Molecular marker related to cold tolerance of penaeus vannamei and application thereof

Abstract

This invention discloses a molecular marker associated with the cold resistance trait of Litopenaeus vannamei and its application. The molecular marker includes molecular marker A, molecular marker B, and molecular marker C. Molecular marker A is located on the sequence described in Sequence 1 of the sequence listing, and molecular markers B and C are located on the sequences described in Sequence 2 of the sequence listing. The molecular markers are significantly correlated with the cold resistance trait of Litopenaeus vannamei and can serve as functional markers for the cold resistance ability of Litopenaeus vannamei, thereby improving the efficiency of cold-resistant breeding of Litopenaeus vannamei. The method involves extracting genomic DNA from the muscle tissue of the Litopenaeus vannamei to be tested and using it as template DNA for PCR amplification and purification of the amplification products. Then, the obtained products are sequenced to determine the genotypes of molecular markers A, B, and C. Individuals with dominant genotypes are selected for Litopenaeus vannamei breeding, thereby accurately and efficiently breeding Litopenaeus vannamei varieties with strong cold resistance and stress tolerance.

Description

Technical Field

[0001] This invention belongs to the field of Litopenaeus vannamei breeding technology, specifically relating to a molecular marker related to the cold resistance trait of Litopenaeus vannamei and its application. Background Technology

[0002] South American white shrimp ( Litopenaeus vannamei The Pacific white shrimp (Litopenaeus vannamei), scientifically known as *Litopenaeus vannamei*, was originally distributed in the warm and tropical waters along the coast from northern Peru to the Gulf of Mexico. It is characterized by its large size, rapid growth, and high yield. Since its introduction to my country in 1988, it has quickly achieved fully artificial breeding and has been rapidly promoted for cultivation throughout the country, becoming the highest-yielding shrimp species in my country. Under artificial cultivation conditions, the Pacific white shrimp adapts to water temperatures of 16–38℃. Below 15℃, it basically stops feeding, and below 10℃, it exhibits lateral lying and mortality. In northern my country, the suitable cultivation period for Pacific white shrimp is short each year, while in southern my country, many shrimp farmers raise shrimp in winter to pursue higher prices during the Spring Festival, but they bear the risk of large-scale shrimp mortality due to sudden drops in water temperature during cold waves. Therefore, the breeding of cold-resistant varieties has become an urgent need for the Pacific white shrimp farming industry in both northern and southern my country.

[0003] With the development of molecular biology and genotyping technology, molecular marker technology based on trait-related functional genes has become one of the key technologies in aquatic genetic breeding. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by a single nucleotide variation at the genome level. It has advantages such as large number, wide distribution, strong representativeness, good genetic stability, and ease of high-throughput and highly automated detection and analysis. It has been widely used in the construction of animal and plant genetic maps, QTL mapping, and functional gene analysis, effectively promoting molecular marker-assisted breeding. However, there are few reports on the application of SNPs in the breeding of cold-resistant varieties of Litopenaeus vannamei. Summary of the Invention

[0004] To address the aforementioned shortcomings, this invention discloses a molecular marker related to the cold resistance trait of Litopenaeus vannamei and its application. The molecular marker is used as a functional marker for the cold resistance trait of Litopenaeus vannamei and is used to breed Litopenaeus vannamei varieties with excellent cold resistance traits.

[0005] This invention is achieved using the following technical solution:

[0006] A molecular marker associated with cold resistance in Litopenaeus vannamei includes molecular marker A, molecular marker B and molecular marker C;

[0007] The molecular marker A is located at the 158 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.158 A>C. The base at this site is A or C, and the mutation type is A / A homozygous, A / C heterozygous, or C / C homozygous.

[0008] The molecular marker B is located at the 172 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.172 T>C. The base at this site is T or C, and the mutation type is T / T homozygous, T / C heterozygous, or C / C homozygous.

[0009] The molecular marker C is located at the 205 bp site of the nucleotide sequence shown in sequence 2 of the sequence listing, denoted as D.205 A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0010] Sequence 1 in the sequence listing is the nucleotide sequence of the tetraspanin-3-like gene of Litopenaeus vannamei obtained by PCR amplification using upstream primer FA and downstream primer RA.

[0011] Sequence 2 in the sequence listing is the nucleotide sequence of the gene probable ATP-dependent RNA helicase DDX17 obtained by PCR amplification using upstream primer FB and downstream primer RB.

