Pectin methylesterase inhibitor 8 gene for regulating brassica napus sclerotinia resistance and application thereof
By knocking out the BnPMEI8 gene in rapeseed, the degree of pectin methyl esterification and cell wall mechanical strength were enhanced, and the JA signaling pathway and genes related to hydrogen peroxide synthesis and degradation were regulated, solving the problem of breeding rapeseed resistance to Sclerotinia sclerotiorum disease and providing new genetic resources.
Patent Information
- Application Number
- CN202410009066.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-03
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2044-01-03
AI Technical Summary
In existing technologies, breeding rapeseed to resist Sclerotinia stem rot is time-consuming and lacks effective genetic sources. The key is to use genetic engineering technology to discover host cell wall resistance genes to enhance resistance, but the functional research on the pectin methyl esterase inhibitor PMEI8 is still not in-depth.
The BnPMEI8 sequence with the highest homology in Arabidopsis thaliana was screened out, and a CRISPR/Cas9 gene knockout vector was constructed. The BnPMEI8 gene was knocked out in Brassica napus Westar using Agrobacterium-mediated genetic transformation. Its function in resistance to Sclerotinia sclerotinia in Brassica napus was analyzed, including the regulation of pectin methyl ester content, PME activity, and JA signaling pathway-related genes.
Knocking out the BnPMEI8 gene increases the degree of pectin methyl esterification in rapeseed, enhances the mechanical strength of the cell wall, and participates in the resistance of rapeseed to Sclerotinia sclerotiorum through the JA signaling pathway and hydrogen peroxide synthesis and degradation-related genes, providing new genetic resources to enhance the ability to resist sclerotiorum sclerotiorum disease.
Smart Images

Figure BDA0004648609590000071 
Figure BDA0004648609590000072 
Figure BDA0004648609590000081
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically involving the BnPMEI8 gene, a pectin methyl esterase inhibitor that regulates resistance to sclerotinia stem rot in Brassica napus, and its application. Background Technology
[0002] Rapeseed is one of the world's most important oil crops and a major source of edible vegetable oil in my country, with high nutritional and economic value. Sclerotinia sclerotiorum rot is the most significant disease causing a decline in rapeseed production. It occurs in all regions of my country, but is most severe in the middle and lower reaches of the Yangtze River and the southeast coast, with an incidence rate of 10% to 80% and a yield loss of 5% to 30% (LIU SM, FU LY, CHEN JP, et al. Baselinesensitivity of Sclerotinia sclerotiorum to metconazole and the analysis of cross-resistance with carbendazim, dimethachlone, boscalid, fluazinam, and fludioxonil. Phytoparasitica, 2021, 49(1):123-130.). Studies have shown that from 2011 to 2021, the incidence of Sclerotinia sclerotinia in rapeseed in Ezhou City, Hubei Province, was very high in nine years except for 2013 (level 4-5). In eight years, the ratio of rapeseed sclerotinia afforestation area to rapeseed planting area reached over 80% (79.44% in 2012), and in six years it reached over 90% (Wu Jiang. Analysis of the causes and control strategies for the severe occurrence of rapeseed sclerotinia sclerotinia in Ezhou City. Hubei Plant Protection, 2022: 54-55). Furthermore, Sclerotinia sclerotinia can severely affect rapeseed yield and quality, leading to decreased oil production and changes in fatty acid composition.
[0003] *Sclerotinia sclerotiorum* is a necrotrophic plant pathogenic fungus with a complex pathogenic mechanism. It primarily infects rapeseed through hyphal invasion, but can also infect through germinating ascospores. Currently, a two-stage infection model for *Sclerotinia sclerotiorum* is widely accepted. Stage 1: Hyphae form infection spikes, which then penetrate the leaf cuticle and epidermal cell walls through stomata. Simultaneously, the tips of numerous hyphae on the leaf may locally accumulate cell wall degrading enzymes and defense inhibitors, accelerating the establishment of initial infection. Stage 2: Subcutaneous hyphae secrete pathogenic factors that kill rapeseed cells. After the infection spikes break through the cuticle, they spread horizontally below, forming bulb-like subcutaneous hyphae. At this stage, the hyphae secrete pathogenic factors such as oxalic acid, pectinase, and cellulase, which degrade the rapeseed cell walls, killing the rapeseed cells and causing sclerotinia rot. Studies have shown that changes in any component of the cell wall can alter a plant's response to external biotic and abiotic stresses. *Sclerotinia sclerotiorum* encodes as many as 183 plant cell wall degrading enzymes. These enzymes can degrade the host cell wall, destroying the host cell wall's protective epidermal tissue. The degraded substances can also provide nutrients for the colonization and growth of *Sclerotinia sclerotiorum* hyphae in the host. Therefore, the cell wall's defensive role is crucial in the infection process of *Sclerotinia sclerotiorum*. Currently, breeding disease-resistant crop varieties is the most economical and effective way to combat *Sclerotinia sclerotiorum*. However, hybridization breeding is time-consuming and lacks effective sources of resistance genetics. In contrast, transgenic breeding of crops using genetic engineering technology has wide applications and stable control effects. Therefore, continuously mining host cell wall resistance genes through gene editing technology to strengthen the host cell wall and enhance host resistance to *Sclerotinia sclerotiorum* can provide theoretical guidance and germplasm resources for the breeding of resistant varieties, and has important reference value for the safe production of rapeseed.
