A strain of avian pathogenic Escherichia coli sRNA s053 gene deletion and its application

Abstract

The invention discloses an avian pathogenic Escherichia coli sRNA s053 gene-deficient strain and its application. The strain is CE041Δs053, and its preservation number is CCTCC NO: M 20232290. Its classification name is Escherichia coli CE041Δs053, and it is currently preserved in the China Center for Type Culture Collection. The avian pathogenic Escherichia coli sRNA s053 gene-deficient strain of the invention has a clear genetic background, stable properties after passage, and good biosafety. The gene-deficient strain can produce membrane vesicles (MVs), and the MVs have good immunogenicity. The MVs of CE041Δs053 can be prepared in large quantities by a nitrogen cavitation method, and can be used to prepare a subunit vaccine for avian Escherichia coli disease, which has good immune protection and is helpful in preventing avian pathogenic Escherichia coli infection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an avian pathogenic Escherichia coli sRNA s053 gene deleted strain and application thereof. Background Art

[0002] Avian pathogenic Escherichia coli (APEC) is an important bacterial pathogen that endangers the poultry industry. It can cause respiratory tract infections, sepsis, polyserositis, granulomas, cellulitis, yolk sac infection, omphalitis and swollen head syndrome in poultry, collectively known as avian colibacillosis. The disease develops quickly, with high morbidity and mortality, causing serious losses to the poultry industry and posing a serious threat to human food safety. The prevention and control of avian colibacillosis is mainly based on antibiotics. With the irrational use and abuse of antibiotics, bacteria have developed widespread drug resistance, and "antibiotic ban" has become an unstoppable trend in the livestock and poultry industry. How to find alternatives to antibiotics is an important issue facing the prevention and control of bacterial diseases. Vaccines are one of the most effective means of preventing diseases, and the use of vaccines reduces the severity of the disease. Vaccines are also considered the best means of preventing and controlling E. coli.

[0003] Small RNA (sRNA) in bacteria is a type of non-coding RNA (Non-coding Regulatory RNAs) with a length ranging from 50 bp to 500 bp. They play an important role in bacterial gene regulation, especially in responding to environmental stress and regulating pathogenicity.

[0004] Bacterial membrane vesicles (MVs) are nano-membrane structures produced by bacteria during normal growth, with a diameter of approximately 20 to 400 nm. MVs contain a variety of antigenic proteins from the bacterial outer membrane, making them effective vaccine candidates. Studies have shown that MVs can induce protective immunity against bacterial pathogens, including Neisseria meningitidis, Escherichia coli, and Bordetella pertussis. The small size of MVs enables them to enter lymphatic vessels and be taken up by antigen-presenting cells (APCs). In addition, MVs have natural adjuvant properties that can strongly stimulate innate and adaptive immune responses. The high stability of MVs after exposure to high temperatures and multiple chemical treatments further indicates that they are attractive vaccine candidates.

[0005] However, current studies have shown that the serotypes of APEC are relatively complex, so it is crucial to produce vaccines that have cross-protection against different serotypes of bacteria. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention provides an avian pathogenic Escherichia coli sRNA s053 gene deletion strain and its application. The deletion of the sRNA s053 gene leads to a relatively low lipopolysaccharide (LPS) production of avian pathogenic Escherichia coli. The LPS content in the membrane vesicles (MVs) produced by the gene-deficient strain CE041Δs053 is low, so the membrane vesicles prepared by the deletion strain have good immunogenicity.

[0007] The present invention is achieved through the following technical solutions:

[0008] The invention discloses an avian pathogenic Escherichia coli sRNA s053 gene deleted strain, the strain is CE041Δs053, the preservation number is CCTCC NO: M 20232290, the classification name is Escherichia coli CE041Δs053, and the strain is currently preserved in China Center for Type Culture Collection.

[0009] The application of the above-mentioned avian pathogenic Escherichia coli sRNAs053 gene deleted strain in the preparation of subunit vaccines.

[0010] Preferably, the vaccine is a membrane vesicle subunit vaccine, adjuvant or immunopotentiator prepared based on the above-mentioned avian pathogenic Escherichia coli sRNAs053 gene deleted strain.

[0011] Preferably, the membrane vesicle subunit vaccine is a broad-spectrum subunit vaccine.

[0012] A subunit vaccine for avian pathogenic Escherichia coli comprises membrane vesicles produced by the above-mentioned avian pathogenic Escherichia coli sRNA s053 gene deleted strain.

