK4 C ) rice varieties, can increase rice grain length, reduce plant height, and increase tillering number. At present, it is known that at least 160 rice varieties contain OsGSK4 gene haplotype C. In a specific embodiment, 'Nipponbare' is a representative variety of OsGSK4 gene haplotype C.

[0018] The third object of the present invention is to provide an application of an overexpression vector containing the aforementioned rice gene OsGSK4 haplotype A in improving rice yield.

[0019] Furthermore, the overexpression vector is obtained by inserting the gene coding region of the rice OsGSK4 haplotype A described in claim 1 into the KpnⅠ and SalⅠ restriction sites of the plant binary expression vector pCAMBIA1300s.

[0020] Beneficial Effects

[0021] The invention discloses the application of three haplotypes of OsGSK4 gene in grain genetic engineering. The gene is from rice (Oryza sativa L.), and overexpression of OsGSK4 A It can increase the length and width of rice grains, reduce plant height, increase the number of tillers, and replace OsGSK4 in Nanjing 9108 with B After knockout, the grain length increased significantly, the plant height decreased, and the number of tillers increased. C Knockout can also significantly increase grain length, reduce plant height, and increase tiller number. The three haplotypes of the OsGSK4 gene provided by the present invention are beneficial to the genetic improvement of rice grain shape and provide new resources for high-yield and high-quality rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 .Identification of OsGSK4 transgenic material, among which, Figure 1 A is OsGSK4 A Identification results of overexpressed materials; Figure 1 B is cr-osgsk4 B Materials and cr-osgsk4 C Identification results of the materials.

[0023] Figure 2 .OsGSK4 A Phenotypic analysis of overexpressing material

[0024] Figure 2 A.OsGSK4 A Comparison of grains between the overexpression strain and the wild type;

[0025] Figure 2 B.OsGSK4 A Comparison of plant types between the overexpression strain and the wild type;

[0026] Figure 2 C.OsGSK4 A Grain length statistics of overexpression lines;

[0027] Figure 2 D.OsGSK4 A Grain width statistics of overexpression lines;

[0028] Figure 2 E.OsGSK4 A Plant height statistics of overexpression lines;

[0029] Figure 2 F.OsGSK4 A Statistics of tiller numbers of overexpression lines.

[0030] Figure 3.cr-osgsk4 B Phenotypic analysis of materials

[0031] Figure 3 A.cr-osgsk4 B Comparison of grains between material strains and wild type;

[0032] Figure 3 B.cr-osgsk4 B Comparison of plant types between material strains and wild type;

[0033] Figure 3 C.cr-osgsk4 B Grain length statistics of materials;

[0034] Figure 3 D.cr-osgsk4 B Grain width statistics of materials;

[0035] Figure 3 E.cr-osgsk4 B Plant height statistics of the materials;

[0036] Figure 3 F.cr-osgsk4 B Statistical chart of tiller number of materials.

[0037] Figure 4 .cr-osgsk4 C Phenotypic analysis of materials

[0038] Figure 4 A.cr-osgsk4 C Comparison of grains between material strains and wild type;

[0039] Figure 4 B.cr-osgsk4 C Comparison of plant types between material strains and wild type;

[0040] Figure 4 C.cr-osgsk4 C Grain length statistics of materials;

[0041] Figure 4 D.cr-osgsk4 C Plant height statistics of the materials;

[0042] Figure 4 E.cr-osgsk4 C Statistical chart of tiller number of materials. DETAILED DESCRIPTION

[0043] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0044] Example 1 Haplotype analysis of OsGSK4 gene

[0045] There are two SNPs with significant differences in OsGSK4 in different rice varieties, forming three haplotypes, named OsGSK4 A 、OsGSK4 B 、OsGSK4 C (Table 1), including haplotype OsGSK4 A Among the variety materials, the number of indica rice is 1128, the number of japonica rice is 16, the average grain length of the materials is 8.735mm, and the representative variety is 9311; B Among the varieties, there are 29 indica rice and 610 japonica rice, with an average grain length of 8.723 mm. The representative variety is Nanjing 9108 (NJ9108); C Among the variety materials, the number of indica rice is 1, the number of japonica rice is 167, and the average grain length of the materials is 7.565 mm. The representative variety is Nipponbare (NIP).