[0004] Pectin methylesterase inhibitors (PMEIs) are plant cell wall-related proteins that play a crucial regulatory role in the composition and structure of plant cell walls. PMEIs regulate pectin methylesterase (PME) activity through post-translational mechanisms, fine-tuning the balance of pectin polysaccharide methyl esterification modification to maintain cell wall integrity and biomechanical properties. Therefore, the methyl esterification state of pectin is essential for the properties and function of plant cell walls. Studies have shown that different PMEI genes can respond to the effects of abiotic stresses such as low temperature, drought, and salt stress through signal regulation via different hormonal pathways. For example, CbPMEI1 in alpine mustard increases the level of pectin methylesterase in the cell wall at low temperatures, regulating root growth (Chen J., Chen X., Zhang Q., et al. A cold-induced pectin methyl-esterase inhibitor gene contributes negatively to freezing tolerance but positively to salt tolerance in Arabidopsis, J Plant Physiol, 2018, 222:67-78.). PMEI also plays an important role in biotic stress. For example, plants with silenced CaPMEI1 in peppers are more susceptible to pathogens (An SH, Sohn KH, Choi HW, et al. Pepper pectin methylesterase inhibitor protein CaPMEI1 is required for antifungal activity, basal disease resistance and abiotic stress tolerance, Planta, 2008, 228(1):61-78.).In addition, the pectin methylesterase state regulated by PMEI can also play an important role in the resistance of plants to pathogens such as bacteria and fungi. Studies have shown that overexpression of AtPMEI-2 in Arabidopsis can delay the movement of radish vein clearance virus (TVCV) and reduce its sensitivity to the virus, proving that PMEIs not only affect PMEs that already exist in plants, but also inhibit the activity of virus- or fungus-induced PMEs (Lionetti V., Raiola A., Cervone F., et al. Transgenic expression of pectin methylesterase inhibitors limits to bamovirus spread into bacco and Arabidopsis. MolecuLar Plant Pathology, 2014, 15(3):265-274). Although studies on plant PMEI have found that this gene family can regulate host resistance to bacteria and fungi by altering the barrier function of the host cell wall, research on the disease resistance function of PMEI8 is still incomplete. There are no reports on whether PMEI8 can enhance rapeseed's resistance to sclerotinia stem rot, and its function needs further verification. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of existing technologies and provide an application of the pectin methyl esterase inhibitor BnPMEI8 gene in the resistance of rapeseed to Sclerotinia stem rot. Functional verification and transformation application of this gene were conducted. Based on Arabidopsis thaliana homologous sequence alignment, the BnPMEI8 sequence with the highest homology was selected. The nucleotide sequence of the gene is shown in SEQ ID NO: 1. A knockout vector of this gene was constructed, and knockout expression was performed in Brassica napus Westar using Agrobacterium-mediated genetic transformation. The transgenic plants were then inoculated with Sclerotinia stem rot. The disease resistance, pectin methyl esterification intensity, pectin methyl esterase activity, accumulation of endogenous reactive oxygen species in leaves, and detection of genes related to the jasmonic acid (JA) signaling pathway were analyzed. This rapidly identified its function in rapeseed resistance to Sclerotinia stem rot, providing a new genetic resource for breeding rapeseed resistant to Sclerotinia stem rot.
[0006] The technical solution of the present invention is as follows:
[0007] The applicant cloned a gene of BnPMEI8, a pectin methyl esterase inhibitor that regulates resistance to sclerotinia stem rot in rapeseed, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0008] The protein sequence encoded by the above-mentioned rapeseed pectin methyl esterase inhibitor BnPMEI8 gene, which regulates rapeseed resistance to sclerotinia stem rot, is shown in SEQ ID NO: 2.
[0009] The present invention relates to the application of the BnPMEI8 gene in regulating resistance to sclerotinia stem rot in rapeseed.
[0010] The more detailed technical solution is as follows:
[0011] The expression pattern of the PMEI8 gene family in rapeseed induced by Sclerotinia sclerotiorum was analyzed using RT-qPCR. Based on the gene expression induction, the target gene BnPMEI8 was finally determined (see...). Figure 1 ).
[0012] This invention uses pCBC-DT1DT2 (vector resistance is chloramphenicol) as the intermediate gene editing vector. Figure 2 Figure A in the diagram shows that pKSE401 (vector resistance is kanamycin) is the final gene editing vector. Figure 2 (Figure B in the original text) A CRISPR / Cas9-Bnpmei8 gene knockout vector for this gene was constructed. The applicant transformed the vector into Brassica napus Westar using Agrobacterium-mediated hypocotyl infection until regenerated differentiated seedlings were obtained. Genomic DNA was extracted from leaves of wild-type Brassica napus as a control and transgenic rapeseed lines using the CTAB method. PCR amplification and identification were performed using U626-IDF (5'TGTCCCAGGATTAGAATGATTAGGC 3') and U629-IDR (5'AGCCCTCTTCTTTCGATCCATCAAC 3') primers to screen for CRISPR / Cas9 knockout positive lines of this gene. Subsequently, the positive materials were sequenced and analyzed. Finally, a total of 32 positive seedlings were obtained. The above transgenic materials were self-pollinated to obtain higher generations as subsequent experimental materials.