[0013] A method for preparing an avian pathogenic Escherichia coli subunit vaccine comprises the following steps:

[0014] Step 1) Prepare bacterial solution: The above-mentioned avian pathogenic Escherichia coli sRNA s053 gene deletion strain was streaked on LB solid medium, and a single colony was picked and inoculated into LB liquid medium for culture until the bacterial count reached 5.0×10 9 CFU / mL;

[0015] Step 2) Ultracentrifugation: Add the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053 cultured in step 1) to 500 mL LB broth medium, and culture at 37°C and 180 rpm for 12 hours; centrifuge at 4°C and 8000×g for 10 minutes, discard the precipitate, and filter and sterilize the supernatant; then ultracentrifuge the supernatant at 4°C and 200000×g, discard the supernatant after centrifugation for 3 hours, and resuspend the precipitate in TE buffer;

[0016] Step 3) Density gradient centrifugation: The suspension obtained in step 2) is centrifuged at 4°C and 200,000×g for 2 h through iodixanol density gradients of 10%, 20%, and 40%; the separated liquids are collected after centrifugation, and then ultracentrifuged at 200,000×g, and the precipitate is resuspended in TE buffer, filtered, and concentrated to obtain membrane vesicles of the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053, which are stored at 4°C;

[0017] Step 4) The membrane vesicles obtained in step 3) are mixed with ISA201 VG adjuvant at a volume ratio of 1:1 to make the final concentration of the membrane vesicle protein 2 mg / mL, and stored at -20°C.

[0018] A method for preparing an avian pathogenic Escherichia coli subunit vaccine comprises the following steps:

[0019] Step A) Preparation of bacterial solution: streak the avian pathogenic Escherichia coli sRNA s053 gene deletion strain of claim 1 on LB solid medium, pick a single colony and inoculate it on LB liquid medium for culture until the bacterial count reaches 5.0×10 9 CFU / mL;

[0020] Step B) The bacteria cultured in step A) were transferred to a centrifuge tube, cultured at 37°C and 180 rpm for 12 h; centrifuged at 4°C and 8000×g for 10 min, the supernatant was discarded, the precipitate was resuspended in PBS, and placed on ice;

[0021] Step C) precooling the nitrogen cavitation device on ice, placing the precooled nitrogen cavitation device on a magnetic stirrer, placing a micro magnetic stirring bar, and connecting it to a nitrogen tank; transferring the bacterial suspension obtained in step B) to the precooled nitrogen cavitation device, turning on the stirrer to mix the suspension; gradually pressurizing until the pressure gauge reading stabilizes at 1500PSI; closing all valves, disconnecting the nitrogen tank, and incubating on ice for 25 minutes to allow the nitrogen to fully dissolve and reach a balanced state; slowly opening the valve to release the pressure, and collecting the bacterial lysate;

[0022] Step D) The bacterial lysate obtained in step C) is first subjected to ultracentrifugation to obtain crude vesicles, and then subjected to density gradient centrifugation to obtain purified membrane vesicles, i.e., membrane vesicles of the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053, which are stored at 4° C.;

[0023] Step E) The membrane vesicles obtained in step D) are mixed with ISA201 VG adjuvant at a volume ratio of 1:1 to make the final concentration of the membrane vesicle protein 2 mg / mL, and stored at -20°C.

[0024] Preferably, in step D), the ultracentrifugation is specifically as follows: adding the bacterial lysate obtained in step C) to 500 mL of LB broth medium, culturing at 37° C. and 180 rpm for 12 h; centrifuging at 4° C. and 8000×g for 10 min, discarding the precipitate, and filtering and sterilizing the supernatant; then ultracentrifuging the supernatant at 4° C. and 200,000×g, discarding the supernatant after centrifugation for 3 h, and resuspending the precipitate in TE buffer to obtain a suspension that is the crude vesicle;

[0025] The density gradient centrifugation is specifically as follows: the crude vesicles are centrifuged at 4°C and 200,000×g for 2 hours through iodixanol density gradients of 10%, 20%, and 40%; the layered liquid is collected after centrifugation, and then ultracentrifuged at 200,000×g, the precipitate is resuspended with TE buffer, filtered, and concentrated to obtain purified membrane vesicles.

[0026] A broad-spectrum subunit vaccine for avian pathogenic Escherichia coli comprises membrane vesicles produced by the above-mentioned avian pathogenic Escherichia coli sRNAs053 gene deleted strain.