[0012] The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei mentioned above involves using molecular markers A, B, and C for the selective breeding of Litopenaeus vannamei. Specifically, this involves extracting genomic DNA from the muscle tissue of the Litopenaeus vannamei to be tested, using it as template DNA for PCR amplification and purification of the PCR amplification products, and then sequencing the obtained products to determine the genotypes of molecular markers A, B, and C.

[0013] When the genotype of molecular marker A is AA, select that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is TT, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is TT, select that individual as a backup parent for breeding Litopenaeus vannamei.

[0014] During the PCR amplification and PCR product purification process, the primer set used to detect the molecular marker A includes the following primers:

[0015] The sequence of the upstream primer FA is: ATCTACACTCAGGGGTGCTAT (Sequence 3 in the sequence listing);

[0016] The sequence of the downstream primer RA is: ATGGCAACTCACAAAACGCTAC (sequence 4 in the sequence listing).

[0017] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upstream primer FA at a concentration of 10 μmol / L, 2 μL of downstream primer RA at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0018] The PCR amplification reaction procedure includes the following steps:

[0019] S11. Pre-denaturate at 94℃ for 3 min;

[0020] S12. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 62℃ for 30s, and extension at 72℃ for 45s.

[0021] S13, extend at 72℃ for 10 minutes.

[0022] During the PCR amplification and PCR product purification process, the primer set used to detect molecular markers B and C includes the following primers:

[0023] The sequence of the upstream primer FB is: AACATTCCCAACCCCATTC (sequence 5 in the sequence listing);

[0024] The sequence of the downstream primer RB is: TCGGCAAGATTCCTCACCT (sequence 6 in the sequence listing).

[0025] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upstream primer FB at a concentration of 10 μmol / L, 2 μL of downstream primer RB at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0026] The PCR amplification reaction procedure includes the following steps:

[0027] S21. Pre-denaturate at 94℃ for 3 min;

[0028] S22. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s.

[0029] S23, extend at 72℃ for 10 minutes.

[0030] Compared with existing technologies, this technical solution has the following advantages:

[0031] This invention, based on the analysis and screening of the tetraspanin-3-like gene and the probable ATP-dependent RNA helicase DDX17 gene in Litopenaeus vannamei, provides SNP molecular markers closely related to the cold-resistance trait of Litopenaeus vannamei. These markers can be applied to the breeding of new cold-resistance varieties of Litopenaeus vannamei, which is beneficial for promoting research and application in the cold-resistance and stress-resistant aquaculture of Litopenaeus vannamei. Furthermore, the method of this invention for breeding cold-resistance Litopenaeus vannamei results in individuals with stable genotypes and no genetic differentiation, and the breeding efficiency and accuracy are high, providing a solid foundation for the research and improvement of Litopenaeus vannamei varieties. Attached Figure Description

[0032] Figure 1 This is a partial sequence (positions 148-169) of the product obtained from amplifying the tetraspanin-3-like gene in Example 1, showing the peak values ​​of AA, CA, and CC at the D.158 A>C site.

[0033] Figure 2 This is a partial sequence (positions 162-181) of the product obtained from amplifying the probable ATP-dependent RNA helicase DDX17 gene in Example 2, showing the CC, CT, and TT peaks at the D.172 T>C site.

[0034] Figure 3 This is a partial sequence (positions 195-215) of the product obtained from amplifying the probable ATP-dependent RNA helicase DDX17 gene in Example 2, showing the AA, AT, and TT peaks at the D.205 A>T site. Implementation

[0035] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.

[0036] Example 1: The screening process for molecular marker A related to the cold resistance trait of Litopenaeus vannamei described in this invention is as follows:

[0037] (1) 120 white shrimp weighing about 3 grams were selected and temporarily kept for 2 days. Then, a cold resistance experiment was conducted under the stress conditions of 9.5-10.5℃. The first 40 shrimp that died were designated as the low temperature sensitive group, and the last 40 shrimp that survived were designated as the low temperature tolerant group.

[0038] (2) Five white shrimp were randomly selected from the low temperature sensitive group and the low temperature tolerant group, muscle tissue was extracted and genomic DNA was extracted using the conventional phenol-form extraction method, and the obtained genomic DNA was stored at -20 °C for later use.

[0039] (3) Based on the tetraspanin-3-like gene sequence of Litopenaeus vannamei (gene accession number: LOC113812061), upstream primer FA and downstream primer RA were designed, and then the tetraspanin-3-like gene in the genomic DNA was amplified accordingly.

