A design method of high-sensitivity microbial sensor for heavy metal copper detection

Abstract

This invention belongs to the field of environmental biodetection technology and discloses a design method for a highly sensitive microbial sensor for the detection of heavy metal copper. The invention introduces the cusR gene to form a positive feedback circuit, combined with a repL signal amplification module to further improve the fluorescence output intensity of the whole-cell biosensor; introduces the cusS gene to reduce the background fluorescence of the sensor, improving sensitivity and optimizing selectivity for copper ions; and uses a double knockout strain to lower the detection limit. Optimizing cell culture conditions during the testing process further significantly improves the sensor sensitivity. The finally constructed positive feedback whole-cell biosensor Cu26 based on the cusRS two-component system, under the newly invented culture and detection procedure, detects Cu26... 2+ The detection limit was reduced to 0.1 μM, and the induction coefficient at 1 μM reached ~100 times, significantly improving both sensitivity and selectivity, while greatly shortening the cell culture time during detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of environmental biological detection, and particularly relates to a design method of a high-sensitivity microbial sensor for heavy metal copper detection. BACKGROUND

[0002] Copper (Cu) as a common metal ion, widely exists in nature and human activities, because of its good electrical conductivity is widely used in power and electronic industry, and is also an essential trace element for human body, which is beneficial to human body. Although copper is beneficial to human and environment in many ways, excessive copper ion emission will cause serious harm. First, long-term exposure to high concentration of copper ion environment will cause various health problems, for example, excessive copper content in drinking water causes gastrointestinal discomfort, nausea and vomiting, and in severe cases, causes damage to liver, gallbladder, kidney and other organs, and also has irritant to eyes and skin. Secondly, if the copper-containing wastewater is used to irrigate farmland, copper will accumulate in soil and crops, causing poor growth of crops, especially rice and barley, and polluting grain kernels. Moreover, copper has great toxicity to aquatic organisms, and once caused oyster meat to turn green due to copper pollution in the coast and harbor. Therefore, it is necessary to develop a detection method that can sensitively and quickly detect copper ion pollution. Traditional electrochemical method and spectral method have high detection sensitivity and low detection limit, but need to use expensive instruments and complex sample pretreatment process, and need to be operated by professional detection personnel, which is difficult to realize real-time, low-cost and on-site detection, and also causes secondary pollution in the detection process. As a product of multi-disciplinary cross-fusion, the whole cell biosensor can overcome the limitations of electrochemical method and spectral method to a certain extent, and has simple operation, easy understanding and low detection cost. At present, many studies have used gene circuit design to construct whole cell biosensors for heavy metal ion detection.

[0003] Currently, there are two types of whole-cell microbial sensors for copper. One is a single-component system based on the transcriptional regulator cueR. In E. coli, the regulatory protein CueR can bind copper to turn on the transcription of the promoter PcopA, thereby causing the expression of the efflux protein CopA to be up-regulated, which expels copper ions from the cytoplasm to the outside of the cell. The other is a two-component system based on cusRS. Studies have shown that the cusRS two-component system in E. coli can respond to heavy metal copper to maintain the balance of the cell in a copper-containing environment. The CusRS system is a typical two-component system, which contains two proteins: CusS is a sensor histidine kinase (SK) that undergoes autophosphorylation when it senses the presence of copper ions in the periplasmic space, and the phosphorylated CusS binds to the response regulator (RR) CusR, phosphorylating CusR. Phosphorylated CusR activates the PcusC and PcusR promoters, thereby activating the expression of downstream genes. The genes downstream of the PcusR promoter are cusS and cusR, so they form a positive feedback loop. The genes downstream of the PcusC promoter are cusCFBA, which function to expel all copper ions in the cytoplasm and periplasmic space to the outside of the cell. Many of the whole-cell biosensors for copper reported so far are based on the cueR regulatory system, and some can meet the basic requirements for detection, but their sensitivity is poor, especially at low concentrations (≤10 μM), and the degree of signal change is small, which limits their application in actual environmental detection, so it is necessary to optimize them or develop new sensors to replace them.