[0027] The beneficial effects of the present invention are as follows:

[0028] The avian pathogenic Escherichia coli sRNA s053 gene-deficient strain CE041Δs053 of the present invention has a clear genetic background, stable properties after passage, and good biosafety. The gene-deficient strain can produce membrane vesicles (MVs), and the MVs have good immunogenicity. The MVs of CE041Δs053 can be prepared in large quantities by a nitrogen cavitation method, and can be used to prepare a subunit vaccine for avian Escherichia coli disease, which has good immunoprotective properties and is helpful in preventing avian pathogenic Escherichia coli infection. The present invention prepares a broad-spectrum subunit vaccine through the MVs produced by the gene-deficient strain CE041Δs053, which has an immunoprotective effect against infection of avian pathogenic Escherichia coli strains of different serotypes, and has broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The secondary structure prediction result of sRNAs053 in Example 1;

[0030] Figure 2 The Northern blot was used to detect the transcription level of s053 RNA in the CE041 wild-type strain and the sRNA s053 deletion strain in Example 1;

[0031] Figure 3 The average particle size and concentration of bacterial membrane vesicles (MVs) produced by natural culture of the deletion strain CE041Δs053 detected by nanoparticle tracking analysis (NTA) in Example 3;

[0032] Figure 4The average particle size and concentration of bacterial membrane vesicles of the deletion strain CE041Δs053 prepared by nitrogen cavitation were detected by nanoparticle tracking analysis (NTA) in Example 4;

[0033] Figure 5 For the comparison and detection of the difference in lipopolysaccharide (LPS) between the deletion strain CE041Δs053 and the wild-type strain CE041 in Example 5;

[0034] Figure 6 Comparison of LPS content in MVs produced by the deletion strain CE041Δs053 and the wild-type strain CE041 in Example 5;

[0035] Figure 7 This is the detection of antibody levels after immunization with the deletion strain CE041Δs053 MVs subunit vaccine in Example 7. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0037] Unless otherwise specified, the technical means used in the following examples are all conventional means well known to those skilled in the art, and the experimental methods without specifying the specific conditions are all conventional methods in the art.

[0038] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0039] Example 1 Secondary structure prediction and northern blot verification of sRNA s053

[0040] 1. Predict the secondary structure of sRNA s053 using RNAfold WebServer

[0041] Based on the whole genome sequencing of the APEC virulent strain CE041, the TSS-seq technology was used to sequence the initial transcriptome spectrum of CE041 to obtain the transcription information of the whole genome operon of CE041 and the location information of the 5' non-coding region (UTR) of each transcript. By analyzing the initial transcriptome data, more than one hundred sRNAs were predicted in the intergenic region of CE041, and the lengths of these sRNAs ranged from 76bp to 573bp. The study found that the sRNA numbered s053 is a newly discovered important virulence factor in APEC. Figure 1 As shown, the secondary structure of sRNA s053 presents a typical stem-loop structure.

[0042] The gene coding sequence of sRNA s053 is shown in SEQ ID NO.1, and the specific sequence is as follows:

[0043] ATTTGGTAGAAAATAAAAATGGGCGACTGACCAGATATGGGAGTCTCCGGTCAGTCATTCGCTTGTAGATGCAGGACATAAGCGAACCAGGGCCCACTGCTTGTGCGCAAAAGCAAGGAGAGTTTACCCTAGCAGATTGAGTTACACCAGATCATCACCTCACTGACCAGTCAGAAATTCC GACTCATCTTCCACCACTAAACCTGCTCCATCCCAGTCCTGAACCTTCCCTCGCCAGCAGCCAGGATCGTACGGTTCACCACCATCCTCTTCCGTGAATGACCGTAAGTGAGCAGCACCAAAATAAATCGGTACTTCCAATAACAGATAGTGAAAGCGTAAGGTGAAATATGAACATGAG.

[0044] The RNA sequence corresponding to sRNA s053 is shown in SEQ ID NO.2, and the specific sequence is as follows:

[0045] AUUUGGUAGAAAAUAAAAAAUGGGCGACUGACCAGAUAUGGGAGUCCGGUCAGUCAUUCGCUUGUAGAUGCAGGACAUAAGCGAACCAGGGCCCACUGCUUGUGCGCAAAAGCAAGGAGAGUUUACCCUAGCAGAUUGAGUUACACCAGAUCAUCACCUCACUGACCAGUCAGAAAUUCC GACUCAUCUUCCACCACUAAACCUGCUCCAUCCCAGUCCUGAACCUUCCCUCGCCAGCAGCCAGGAUCGUACGGUUCACCACCAUCCUCUUCCGUGAAUGACCGUAAGUGAGCAGCACCAAAAUAAAUCGGUACUUCCAAUAACAGAUAAGUGAAAGCGUAAGGUGAAAUAUGAACAUGAG.

[0046] 2. Northern blot experiment

[0047] In order to determine whether sRNA s053 exists in the wild-type strain CE041 and its deletion strain (ie, gene deletion strain, the same below) CE041Δs053, Northern Blot was used for verification.