[0013] This invention conducted an in vitro leaf inoculation experiment on BnPMEI8 transgenic material (CRISPR / Cas9 mutant line) with Sclerotinia sclerotiorum. The results showed that, compared with the control material, the lesion expansion area of all transgenic plants 36 hours after inoculation was smaller than the root mean (WT), indicating that knocking out the BnPMEI8 gene can improve the resistance of Brassica napus to Sclerotinia sclerotiorum. Figure 3 Pectin methyl ester content (DM) is an important parameter of pectin. Measurement of DM in the leaves of transgenic materials revealed that the DM of transgenic rapeseed plants was significantly enhanced compared to wild-type plants. This result indicates that the enhanced DM of BnPMEI8-Cas9 transgenic rapeseed leads to increased cell wall mechanical strength. Figure 4 Leaves surrounding lesions were collected 36 hours after inoculation with Sclerotinia sclerotiorum var. sclerotiorum. Pectin methyl esterase (PME) activity was measured. The results showed that the PME activity of the BnPMEI8-Cas9 transgenic lines (Bnpmei8-100 and Bnpmei8-83) was higher than that of the wild type both before and after inoculation, indicating that BnPMEI8 may be involved in regulating PME activity in rapeseed. Figure 5 The expression patterns of defense-related genes in transgenic plants inoculated with Sclerotinia sclerotiorum for 36 hours were analyzed by RT-qPCR. It was found that BnPMEI8 may transmit defense signals through a signal cascade reaction and negatively regulate the JA signaling pathway, thus participating in the resistance of rapeseed to Sclerotinia sclerotiorum. Figure 6 Leaves of wild-type and transgenic strains of BnPMEI8 were stained with diaminobenzidine (DAB) for 36 hours, and the H2O2 content was measured to observe the accumulation of H2O2 in the leaves. The results showed that the hydrogen peroxide content of the knockout BnPMEI8 strain was significantly lower than that of the wild-type strain. Figure 7 Further RT-qPCR revealed that, before inoculation with *Sclerotinia sclerotiorum*, the expression of hydrogen peroxide synthesis-related genes RobhF and superoxide dismutase CSD2 was downregulated in BnPMEI8-Cas9 transgenic plants, while the expression of related genes glutathione peroxidase (GPX6, GPX7), catalase CAT1, and ascorbate peroxidase APX1 was upregulated in BnPMEI8-Cas9 transgenic plants. Figure 8 Thirty-six hours after inoculation, the expression of superoxide dismutase (CSD2, CSD1) and oxidase (RbohF, RbohD) genes related to hydrogen peroxide synthesis was downregulated in BnPMEI8-Cas9 transgenic plants; while the expression of degradation-related genes glutathione peroxidase (GPX6, GPX7), catalase CAT1, and ascorbate peroxidase APX1 was upregulated in transgenic plants. Figure 9 The above results indicate that BnPMEI8 regulates genes related to hydrogen peroxide synthesis and degradation, which are involved in the interaction between rapeseed and Sclerotinia sclerotiorum. Therefore, BnPMEI8 negatively regulates rapeseed resistance to Sclerotinia sclerotiorum.
[0014] Advantages of this invention:
[0015] This invention analyzes the expression pattern of the pectin methyl esterase inhibitor gene in rapeseed induced by Sclerotinia stem rot, screening and identifying the BnPMEI8 gene. It was also discovered that BnPMEI8 is a negative regulator of rapeseed resistance to Sclerotinia stem rot; knocking out BnPMEI8 increases the degree of pectin methyl esterification in rapeseed, enhances cell wall mechanical strength, and thus improves the plant's disease resistance. Furthermore, BnPMEI8 can also participate in rapeseed resistance to Sclerotinia stem rot by regulating the JA signaling pathway and genes related to hydrogen peroxide synthesis and degradation. Through genetic transformation, new rapeseed lines resistant to Sclerotinia stem rot were obtained by deficient expression of this gene. BnPMEI8 can serve as a potential marker gene for rapeseed resistance materials. Attached Figure Description
[0016] Figure 1 Analysis of the expression patterns of BnPMEI family genes in wild-type Brassica napus after inoculation with Westar. (Figure labels are as follows:) Figure 1 The expression patterns of the genes BnPMEI8, BnPMEI9, BnPMEI10, and BnPMEI11 were analyzed at 0 h, 24 h, 48 h, and 72 h after inoculation of detached leaves with *Sclerotinia sclerotiorum* clumps in *Westar* wild-type *Brassica napus*. PDA culture blocks served as a blank control. The results indicate that BnPMEI8 may be a key gene mediating resistance to *Sclerotinia sclerotiorum* in *Brassica napus*.