[0046] Table 1 Haplotype analysis of OsGSK4

[0047]

[0048] Example 2 Construction of OsGSK4 overexpression and gene editing vector

[0049] (1) Overexpression vector construction:

[0050] 100 uniform and full seeds of rice variety 9311 were selected, disinfected with 10% sodium hypochlorite solution for 20 minutes, and rinsed with pure water 5 times. The seeds were soaked in pure water and sown in nutrient soil after they turned white. They were grown in an artificial climate incubator (16h light / 8h dark, 30℃ during the day and 26℃ at night). When the seedlings grew to the 3-4 leaf stage, samples of the aboveground parts of the rice seedlings were taken, and rice RNA was extracted according to the Trizol method of Invitrogen. The total RNA obtained that met the quality was further used to synthesize the first chain of cDNA. The synthesis of the first chain of cDNA was carried out according to the operation manual of the reverse transcription system of Vazyme.

[0051] The first strand of cDNA synthesized by reverse transcription was used as a template, and primer pairs: F1 (SEQ ID NO.1), R1 (SEQ ID NO.2) were used for PCR amplification. The cloned fragment was connected to the pEasy Blunt Simple vector and transformed into the Escherichia coli strain DH5α. The OsGSK4 AcDNA sequence of recombinant plasmid T-OsGSK4 A .

[0052] Based on the cDNA sequence of the rice OsGSK4 gene, a primer pair was designed to amplify the complete coding reading frame: F2 (SEQ ID NO.3), containing a KpnⅠ restriction endonuclease site, and R2 (SEQ ID NO.4), containing a SalⅠ restriction endonuclease site. The recombinant plasmid T-OsGSK4 obtained in step (2) with correct sequencing was used. A PCR amplification was performed using the PCR product as a template, and the amplified product was inserted between the KpnⅠ and SalⅠ restriction sites of the plant binary expression vector pCAMBIA1300s to obtain an overexpression vector.

[0053] Obtaining transgenic plants:

[0054] pCAMBIA1300s-OsGSK4 A The OE-OsGSK4 was obtained by heat shock into Agrobacterium strain EHA105 and Agrobacterium-mediated rice genetic transformation to integrate the T-DNA region of the overexpression vector into the genome of the japonica rice variety Nipponbare. A Genetically modified rice.

[0055] (2) Construction of gene editing vector:

[0056] In order to construct Nanjing 9108 (NJ9108, containing OsGSK4 B haplotype) and Nipponbare (NIP, containing OsGSK4 CThe gene editing materials for knocking out OsGSK4 in the background of two materials (haplotype) were first constructed using the CRISPR / Cas9 system to construct the gene editing vector of OsGSK4, and the target was selected in the exon region of OsGSK4. The target sequence was: SEQ ID NO. 5. Primers containing the target sequence OsGSK4-BsF (SEQ ID NO. 6), OsGSK4-BsR (SEQ ID NO. 7), OsGSK4-F0 (SEQ ID NO. 8), and OsGSK4-R0 (SEQ ID NO. 9) were designed, and the pCBC-MT1T2 plasmid was amplified using the above primers. The obtained fragment was ligated with the pBUE411 vector using T4 Ligase (NEB), and then transformed into DH5α competent cells, spread on Kana LB solid medium plates and cultured at 37°C for 24 hours. Positive single clones were amplified with primers OsU3-FD3 (SEQ ID NO.10) and TaU3-RD (SEQ ID NO.11), and sequenced and confirmed by OsU3-FD3 and TaU3-FD2 (SEQ ID NO.12). The bacterial solution that successfully aligned with the target sequence was used for propagation and transferred into Agrobacterium, which was transferred into callus tissues of NJ9108 and NIP materials to obtain cr-osgsk4 in the background of NJ9108 and NIP, respectively. B and cr-osgsk4 C of mutant material.