[0048] (1) Experimental procedures

[0049] The wild-type strain CE041 and the deletion strain CE041Δs053 cultured overnight were inoculated into LB liquid medium and cultured at 37°C and 180 r / min until OD 600 1.0. Collect 2mL of bacterial solution, centrifuge at 10000r / min, discard the supernatant, add 100μL of lysis / TEBuffer and resuspend. Incubate in a 30℃ water bath for 10min (vortex every 2min). Add 400μL of Buffer BRK / 2Me reagent, vortex for 4min and centrifuge for 10min, take 400μL of supernatant and transfer it to a 1.5mL EP tube without RNase, add an equal volume of 75% ethanol and mix well, then add the mixture to HiBind Mini column, centrifuge at 12000×g for 1min. Discard the liquid in the collection tube, add 400μL RNA Wash BufferⅠ, centrifuge at 12000×g for 1min. Discard the waste liquid in the collection tube, add 400μL RNA Wash BufferⅠ again, centrifuge at 12000×g for 1min, and discard the waste liquid in the collection tube. Add 500μL RNA Wash BufferⅡ, centrifuge at 12000×g for 1min, and discard the waste liquid in the collection tube. Add 500μL RNA Wash BufferⅡ again, centrifuge at 12000×g for 1min, and discard the waste liquid in the collection tube. Transfer the mini column to a new 1.5mL EP tube without RNAse, add 50μL preheated RNA-free ddH2O to elute and measure RNA concentration. Take 10μg RNA and add it to the well of 6% polyacrylamide denaturing gel, and perform electrophoresis in 0.5×TBE buffer and 300V. After the electrophoresis, transfer RNA to NC membrane and use 120mJ / cm 2 The NC membrane was cross-linked and fixed under UV conditions. A DNA probe labeled with 5'-end biotin was synthesized and hybridized with the labeled probe overnight at 42°C using Ultra-Hyb hybridization buffer. Finally, the membrane was washed and detected using a kit.

[0050] (2) Test results

[0051] like Figure 2 As shown, sRNA s053 was identified in the wild-type strain CE041, but not in the deletion strain CE041Δs053.

[0052] Example 2 Construction of avian pathogenic Escherichia coli sRNA s053 gene deletion strain

[0053] 1. Main reagents, culture media and instruments

[0054] Main reagents: Gel recovery kit (Omega), ampicillin and kanamycin (Shanghai Yuanye), 2×PCR PreMix (Novozyme).

[0055] Main culture medium: SOC medium, LB medium, PBS buffer.

[0056] Main instruments: microplate reader (Multiskan GO, BIO-RAD), spectrophotometer (SmartSpec Plus, ThermoScientific), electroporator (MicroPulser, Bio-Rad) and gel imaging system (ChemiDoc MP, BIO-RAD), etc.

[0057] 2. Gene deletion step

[0058] Construction of s053 gene deletion strain by Red homologous recombination

[0059] (1) Prepare linear targeting fragments, use specific primers with homology arms of s053 gene (s053-P1 and s053-P2 in Table 1), use pKD4 plasmid as template, amplify DNA targeting fragments by PCR method, and recover target DNA fragments by gel recovery kit.

[0060] Table 1 Primers for construction and identification of deletion strains

[0061]

[0062] (2) Preparation of CE041 electrocompetent cells, the specific steps are as follows: Cultivate the CE041 strain containing the pKD46 plasmid in LB to the early logarithmic phase. Add L-arabinose at a final concentration of 1mM / L to the culture medium to induce the expression of Red recombinase. After culturing to the logarithmic phase, collect the bacteria. Wash twice with deionized water (ddH2O), then wash twice with 10% glycerol to prepare electrocompetent bacteria. Add the linear DNA targeting fragment to the competent bacteria, use 2300V, 200Ω, 25μF conditions for electrotransformation, and introduce the s053 gene targeting fragment into the CE041 competent bacteria. After the electrotransformation is completed, immediately add preheated SOC medium to the competent bacteria and place it in a shaker at 30°C for 2h. Collect the bacteria by centrifugation, evenly spread on an LB plate containing kanamycin, and place it in a 30°C incubator for overnight culture. A single colony was picked and cultured in a medium containing kanamycin, and the deletion strain was identified using specific primers for the upstream and downstream of the s053 gene (s053-up-F and s053-down-R in Table 1). The pCP20 plasmid was electroporated into the correctly identified strain, and the strain with the resistance gene successfully removed was selected using the PCR method, which was CE041Δs053.