[0017] Figure 2 Map of the vectors used to construct the CRISPR / Cas9 gene knockout vector. (Figure label explanation:) Figure 2 Figure A in the diagram is the pCBC-DT1DT2 vector map. Figure 2 Figure B in the diagram is the pKSE401 vector map.
[0018] Figure 3 Statistics on lesions in T1 generation BnPMEI8-Cas9 transgenic rapeseed 36 hours after inoculation. (Figure labeling explanation:) Figure 3 Figure A shows the phenotypic observation of the control material and the transgenic material 36 hours after inoculation with Sclerotinia sclerotiorum. Figure 3 Figure B shows the statistical results of plaque area. The results indicate that, compared with the control material, interfering with the BnPMEI8 gene can improve the resistance of Brassica napus to Sclerotinia sclerotiorum.
[0019] Figure 4 Determination of pectin methyl ester (DM) content in BnPMEI8-Cas9 transgenic plants. (Figure labeling explanation:) Figure 4 The results show the pectin methyl ester (DM) content of the transgenic plants. Compared with the wild type, the DM content of the leaves of the transgenic rapeseed plants Bnpmei8-83 and Bnpmei8-100 was significantly enhanced. This result indicates that the BnPMEI8-Cas9 transgenic rapeseed has enhanced pectin methyl ester content and increased cell wall strength.
[0020] Figure 5 Determination of post-inoculation methyl esterase activity in BnPMEI8-Cas9 transgenic rapeseed before inoculation. (Figure labeling explanation:) Figure 5 The results show the PME activity assay in BnPMEI8-Cas9 transgenic plants. Before and after inoculation, the PME activity of the BnPMEI8-Cas9 transgenic lines (Bnpmei8-100 and Bnpmei8-83) was higher than that of the wild type. This result suggests that BnPMEI8 may be involved in regulating PME activity in rapeseed.
[0021] Figure 6 Analysis of disease resistance-related gene expression in control and transgenic materials 36 hours after inoculation with *Sclerotinia sclerotiorum*. Figure labeling explanation: Figure 8This study measured the expression levels of disease resistance-related genes in control and transgenic materials 36 hours after inoculation with *Sclerotinia sclerotiorum*. The results showed that BnPMEI8 may transmit defense signals through a signal cascade reaction and negatively regulate the JA signaling pathway, thus participating in rapeseed resistance to *Sclerotinia sclerotiorum*.
[0022] Figure 7 DAB staining and hydrogen peroxide content determination in T1 generation BnPMEI8-Cas9 transgenic rapeseed after inoculation. (Figure labeling explanation:) Figure 7 Figure A shows DAB staining of WT wild-type and BnPMEI8-Cas9 seedlings 36 hours after in vitro inoculation with Sclerotinia sclerotiorum. Figure 7 Figure B shows the hydrogen peroxide content in leaves 0 h and 36 h after inoculation with Sclerotinia sclerotiorum. Compared with the wild type, the absence of BnPMEI8 reduced the accumulation of H2O2 in rapeseed during Sclerotinia sclerotiorum infection, indicating that the BnPMEI8-Cas9 transgenic plants can limit further invasion of Sclerotinia sclerotiorum by regulating cell hypersensitive necrosis.
[0023] Figure 8 Analysis of the expression levels of genes related to hydrogen peroxide synthesis and degradation before inoculation. Figure labeling explanation: Figure 8 This study presents the expression levels of genes related to H2O2 synthesis and degradation in WT and BnPMEI8-Cas9 transgenic knockout plants before inoculation. The results showed that the expression of hydrogen peroxide synthesis-related genes RobhF (oxidase) and CSD2 (superoxide dismutase) was downregulated in BnPMEI8-Cas9 transgenic plants; while the expression of scavenging-related genes glutathione peroxidase (GPX6, GPX7), catalase CAT1, and ascorbate peroxidase APX1 was upregulated in BnPMEI8-Cas9 transgenic plants.
[0024] Figure 9 Analysis of the expression levels of genes related to hydrogen peroxide synthesis and degradation 36 hours after inoculation. (Figure labels are explained below.) Figure 9 This study presents the expression levels of genes related to H2O2 synthesis and degradation in WT and BnPMEI8-Cas9 transgenic knockout plants 36 hours after inoculation. The results indicate that BnPMEI8 regulates genes related to hydrogen peroxide synthesis and degradation, participating in the interaction between rapeseed and Sclerotinia sclerotiorum. Detailed Implementation
[0025] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are merely illustrative of the invention and not intended to limit its scope. Unless otherwise specified, the experimental methods described in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, instruments, etc., used are commercially available.
[0026] Example: BnPMEI8 gene mutation leads to increased resistance to sclerotinia stem rot in Brassica napus.
[0027] This embodiment uses CRISPR / Cas9 technology to edit the BnPMEI8 gene in Brassica napus. After mutation, the resistance of Brassica napus to Sclerotinia sclerotinia disease is significantly increased compared to the wild type. The BnPMEI8 gene DNA sequence is SEQ ID NO: 1 in the sequence listing, and the amino acid sequence is SEQ ID NO: 2 in the sequence listing. The specific steps are as follows:
[0028] (I) Analysis of the expression pattern of BnPMEI8 gene induced by Sclerotium sclerotiorum.