[0057] Example 3 Cultivation of Gene Editing and Overexpression Transgenic Lines of OsGSK4

[0058] The OE-OsGSK4 cultured in Example 1 that was positively verified was A 、cr-osgsk4 B 、cr-osgsk4 C Transgenic material plants and wild-type plants were planted at the Baima teaching base of Nanjing Agricultural University. Each plant line was planted in 3 rows, with 8 plants in each row, and conventional soil and fertilizer management was used. When the rice was yellow and ripe, the plant height and tiller number were measured. After the seeds matured, the harvested seeds were dried at 42℃ for 5 days and then analyzed for grain length.

[0059] Discovery of OE-OsGSK4 A The grain length of each plant in the treatment group was significantly longer than that of the wild type, the grain width was significantly increased, the plant height was shorter, and the number of tillers increased. Figure 2 shown.

[0060] In Nanjing 9108 (containing haplotype OsGSK4 B ) after knocking out OsGSK4, the grains of all plants in the treatment group increased significantly, the grain width did not change significantly, the number of tillers increased, and the plant height decreased. Figure 3 shown.

[0061] In Nipponbare (containing haplotype OsGSK4 C ) after knocking out OsGSK4, the grain size of each plant in the treatment group increased significantly, the number of tillers increased, and the plant height decreased. Figure 4 shown.

[0062] The primers or target sequences involved in the examples are as follows:

[0063] SEQ ID NO.1: CCACTACCCCGACTGC;

[0064] SEQ ID NO.2: GCAGCCGACGGATTACAAC;

[0065] SEQ ID NO.3: AGCTTTCGCGAGCTCGGTACCATGGCCGCGATGCCA;

[0066] SEQ ID NO.4: CTTGCATGCCTGCAGGTCGACCAAAACAATGAATTA;

[0067] SEQ ID NO.5: GGCCCGACCTTGCCGGGGCGG;

[0068] SEQ ID NO.6: AATAATGGTCTCAGGCGCCATGGCCGCGATGCCAGG;

[0069] SEQ ID NO.7: ATTATTGGTCTCTAAACCCTGGCATCGCGGCCATG;

[0070] SEQ ID NO.8: GCCATGGCCGCGATGCCAGGGTTTTAGAGCTAGAAATAGC;

[0071] SEQ ID NO.9: CCTGGCATCGCGGCCATGGCGCTTCTTGGTGCC;

[0072] SEQ ID NO.10: GACAGGCGTCTTCTACTGGTGCTAC;

[0073] SEQ ID NO.11: CTCACAAATTATCAGCACGCTAGTC;

[0074] SEQ ID NO. 12: TTGACTAGCGTGCTGATAATTTGTG.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of OsGSK4 gene in improving rice yield, characterized in that: The CDS sequence genbank accession number of the OsGSK4 gene is LOC_Os06g35530; the application includes one of the following (1) to (3): (1) Overexpression OsGSK4 A The invention can increase the length of rice grains, increase the width of grains, reduce plant height, and increase the number of tillers. OsGSK4 A The 571bp position of the CDS sequence of the OsGSK4 gene mutated from G to A, and the 1072bp position mutated from T to C; (2) Knockout includes OsGSK4 B The OsGSK4 gene in the rice variety can increase the rice grain length, reduce the plant height, and increase the number of tillers. OsGSK4 B The 1072bp position of the CDS sequence of the OsGSK4 gene mutated from T to C; (3) Knockout includes OsGSK4 C The OsGSK4 gene in the rice variety can increase the rice grain length, reduce the plant height, and increase the number of tillers. OsGSK4 C The CDS sequence GenBank accession number is LOC_Os06g35530.

2. Containing the substance described in claim 1 OsGSK4 A Application of overexpression vector in improving rice yield.

3. The use according to claim 2, characterized in that: The overexpression vector is the one described in claim 1 OsGSK4 A The gene coding region was inserted into the plant binary expression vector pCAMBIA1300s Kpn Ⅰ and Sal Obtained between restriction endonuclease Ⅰ cutting sites.

Images