[0063] The constructed strain is the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053, with a preservation number of CCTCC NO: M 20232290, and is classified and named Escherichia coli CE041Δs053. It was deposited in the China Center for Type Culture Collection on November 20, 2023, with an address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0064] Example 3 Extraction of naturally produced membrane vesicles (MVs) from avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053 and detection by nanoparticle tracking analysis (NTA)

[0065] The bacterial membrane vesicles (MVs) of the deletion strain CE041Δs053 were extracted by ultracentrifugation and iodixanol density gradient centrifugation, as follows:

[0066] 1. Experimental steps

[0067] (1) Ultracentrifugation to separate membrane vesicles (MVs) produced by APEC deletion strains

[0068] The avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053 cultured overnight was added to 500mL LB broth medium and cultured at 37°C and 180rpm for 12h. Centrifuged at 4°C and 8000×g for 10min, the precipitate was discarded, and the supernatant was sterilized by filtration through a 0.22μm filter membrane. The supernatant was then ultracentrifuged at 4°C and 200000×g for 3h and the supernatant was discarded. MVs were precipitated at the bottom of the centrifuge tube and resuspended in TE buffer (10mM Tris-HCl, 1mM EDTA, pH=8.0).

[0069] (2) Density gradient centrifugation to purify APEC-deficient bacterial membrane vesicles (MVs)

[0070] The suspension was centrifuged through an iodixanol density gradient (10%, 20%, 40%) (4°C, 200,000×g, 2h), and the stratified liquid containing more MVs was collected after centrifugation. The precipitate was resuspended in TE buffer, filtered through a 0.22μm filter membrane, and concentrated using a 100kDa ultrafiltration tube to obtain the bacterial membrane vesicles of the deletion strain CE041Δs053 purified by density gradient centrifugation and stored at 4°C.

[0071] A 100 μL sample was taken and commissioned to Beijing Enze Kangtai Biotechnology Co., Ltd. to perform nanoparticle size tracking analysis (NTA) to measure the particle size and concentration of bacterial membrane vesicles of the deletion strain CE041Δs053.

[0072] 2. Test results

[0073] like Figure 3 As shown in the NTA results, the average particle size of MVs produced by natural culture of the deletion strain CE041Δs053 was about 107 nm, and the concentration was about 1.31×10 12 Particles / mL.

[0074] Example 4 Preparation of bacterial membrane vesicles (MVs) of deletion strain CE041Δs053 by nitrogen cavitation and detection by nanoparticle tracking analysis (NTA)

[0075] 1. Experimental steps

[0076] (1) Preparation of bacterial membrane vesicles by nitrogen cavitation

[0077] Transfer the overnight cultured bacteria to a 50mL centrifuge tube and culture at 37°C and 180rpm for 12h. Centrifuge at 4°C and 8000×g for 10min, discard the supernatant, resuspend the precipitate in 15mL PBS, and place on ice. Precool the nitrogen cavitation device on ice, place the precooled nitrogen cavitation device on a magnetic stirrer, put in a micro magnetic stirring bar, and connect it to the nitrogen tank. Transfer the bacterial suspension to the precooled nitrogen cavitation device, turn on the stirrer to mix the suspension. Gradually pressurize until the pressure gauge reading stabilizes at around 1500PSI. Close all valves, disconnect the nitrogen tank, and incubate on ice for 25min to allow the nitrogen to fully dissolve and reach equilibrium. Wipe off the moisture around the valve with a towel, slowly open the valve to release the pressure, and collect the bacterial lysate in a precooled 15mL centrifuge tube.

[0078] (2) Extraction method of avian pathogenic Escherichia coli membrane vesicles (MVs)

[0079] The bacterial lysate was collected and purified by ultracentrifugation and density gradient centrifugation in Example 3, and stored at 4°C.

[0080] A 100 μL sample was taken and commissioned to Beijing Enze Kangtai Biotechnology Co., Ltd. to perform nanoparticle size tracking analysis (NTA) to measure the particle size and concentration of bacterial membrane vesicles of the deletion strain CE041Δs053.

[0081] 2. Test results

[0082] like Figure 4 As shown in the NTA results, the average particle size of MVs in the deletion strain CE041Δs053 was about 111 nm, and the concentration was about 1.17×10 14 Particles / mL.

[0083] By comparing the experimental results of Examples 3 and 4, it can be seen that the nitrogen cavitation method can prepare a large number of avian pathogenic Escherichia coli membrane vesicles. Compared with the method of Example 3, the yield of MVs prepared by the method of Example 4 is two orders of magnitude higher.