[0040] The sequence of the upstream primer FA is: ATCTACACTCAGGGGTGCTAT;

[0041] The sequence of the downstream primer RA is: ATGGCAACTCACAAAACGCTAC;

[0042] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upstream primer FA at a concentration of 10 μmol / L, 2 μL of downstream primer RA at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0043] The PCR amplification reaction procedure includes the following steps:

[0044] S11. Pre-denaturate at 94℃ for 3 min;

[0045] S12. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 62℃ for 30s, and extension at 72℃ for 45s.

[0046] S13, extend at 72℃ for 10 min;

[0047] (4) The PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis. The molecular marker A was screened. The molecular marker A is located at the 158 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, denoted as D.158 A>C. The base at this site is A or C, and the mutation type is A / A homozygous, A / C heterozygous, or C / C homozygous.

[0048] (5) Based on the obtained molecular marker A, the Litopenaeus vannamei in the low temperature sensitive group and the low temperature tolerant group were detected and genotyped according to the above method. The samples of different mutation types in the low temperature sensitive group and the low temperature tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The statistical results are shown in Table 1.

[0049] Table 1. Genotype and allele frequencies of molecular marker A

[0050]

[0051] The correlation between locus D.158 A>C and the cold tolerance trait in Litopenaeus vannamei was analyzed using the chi-square test method in SPSS 19.0 software. The results showed that at locus D.158 A>C, the distribution of the three different genotypes AA, CA, and CC was significantly associated with the cold tolerance trait (X). 2 =19.209, P= 0.000), and the two alleles A and C also showed an association with the cold hardiness trait (X). 2 =24.74, P=0.000); The results showed that the genotypic polymorphism of the molecular marker site D.158 A>C had a highly significant impact on the cold resistance trait of Litopenaeus vannamei, with individuals of the AA genotype showing better cold resistance than those of the CA and CC genotypes. Individuals with the AA genotype at the D.158 A>C site should be preferentially selected as broodstock for breeding cold-resistant Litopenaeus vannamei or for large-scale aquaculture.

[0052] Example 2: The molecular markers B and C related to the cold resistance trait of Litopenaeus vannamei described in this invention are processed as follows:

[0053] (1) 120 white shrimp weighing about 3 grams were selected and temporarily kept for 2 days. Then, a cold resistance experiment was conducted under the stress conditions of 9.5-10℃. The first 40 shrimp that died were designated as the low temperature sensitive group, and the last 40 shrimp that survived were designated as the low temperature tolerant group.

[0054] (2) Five white shrimp were randomly selected from the low temperature sensitive group and the low temperature tolerant group, muscle tissue was extracted and genomic DNA was extracted using the conventional phenol-form extraction method, and the obtained genomic DNA was stored at -20 °C for later use.

[0055] (3) Based on the gene sequence of probable ATP-dependent RNA helicase DDX17 in Litopenaeus vannamei (gene accession number: LOC113814743), upstream primer FB and downstream primer RB were designed, and then the probable ATP-dependent RNA helicase DDX17 gene in the genomic DNA was amplified accordingly.

[0056] The sequence of the upstream primer FB is: AACATTCCCAACCCCATTC;

[0057] The sequence of the downstream primer RB is: TCGGCAAGATTCCTCACCT;

[0058] The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upstream primer FB at a concentration of 10 μmol / L, 2 μL of downstream primer RB at a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0059] The PCR amplification reaction procedure includes the following steps:

[0060] S21. Pre-denaturate at 94℃ for 3 min;

[0061] S22. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s.

[0062] S23, extend at 72℃ for 10 minutes;

[0063] (4) The PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis. Molecular marker B and molecular marker C were screened. Molecular marker B is located at the 172 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.172T>C. The base at this site is T or C, and the mutation type is T / T homozygous, T / C heterozygous, or C / C homozygous. Molecular marker C is located at the 205 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, denoted as D.205A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous.

[0064] (5) Based on the obtained molecular markers B and C, the Litopenaeus vannamei in the low temperature sensitive group and the low temperature tolerant group were detected and genotyped according to the above method. The samples of different mutation types in the low temperature sensitive group and the low temperature tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The specific results are shown in Table 2 and Table 3.