[0029] A 6mm mycelial block of *Sclerotinia sclerotiorum* (preserved by the Crop Genetics Laboratory of Hubei University) was punched and placed in a PDA plate for activation. When the mycelium was about to spread to the edge of the plate, it was placed in a new PDA plate for activation and incubated in the dark at 22℃ for about 40 hours. The storage containers were cleaned and sterilized, and absorbent paper was placed at the bottom for leaf storage and incubation. An equal amount of sterile water was added to each container, and the containers were sealed for later use. The second-to-last fully expanded 6-leaf stage new leaves of rapeseed of the same size were selected and placed in the storage container. The petiole was kept moist with a cotton ball. A 6mm mycelial block of newly formed mycelium near the edge of the plate was taken, avoiding the main vein, and placed upside down in the same position on the leaf. The same amount of water was sprayed evenly to maintain humidity, and the containers were incubated in the dark at 22℃. After inoculation, total RNA was extracted from the inoculated leaves at different time points and reverse transcribed into cDNA as a template. A real-time quantitative RT-qPCR kit was used for analysis. Use Geeen PCR Master Mix (follow the kit instructions) and perform the reaction on a BIO-Rad CFX Connect (manufactured by BIO-Rad). The required primers are as follows: internal control primer Q-BnActin7F (5'TCTTCCTCACGCTATCCTCCG3'), internal control primer Q-BnActin7R (5'AGCCGTCTCCAGCTCTTGC3'), Q-BnPMEI8-F (5'CTTCCGACCCCAAGTCTCTA3'), Q-BnPMEI8-R (5'GAACTCTCCTCGCCGCATT3'), Q-BnPMEI9-F (…). The gene sequences were: 5'TAGGCAATAGCGTGGACC3'), Q-BnPMEI9-R(5'TGGCTTGACCCGAAAATC3'), Q-BnPMEI10-F(5'ATGGGTTAGTGCTGCTCTCA3'), Q-BnPMEI10-R(5'AATCTTTCACGACCGCTTTG3'), Q-BnPMEI11-F(5'CACATACCCAACCGTCTGCT3'), and Q-BnPMEI11-R(5'GGTTAACGGTCACGGTGAGT3'). The results showed that BnPMEI8 and BnPMEI9 were significantly downregulated by *Sclerotinia sclerotiorum*, suggesting that BnPMEI8 and BnPMEI9 may be involved in the resistance response of rapeseed to *Sclerotinia sclerotiorum*. However, due to generational limitations in the genetic transformation materials, BnPMEI8 was chosen as the primary gene for study.
[0030] (II) Construction of CRISPR / Cas9 gene knockout vector
[0031] Based on the BnPMEI8 gene sequence of Brassica napus obtained from the BnPIR database, the CRISPR-P 2.0 gene developed by the State Key Laboratory of Genetic Improvement of Major Agricultural Crops in Central China was used. CRISPR-P v2.0 (hzau.edu.cn)Two gRNAs with the highest scores and strongest specificity were screened: pmei8-gRNA1 (5'TCTGCAAACGCAAACCGGTC3') and pmei8-gRNA2 (5'AGCTGATAGTGAGAGCGGT3'). Amplification primers for gRNA synthesis were used: BnPMEI8-DT1-BsF (5'ATATATGGTCTCGATTGCCATGGCTTCCGTTGTTCTGTT3'), BnPMEI8-DT1-F0 (5'TGCCATGGCTTCCGTTGTTCTTTTAGAGCTAGAAATAGC3'), BnPMEI8-DT2-R0 (5'AACGAGGAATGTTGAACTTGACCAATCTCTTAGTCGACTCTAC3'), and BnPMEI8-DT2-BsR (5'ATTATTGGTCTCGAAACGAGGAATGTTGAACTTGACCAA3'). Using the intermediate vector pCBC-DT1T2 as a template, four primers were mixed for amplification, and the product was preserved, digested, and ligated for use. The PCR product from the previous step was then ligated with the pKSE401 vector using BsaI restriction enzyme and T4 ligase at 37℃ for 12 h. The above reaction product was heat-shocked and transformed into *E. coli* DH5α. Single colonies were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmid was transformed into *Agrobacterium* GV3101 competent cells. Single colonies were picked and cultured in YEP liquid medium with appropriate resistance at 28℃ with shaking for 36-48 h. After PCR detection, positive strains were stored at -80℃ with an appropriate amount of glycerol for later use.
[0032] (III) Rapeseed genetic transformation
[0033] The recombinant plasmid (knockout vector) was screened and differentiated into seedlings using Agrobacterium-mediated hypocotyl infection. The specific steps are as follows:
[0034] 1. Seedling emergence: Select plump and active Westar seeds, put them into EP tubes, add mercuric chloride to sterilize in a clean bench for 4 minutes, pour out and recover the mercuric chloride, add 75% ethanol to sterilize for 2 minutes, pour out, rinse with sterile water for 2 minutes, repeat 3 times, use sterile tweezers to evenly place the treated seeds in M0 medium, and culture in the dark at 24℃ for 5 days.