[0084] Example 5 Determination of LPS content in membrane vesicles (MVs) produced by wild-type avian pathogenic Escherichia coli strain CE041, deletion strain CE041Δs053 and two strains

[0085] 1. Experimental steps

[0086] (1) Bacteria (wild strain CE041, deletion strain CE041Δs053) were cultured until OD 600 When the pH value was 1.0, the bacterial precipitate was collected by centrifugation at 8000×g for 5 min. The bacterial LPS was extracted according to the standard steps using a bacterial lipopolysaccharide (LPS) extraction kit (Bebo Biotechnology, Cat. No. BB-31302). The treated bacteria were left to stand at 4°C overnight; then centrifuged at 3000×g for 30 min. The supernatant on the top was lipopolysaccharide (LPS).

[0087] (2) The extraction of bacterial membrane vesicle LPS is the same as that of bacterial LPS.

[0088] (3) LPS content in bacteria and MVs was determined using PyroGene TM Recombinant Factor C Endotoxin Detection Assay, the steps are as follows: add 100 μL of endotoxin standard, LPS sample and blank control to the enzyme-labeled microplate and pre-incubate at 37°C for 10 minutes; take 100 μL of working solution, including recombinant factor C solution, fluorescent substrate and assay buffer, and add it to the sample well. Use an enzyme-labeled instrument to read the optical density value at 450nm, draw a standard curve and calculate the LPS content, expressed in international units (IU / mL).

[0089] 2. Test results

[0090] like Figure 5 As shown in the results, the LPS content in the deletion strain CE041Δs053 was significantly lower than that in the wild-type strain CE041 ( ** P<0.01).

[0091] like Figure 6 As shown, the LPS content in the MVs produced by the deletion strain CE041Δs053 was also significantly lower than that in the MVs produced by the wild-type strain CE041 ( ** P<0.01).

[0092] The experimental results of this example show that the lipopolysaccharide (LPS) content in the cell membrane of the deletion strain CE041Δs053 is significantly lower than that of the wild-type strain, and the LPS content on the membrane surface of the MVs of the deletion strain is also low, so it has lower cytotoxicity.

[0093] Example 6 Preparation and safety evaluation of MVs subunit vaccine of avian pathogenic Escherichia coli sRNA s053 gene deletion strain

[0094] 1. Preparation of subunit vaccines

[0095] The MVs of the deletion strain CE041Δs053 produced by natural culture (Example 3) and prepared by nitrogen cavitation (Example 4) were streaked on LB agar plates to observe whether colonies would appear. The results showed that no colonies grew on the plate, indicating that the prepared MVs did not contain live bacteria. Based on this, a subunit vaccine of the gene-deficient strain MVs was prepared, as follows:

[0096] The MVs protein concentration was determined using a BCA kit (Thermo Scientific), and MVs and adjuvant (ISA201VG) were formulated into a subunit vaccine at a volume ratio of 1:1 with a final MVs protein concentration of 2 mg / mL and stored at −20°C.

[0097] 2. Safety evaluation of subunit vaccines

[0098] (1) Experimental procedures

[0099] 60 7-day-old chicks (commercially purchased, the same below) were selected and divided into four groups, with 20 chicks in each group. Before the experiment, the chicks were tested for E. coli to ensure that they were not infected with E. coli. The chicks with negative test results were selected as test subjects. Each chick in the first and second groups was inoculated with 0.1 mL of naturally produced or nitrogen cavitation-prepared MVs subunit vaccine, which contained 200 μg of MVs protein, through leg muscle injection. The third group was inoculated with 0.1 mL (containing 1.0×10 7 The wild strain CE041 was inoculated with PBS as a negative control. The status of the chicks was observed after inoculation.

[0100] 2. Experimental results

[0101] The experimental results showed that the chicks inoculated with the deletion strain MVs (Group 1), wild strain MVs (Group 2) and PBS (Group 4) did not die, were in good spirits, had normal appetite, and had no abnormal changes in organs. E. coli antibodies could be detected in the chicks' serum after inoculation. After inoculation with the wild strain CE041 (Group 3), the chicks showed symptoms such as loss of appetite, listlessness, and rough back hair. They began to die on the first day of inoculation and all died within 7 days. After autopsy, typical E. coli infection lesions were found.

[0102] The experimental results of this example show that the APEC membrane vesicle (MVs) subunit vaccine prepared by the gene-deficient strain CE041Δs053 has high safety.

[0103] Example 7 Determination of antibody levels in chicken serum induced by MVs subunit vaccine of gene-deleted strain CE041Δs053

[0104] 1. Immunization program for chicks

[0105] Sixty 7-day-old chicks were divided into three groups and immunized with naturally produced MVs subunit vaccine, nitrogen cavitation prepared MVs subunit vaccine and PBS (control group) respectively. The second immunization was carried out after an interval of 14 days. Blood was collected from the chicks one week after the second immunization, and the serum was separated and stored at -20℃.