[0065] Table 2. Genotype and allele frequencies of molecular marker B

[0066]

[0067] The correlation between locus D.172 T>C and cold tolerance in Litopenaeus vannamei was analyzed using the chi-square test in SPSS 19.0 software. The results showed that at locus D.172 T>C, the distributions of the three different genotypes (CC, CT, and TT) were significantly associated with cold tolerance (X-square test). 2 = 41.476, P = 0.000), and the two alleles C and T also showed an association with the cold hardiness trait (X). 2 = 32.258, P = 0.000); The results showed that the genotypic polymorphism of the molecular marker site D.172 T>C had a highly significant impact on the cold resistance trait of Litopenaeus vannamei, with individuals of the CC and CT genotypes exhibiting better cold resistance than those of the TT genotype. Individuals with the D.172 T>C site as CC or CT should be preferentially selected as broodstock for breeding cold-resistant Litopenaeus vannamei or for large-scale aquaculture, while individuals with the D.172 T>C site as TT should be avoided as broodstock or for large-scale aquaculture.

[0068] Table 3. Genotype and allele frequencies of molecular marker C

[0069]

[0070] The correlation between locus D.205 A>T and cold tolerance in Litopenaeus vannamei was analyzed using the chi-square test in SPSS 19.0 software. The results showed that at locus D.205 A>T, the distributions of the three different genotypes AA, AT, and TT were significantly associated with cold tolerance (X-square test). 2 = 29.630, P = 0.000), and the two alleles A and T also showed an association with the cold hardiness trait (X = 29.630, P = 0.000). 2 = 26.667, P = 0.000); The results showed that the genotypic polymorphism of the molecular marker site D.205A>T had a highly significant impact on the cold resistance trait of Litopenaeus vannamei, with the TT genotype individuals exhibiting better cold resistance than the AA genotype. Individuals with the D.205A>T site and the TT genotype should be preferentially selected as broodstock for breeding cold-resistant Litopenaeus vannamei or for large-scale aquaculture.

[0071] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Use of a molecular marker associated with cold tolerance traits in Penaeus vannamei, characterized by the fact that it is: The molecular markers include molecular marker A, molecular marker B, and molecular marker C; The molecular marker A is located at the 158 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, and the base at this site is either A or C; The molecular marker B is located at the 172 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, where the base is T or C; The molecular marker C is located at the 205 bp site of the nucleotide sequence shown in Sequence 2 of the sequence listing, and the base at this site is A or T; The application involves using molecular markers A, B, and C for the selective breeding of Litopenaeus vannamei with cold-resistant traits.

2. Use of a molecular marker associated with cold tolerance trait of Penaeus vannamei according to claim 1, characterized in that: Specifically, genomic DNA is extracted from the muscle tissue of the whiteleg shrimp to be tested, and then used as template DNA for PCR amplification and purification of the PCR amplification product. The obtained product is then sequenced to determine the genotype of molecular marker A, molecular marker B or molecular marker C. When the genotype of molecular marker A is AA, select that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is TT, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is TT, select that individual as a backup parent for breeding Litopenaeus vannamei.

3. The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei according to claim 2, characterized in that: During the PCR amplification and PCR product purification process, the primer set used to detect the molecular marker A includes the following primers: The sequence of the upstream primer FA is: ATCTACACTCAGGGGTGCTAT; The sequence of the downstream primer RA is: ATGGCAACTCACAAAACGCTAC.

4. The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei according to claim 3, characterized in that: The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upstream primer FA at a concentration of 10 μmol / L, 2 μL of downstream primer RA at a concentration of 10 μmol / L, and 20 μL of ddH2O.

5. The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei according to claim 3, characterized in that: The PCR amplification reaction procedure includes the following steps: S11. Pre-denaturate at 94℃ for 3 min; S12. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 62℃ for 30s, and extension at 72℃ for 45s. S13, extend at 72℃ for 10 minutes.

6. The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei according to claim 2, characterized in that: During the PCR amplification and PCR product purification process, the primer set used to detect molecular markers B and C includes the following primers: The sequence of the upstream primer FB is: AACATTCCCAACCCCATTC; The sequence of the downstream primer RB is: TCGGCAAGATTCCTCACCT.

7. The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei according to claim 6, characterized in that: The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of upstream primer FB at a concentration of 10 μmol / L, 2 μL of downstream primer RB at a concentration of 10 μmol / L, and 20 μL of ddH2O.

8. The application of the molecular markers related to the cold resistance trait of Litopenaeus vannamei according to claim 6, characterized in that: The PCR amplification reaction procedure includes the following steps: S21. Pre-denaturate at 94℃ for 3 min; S22. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 45s. S23, extend at 72℃ for 10 minutes.

Images