[0035] 2. Activation of Agrobacterium: Two days after inoculation, Agrobacterium was cultured on YEP medium supplemented with the appropriate antibiotic at 28°C for 48 hours. A single colony was picked and transferred to 5 ml of YEP medium, and cultured with shaking at 28°C for 36 hours. Subsequently, 1 ml of bacterial suspension was transferred to 45 ml of YEP medium and cultured with shaking at 28°C for 12 hours. Afterward, the bacterial cells were collected by centrifugation at 4000 rpm at 4°C. Agrobacterium was then resuspended in DM medium and diluted to an OD600 of approximately 0.7.
[0036] 3. Infection and Co-culture: In a clean bench, cut cultured hypocotyls (8-10 mM is recommended), keeping them moist by adding DM medium during cutting. Then, immerse them in the prepared Agrobacterium suspension for 20 minutes, gently stirring with sterile forceps to ensure thorough inoculation. Finally, aspirate the suspension, transfer the hypocotyls to filter paper to remove excess suspension, and place them on M1 medium. Incubate at 24°C in the dark for 36 hours.
[0037] 4. Selection culture: Transfer the hypocotyls from M1 to M2 medium and culture at 24℃ for 16 hours under light for 8 hours in the dark for 12 days.
[0038] 5. Differentiation culture: Remove the brown hypocotyls from M2, transfer the healthy hypocotyls to M3 medium, and culture at 24℃ for 16 hours in light and 8 hours in darkness. Repeat this process every 12 days until germination.
[0039] 6. Rooting culture: After the buds appear, remove the callus tissue from the buds and insert them into M4 medium. Culture at 24℃ for 16 hours under light and 8 hours in the dark until roots are formed.
[0040] The embodiments of the present invention involve the following: a specialized culture medium, antibiotic and hormone formulations, and their preparation.
[0041] Culture medium formulation and preparation method:
[0042] 1. M0 seedling culture medium
[0043] MS 4.405g;
[0044] 7.0g of agar;
[0045] Dissolve the contents gradually, then add distilled water to bring the volume to 1000mL, adjust the pH to 5.8-6.0, dispense 50mL into each seedling box, and sterilize in an autoclave at 121℃ for 20min.
[0046] 2. M1 co-culture medium
[0047]
[0048] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added, and the pH was adjusted to 5.8-6.0. The mixture was then placed in an autoclave at 121°C for 20 min to sterilize. After that, AS (100 mM / mL) was added in a clean bench and then dispensed into petri dishes.
[0049] 3. M2 screening medium
[0050]
[0051]
[0052] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added, and the pH was adjusted to 5.8-6.0. The mixture was then placed in an autoclave at 121°C for 20 min to sterilize. After sterilization, TMT (50 mg / mL), Kan (50 mg / mL), and AgNO3 were added in a clean bench and then dispensed into petri dishes.
[0053] 4. M3 differentiation medium
[0054]
[0055] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. The pH was adjusted to 5.8-6.0, and the mixture was placed in an autoclave at 115°C for 15 min to sterilize. After sterilization, TMT (50 mg / mL), ZT (0.5 mg / mL), and IAA (1 mg / mL) were added in a clean bench and then dispensed into petri dishes.
[0056] 5. M4 Rooting Medium
[0057] MS 2.202g;
[0058] 7g of agar;
[0059] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL, adjust the pH to 5.8-6.0, dispense 50 mL into each conical flask, and sterilize in an autoclave at 121°C for 20 min.
[0060] 6. DM culture medium
[0061]
[0062] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added. The pH was adjusted to 5.8-6.0 and then dispensed into 50 mL portions into each culture flask. The flasks were then placed in an autoclave at 121 °C for 20 min to sterilize.
[0063] 7. YEP medium
[0064]
[0065] Add distilled water to a final volume of 1000 mL, autoclave at 121°C for 20 minutes, then dispense. Note: Liquid YEP medium does not require the addition of agar.
[0066] Antibiotic formulation:
[0067] 1. Kanamycin (Kan, 50mg / ml): Weigh 0.5g of kanamycin powder, add 10ml of deionized water to dissolve it completely, filter it, and dispense it into sterile EP tubes. Store at -20℃.
[0068] 2. Ampicillin (Amp, 50mg / ml): Weigh 0.5g of ampicillin powder, add 10ml of deionized water to dissolve it completely, filter to sterilize, dispense into individual containers, and store at -20℃.
[0069] 3. TMT (200mg / l): Under aseptic conditions, inject 4ml of sterile deionized water into 1.6g of unopened bottled TMT powder using a syringe. After mixing thoroughly, remove the powder, add another 4ml of sterile deionized water, mix thoroughly, dispense directly into sterile EP tubes, and finally store at -20℃.
[0070] 4. Rifampin (30mg / ml): Weigh 0.5g of rifampin powder, add 10ml of DMSO to dissolve it completely, filter to sterilize, and dispense into sterile EP tubes. Store at -20℃.