[0106] 2. To determine the antibody level in the serum of chicks after secondary immunization, the wild strain CE041 protein was selected as the detection antigen of Escherichia coli and detected by ELISA method. The specific steps are as follows:

[0107] The wild strain CE041 was cultured in LB medium to the logarithmic phase, centrifuged, and washed with PBS. After lysis with lysis buffer, the whole bacterial protein was collected, and the protein concentration was determined by BCA. 0.5 μg of antigen was coated overnight at 4°C per well. Wash three times with 1×PBST (fill each well with washing buffer and pat dry vigorously), 3-5 minutes each time. Add blocking buffer at 37°C, block for 2 hours, and wash three times with 1×PBST, 3-5 minutes each time. Dilute the chicken serum sample, add 100 μL to each well, set up a negative control, incubate at 37°C for 2 hours, and then wash. HRP-labeled anti-chicken IgG was used as the secondary antibody, diluted 1:5000, and 100 μL was added to each well. Incubate at 37°C for 1 hour and then wash. TMB colorimetric agent was added to each well, and color was developed at room temperature in the dark for 15 minutes, and 2 mol / L H2SO4 was added to stop color development. The OD value at a wavelength of 450nm was read using an enzyme reader to evaluate the antibody level in the serum.

[0108] 3. Experimental results

[0109] like Figure 7 As shown, MVs subunit vaccines prepared by two different methods were tested one week after the second immunization. The results showed that both MVs subunit vaccines showed high antibody levels, and the antibody titer of the MVs subunit vaccine prepared by the nitrogen cavitation method was slightly higher than that of the subunit vaccine prepared from MVs produced by natural culture.

[0110] The experimental results of this example show that the MVs subunit vaccine prepared by the nitrogen cavitation method can effectively stimulate chickens to produce corresponding antibodies, and the antibody level is relatively high.

[0111] Example 8 Immunoprotective test of MVs subunit vaccine with gene-deleted strain CE041Δs053 on chickens

[0112] 1. Ten days after the second immunization, the chicks were challenged with wild strain CE041 (5.0×10 8 CFU / chicken). 24 hours after the challenge, 5 chicks were randomly selected from each group to determine the number of CE041 colonization in their lungs. The chicks were observed for 7 consecutive days and the survival status of each group was recorded to evaluate the protective effect of the vaccine.

[0113] The experimental results showed that after the challenge, the chicks immunized with the CE041Δs053 MVs subunit vaccine prepared by the two methods showed a 100% survival rate compared with the negative control group (mortality rate was 100%). The number of CE041 colonization in the chicks' lungs was also significantly reduced.

[0114] 2. In order to determine the cross-protection ability of CE041Δs053 MVs subunit vaccine against infection caused by different serotypes of avian pathogenic Escherichia coli, a challenge test was conducted using strains of different serotypes CE052 (O1), CE073 (O45) and CE084 (O101). The experimental results are shown in Table 2 below:

[0115] Table 2 Protection rate of different serotypes of strains

[0116]

[0117] Table 2 shows that the cross-immunity protection of CE041Δs053 MVs subunit vaccines prepared by the two methods to chicks is higher than 50%. The above experimental results confirm that the deletion strain CE041Δs053 MVs subunit vaccine has good immunogenicity and produces high immune protection and cross-immunity protection ability to chicks after vaccination.

[0118] The experimental results of the above examples show that the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053 of the present invention has a good immune protection effect and can be used as a subunit vaccine.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A strain of avian pathogenic Escherichia coli sRNA s053 gene deletion, characterized in that: The strain is CE041Δs053, its deposit number is CCTCC NO: M 20232290, and its classification name is Escherichia coli Escherichia coli CE041Δs053 is currently deposited in the China Center for Type Culture Collection.

2. Use of the sRNA s053 gene-deficient strain of avian pathogenic Escherichia coli according to claim 1 in the preparation of an avian pathogenic Escherichia coli subunit vaccine.

3. The use according to claim 2, characterized in that: The vaccine is a subunit vaccine prepared by mixing membrane vesicles prepared from the avian pathogenic Escherichia coli sRNA s053 gene deletion strain according to claim 1 with ISA201 VG adjuvant in a volume ratio of 1:

1.

4. The use according to claim 3, characterized in that: The subunit vaccine is a broad-spectrum subunit vaccine.

5. A subunit vaccine for avian pathogenic Escherichia coli, characterized in that: The invention comprises membrane vesicles produced by the avian pathogenic Escherichia coli sRNA s053 gene deletion strain according to claim 1 and ISA201 VG adjuvant in equal volume ratio.