[0071] 5. Spectinomycin (spec, 50mg / ml): Weigh 0.5g of kanamycin powder, dissolve it thoroughly in 10ml of sterile deionized water, filter to sterilize, and then dispense into sterile EP tubes. Store at -20℃.
[0072] Hormone formulation:
[0073] 1. Acetyleugenone (As, 100mM / mL): Weigh 0.196g of acetyleugenone powder, add 10mL of DMSO to dissolve it completely, filter to sterilize, dispense into sterile EP tubes, and finally store in a -20℃ refrigerator.
[0074] 2. Plant growth regulator (2,4-D, 1 mg / mL): Weigh 100 mg of 2,4-D, add 1 mL of 1N KOH and shake for 5 min. Then add 10 mL of sterile deionized water and shake until 2,4-D is fully dissolved. Finally, bring the volume to 100 mL with sterile deionized water and store at 4°C.
[0075] 3. Kinetin (KT, 1 mg / mL): Weigh 100 mg of KT dry powder, then add 1 mL of 1N KOH and shake until KT is completely dissolved. Then add ddH2O to make up to 100 mL and store at 4℃.
[0076] 4. Naphthaleneacetic acid (NAA, 1 mg / ml): Weigh 100 mg of NAA, add 1 mL of 1N KOH and shake until NAA is completely dissolved. Then add sterile deionized water to make up to 100 mL and store in a refrigerator at 4°C protected from light.
[0077] 5. Zeatin (ZT, 0.5 mg / mL): Under aseptic conditions, add 95% ethanol to each tube containing 5 mg of zeatin and dissolve completely. Then add sterile deionized water to bring the volume to 10 mL. Filter to remove bacteria and store at -20°C.
[0078] 5. Indoleacetic acid (IAA, 1 mg / mL): Weigh 100 mg of IAA dry powder and dissolve it in 5 ml of anhydrous ethanol. Add sterile deionized water to bring the volume to 100 mL, then filter to sterilize, and finally store in a -20°C refrigerator.
[0079] (iv) Identification of Sclerotinia sclerotiorum in transgenic materials
[0080] 1. Inoculation of detached leaves with *Sclerotinia sclerotiorum*: Place *Sclerotinia sclerotiorum* mycelial blocks in PDA plates for incubation and activation. When the mycelium is about to spread to the edge of the plate, take a 6mm section of newly formed mycelium near the edge of the plate and place it in a new PDA plate for activation. Incubate in the dark at 22℃ for about 40 hours. Clean and sterilize the storage container, place absorbent paper at the bottom of the container for leaf storage and incubation, add an equal amount of sterile water to each container, and seal for later use. Select the second to last fully expanded 6-leaf stage new leaf of rapeseed of the same size, place it in the storage container, and use a cotton ball to retain moisture at the petiole. Take a 6mm section of newly formed mycelium near the edge of the plate, avoiding the main vein, and place it upside down in the same position as the leaf. Spray an equal amount of water evenly to maintain moisture. Incubate in the dark at 22℃. Observe and record the *Sclerotinia sclerotiorum* infection status regularly. Set up 3 biological replicates for each strain.
[0081] 2. DAB staining: Select leaves inoculated for 36 hours with hyphal expansion edges of equal size and place them in 50 mL of 1 mg / mL diaminobenzidine solution. Vacuum the solution, let it stand for 20 minutes, and then incubate it in a 28℃ incubator for 8 hours. Then, immerse the leaves in an acetone:methanol 1:1 solution for decolorization for 8 hours, changing the acetone:methanol mixture 1-2 times during this period. Prepare slides, and finally photograph and record them using a stereomicroscope. The depth of brown color is used as the basis for the content of reactive oxygen species. Three biological replicates are set up for each strain.
[0082] 3. Pectin Methyl Ester Determination (DM): The determination was performed using a pectin methyl ester determination kit (purchased from Keming Biotechnology, Suzhou). The steps are as follows:
[0083] Sample preparation: First, weigh approximately 0.1 g of tissue, add 500 μL of distilled water, and grind the sample twice at 70 Hz for 60 seconds. Then add another 500 μL of distilled water and vortex. Centrifuge at 10000 g at 4℃ for 10 min, discard the supernatant, and retain the precipitate. Add 1 mL of extraction buffer to the precipitate, mix well, and incubate in a 90℃ water bath for 2 h, then cool to room temperature. Centrifuge at 10000 g at 4℃ for 10 min, and collect the supernatant for analysis.
[0084] Methanol production determination: Prepare test tubes and blank tubes. Add 150 μL of extract to the test tube and 150 μL of extract to the blank tube as a control. Add 75 μL of reagent one to both the test tube and the blank tube, mix well, and let stand at room temperature for 30 min. Add 75 μL of reagent two and 60 μL of reagent three to each tube, mix well, and incubate on ice for 15-30 min until the purple color fades. Add 60 μL of reagent four and 180 μL of deionized water to each tube, mix well, and react at room temperature for 1 h. Add 600 μL of reagent five to each tube, mix well, and react in a 60℃ water bath for 15 min. Take 1 mL and add it to a glass cuvette. Measure the absorbance at 412 nm (Adetermined vs. Ablank). Calculate: ΔA = Adetermined - Ablank
[0085] Galacturonic acid content determination: Take a 60 μL sample as the test tube, add 60 μL of reagent VII and 960 μL of concentrated sulfuric acid, incubate in a 70℃ water bath for 10 min, and cool to room temperature. Add 48 μL of reagent VIII, mix thoroughly, and let stand for 10 min. Take 1 mL and measure the absorbance value A1 at 450 nm and the absorbance value A2 at 400 nm. ΔA2=A1-A2.