6. The method for preparing a subunit vaccine of avian pathogenic Escherichia coli according to claim 5, characterized in that: The following steps are involved: Step 1) Prepare bacterial solution: streak the avian pathogenic Escherichia coli sRNA s053 gene deletion strain described in claim 1 on LB solid medium, pick a single colony and inoculate it on LB liquid medium for culture until the bacterial count reaches 5.0×10 9 CFU / mL; Step 2) Ultracentrifugation: Add the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053 cultured in step 1) to 500 mL LB broth medium, and culture at 37°C and 180 rpm for 12 h; centrifuge at 4°C and 8000×g for 10 min, discard the precipitate, and filter and sterilize the supernatant; then ultracentrifuge the supernatant at 4°C and 200000×g, discard the supernatant after centrifugation for 3 h, and resuspend the precipitate in TE buffer; Step 3) Density gradient centrifugation: The suspension obtained in step 2) was centrifuged at 4°C and 200,000×g for 2 h through iodixanol density gradients of 10%, 20%, and 40%. The separated liquids were collected after centrifugation, and then ultracentrifuged at 200,000×g. The precipitate was resuspended in TE buffer, filtered, and concentrated to obtain membrane vesicles of the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053, which were stored at 4°C. Step 4) The membrane vesicles obtained in step 3) are mixed with ISA201 VG adjuvant at a volume ratio of 1:1 to make the final concentration of the membrane vesicle protein 2 mg / mL, and stored at -20°C.

7. The method for preparing a subunit vaccine of avian pathogenic Escherichia coli according to claim 5, characterized in that: The following steps are involved: Step A) Preparation of bacterial solution: streak the avian pathogenic Escherichia coli sRNA s053 gene deletion strain described in claim 1 on LB solid medium, pick a single colony and inoculate it on LB liquid medium for culture until the bacterial count reaches 5.0×10 9 CFU / mL; Step B) Transfer the bacteria cultured in step A) to a centrifuge tube and culture at 37°C and 180 rpm for 12 h; centrifuge at 4°C and 8000×g for 10 min, discard the supernatant, resuspend the precipitate in PBS, and place on ice; Step C) Precool the nitrogen cavitation device on ice, place the precooled nitrogen cavitation device on a magnetic stirrer, put in a micro magnetic stirring bar, and connect it to a nitrogen tank; transfer the bacterial suspension obtained in step B) to the precooled nitrogen cavitation device, turn on the stirrer to mix the suspension; gradually pressurize until the pressure gauge reading stabilizes at 1500 PSI; close all valves, disconnect the nitrogen tank, and incubate on ice for 25 minutes to allow the nitrogen to fully dissolve and reach a balanced state; slowly open the valve to release the pressure and collect the bacterial lysate; Step D) The bacterial lysate obtained in step C) is first subjected to ultracentrifugation to obtain crude vesicles, and then subjected to density gradient centrifugation to obtain purified membrane vesicles, i.e., membrane vesicles of the avian pathogenic Escherichia coli sRNA s053 gene deletion strain CE041Δs053, which are stored at 4°C; Step E) The membrane vesicles obtained in step D) are mixed with ISA201 VG adjuvant at a volume ratio of 1:1 to make the final concentration of the membrane vesicle protein 2 mg / mL, and stored at -20°C.

8. The method for preparing a subunit vaccine of avian pathogenic Escherichia coli according to claim 7, characterized in that: In step D), the ultracentrifugation is specifically as follows: adding the bacterial lysate obtained in step C) to 500 mL LB broth medium, culturing at 37°C and 180 rpm for 12 h; centrifuging at 4°C and 8000×g for 10 min, discarding the precipitate, and filtering and sterilizing the supernatant; then ultracentrifuging the supernatant at 4°C and 200,000×g for 3 h, discarding the supernatant, and resuspending the precipitate in TE buffer to obtain a suspension that is a crude vesicle; The density gradient centrifugation is specifically as follows: the crude vesicles are centrifuged at 4°C and 200,000×g for 2 h through iodixanol density gradients of 10%, 20%, and 40%; the stratified liquid is collected after centrifugation, and then ultracentrifuged at 200,000×g, the precipitate is resuspended with TE buffer, filtered, and concentrated to obtain purified membrane vesicles.

9. A broad-spectrum subunit vaccine for avian pathogenic Escherichia coli, characterized in that: The invention comprises membrane vesicles produced by the avian pathogenic Escherichia coli sRNA s053 gene deletion strain according to claim 1 and ISA201 VG adjuvant in equal volume ratio.

Images