[0086] Calculation formula:
[0087] 1. Calculation of methanol production
[0088] The standard curve is y = 0.0596x + 0.009, R² = 0.9997, where x is the concentration of the standard in μmol / mL and y is the absorbance value ΔA1.
[0089] Methanol production (umol / g fresh weight) = (AA1 - 0.009) + 0.0596 - W × Vtotal = 16.78 × (△A1 - 0.009) + W
[0090] 2. Calculation of galacturonic acid content
[0091] The standard curve is y = 0.517x - 0.1746, R² = 0.9986; x is the concentration of the standard, μmol / mL, and y is the absorbance value ΔA².
[0092] Galacturonic acid (umol / g fresh weight) = (△A2 + 0.1746) + 0.517 + W × Vtotal = 1.93 × (△A2 + 0.1746) + W
[0093] Degree of pectin methyl esterification (%) = Methanol production: Galacturonic acid content × 100%
[0094] Vtotal: Volume of extraction solution added, 1 mL; W: Sample mass, g
[0095] 4. Pectin Methylesterase (PME) Activity Assay: The pectin methylesterase activity assay kit (purchased from Zhenke Biotechnology, Shanghai) was used for the assay. First, remove the required strips from the aluminum foil bag after equilibration at room temperature for 20 min. Seal the remaining strips in a resealable bag and return them to 4℃. Set up standard and sample wells. Add 50 μL of different concentrations of standard to each standard well; add 10 μL of the sample to be tested to each sample well, followed by 40 μL of sample diluent; do not add anything to the blank wells. Except for the blank wells, add 100 μL of horseradish peroxidase (HRP)-labeled detection antibody to each standard and sample well. Seal the reaction wells with sealing film and incubate at 37℃ in a water bath or incubator for 60 min. Discard the liquid, pat dry on absorbent paper, fill each well with washing buffer, let stand for 1 min, shake off the washing buffer, pat dry on absorbent paper, and repeat this washing process 5 times (or a plate washer can be used). Add 50 μL of substrate A and substrate B to each well and incubate at 37°C in the dark for 15 min. Add 50 μL of stop solution to each well and measure the OD value of each well at 450 nm within 15 min.
[0096] 5. H2O2 content determination: The hydrogen peroxide content detection kit (purchased from Solarbio Science, Beijing) was used for determination. Weigh approximately 0.1g of tissue (weighed using a 0.01g balance and recorded). The homogenate was sterilized beforehand or the homogenate beads were sterilized by heating with anhydrous ethanol. After cooling on ice, the homogenate beads were added to an EP tube. Add 1mL of Reagent 1 (pre-cooled acetone), and homogenize the sample using a homogenizer at 70Hz for 60 seconds. Then centrifuge at 8000rpm / 10min at 4℃ using a refrigerated centrifuge. Take 800μL of the supernatant and place it on ice; add 80μL of Reagent 2 and 160μL of Reagent 3. Prepare a new EP tube, labeled as a standard tube, and add 1μmol / mL diluted standard solution; add 80μL of Reagent 2 and 160μL of Reagent 3. Prepare a new EP tube, labeled as a blank tube, and add 1000μL of Reagent 1 (acetone); add 80μL of Reagent 2 and 160μL of Reagent 3. Centrifuge all samples at 4000 rpm for 10 min at room temperature, discard the supernatant and retain the precipitate. Wash the samples with 500 μL of acetone to remove plant pigments, centrifuge at 8000 rpm for 2 min, discard the supernatant, and repeat the washing process 3-5 times. After washing, add 800 μL of reagent IV to all samples to dissolve the precipitate. After standing at room temperature for 5 min, pour the solution into a cuvette, measure the wavelength at 415 nm, adjust the absorbance to 0 with distilled water, and record the absorbance of the measurement tube. Calculate: ΔAmeasured = Ameasured tube - Ablank tube, ΔAstandard = Astandard tube - Ablank tube. H2O2 content in tissue (umol / g mass) = ΔA determination ÷ (ΔA standard ÷ C standard solution) × V sample ÷ (V sample ÷ V extraction × W) = ΔA determination ÷ ΔA standard ÷ W, Note: C standard solution: H2O2 standard solution concentration, 1umol / mL; V sample: sample volume added, 1mL; W: tissue mass, g; V extraction: volume used in the extraction process, 1mL; Cpr: sample protein concentration.
Claims
1. The application of knocking out the pectin methyl esterase inhibitor BnPMEI8 gene in improving resistance to sclerotinia stem rot in rapeseed, characterized by: The nucleotide sequence of the BnPMEI8 gene is shown in SEQ ID NO:1.