[0004] Single-component systems can usually only sense intracellular signal inputs, while two-component systems can sense extracellular, intramembrane, or intracellular signal inputs, so two-component systems can respond to a wider range of input signals, and have high specificity, making them irreplaceable in synthetic biology. In addition, the phosphorylation and dephosphorylation processes involved in signal transduction in two-component systems promote a significant increase in the response signal. Therefore, biosensors based on the cusRS system are a potential solution to weak signal responses. Although biosensors based on the cusRS system have been reported before, their sensitivity is not high enough and their detection limit is not low enough. In particular, during actual detection, other signal interference from the sample being tested and limitations of instrument detection capabilities can introduce significant errors, so a low multiple of signal change hinders the ability to assess the authenticity of the signal, so the challenge of improving the sensing coefficient (signal amplification multiple) poses a major obstacle to the practical application of biosensors. These circumstances provide ideas for further designing whole-cell biosensors for heavy metal ions with higher sensitivity and selectivity.

[0005] The application value of microbial sensors is mainly reflected in rapid on-site and online detection and early warning, such as testing whether the water source meets the standards of the World Health Organization or national standards. The World Health Organization stipulates that the copper content in drinking water should not exceed 2.0 mg / L (~30 μM), while my country has also clearly stipulated that the copper content in drinking water should not exceed 1.0 mg / L (~15 μM). Therefore, at low copper ion concentrations (≤10 μM), a strong signal response is a crucial test for whether such sensors can meet practical applications and achieve rapid conversion. However, reported copper-based microbial sensors have poor signal responses to low copper concentrations. Currently, the best-performing sensor is a cueR-based microbial sensor, which only shows a 2-fold signal enhancement at 1 μM and only a 15-fold signal enhancement even at 10 μM. The natural cueR system also cannot significantly improve the response coefficient (I / I0), even worse than cueR-based response systems. This means it is difficult to obtain microbial sensors with high response coefficients (I / I0) for practical analyte detection.

[0006] Based on the above analysis, the problems and shortcomings of the existing technology are as follows:

[0007] Employing cusRS-based biosensors has emerged as a potential solution to address weak signal responses. While cusRS-based biosensors have been reported previously, their sensitivity is insufficient and their detection limits are not low. Especially in practical detection processes, factors such as interference from other signals from the sample and limitations in instrument detection capabilities can introduce significant errors. Therefore, the low magnitude of signal change hinders the ability to assess signal authenticity, making the challenge of increasing the sensing coefficient (signal amplification factor) a major obstacle to the practical application of biosensors.

[0008] Existing microbial sensors for copper have poor detection sensitivity, especially for low concentrations of copper, and cannot meet the requirements for rapid detection and early warning of heavy metal copper by microbial sensors. Summary of the Invention

[0009] To address the problems existing in the prior art, this invention provides a design method for a highly sensitive microbial sensor for the detection of heavy metal copper.

[0010] This invention is achieved by constructing a highly sensitive microbial sensor for the detection of heavy metal copper using the cusRS two-component regulatory system for copper in *E. coli*. The effects of two important components, CusR and cusS, on sensor performance in the two-component system are elucidated for the first time. Furthermore, by optimizing the intracellular levels of both components, a sensor with high sensitivity and low detection limit is obtained, providing a theoretical basis for the construction of two-component sensors. Signal amplification is achieved through the use of an induced plasmid copy number amplification system, significantly increasing the intensity of the output signal and further improving detector performance. Based on this, the detection limit of the sensor is further reduced by double knocking out the copper resistance genes cusCFBA and cueO. Simultaneously, this invention is the first to introduce a repL-mediated adjustable plasmid copy number signal amplifier module into the copper sensor based on the cusRS two-component system, further enhancing its performance. In addition, the cell culture and detection steps in sensor use are optimized for the first time; the new detection procedure can significantly improve the sensor's response sensitivity and greatly shorten the detection implementation time. Ultimately, the high-efficiency copper sensor of this invention, under optimized detection procedures, can achieve up to 100 times signal enhancement at a low concentration of 1 μM copper ions, and shows no significant response to other heavy metals, exhibiting extremely high selectivity. It has great application value in fields such as rapid on-site detection, online monitoring, and water toxicity early warning.

[0011] A design method for a highly sensitive microbial sensor for the detection of heavy metal copper includes the following steps:

[0012] (1) The repL gene encoding the signal amplification module and the sfGFP green fluorescent protein gene encoding the reporter gene were amplified by polymerase chain reaction. The ribosome binding site sequence obtained from the iGEM database was used to connect the enzyme-digested gene elements with the plasmid pXW109Hg according to the circuit sequence PmerT-rbs1-repL-rbs2-sfGFP to construct the recombinant plasmid pXYHg1.

[0013] (2) The bidirectional promoters PcusR-PcusC and cusR genes encoding the positive feedback module were amplified by polymerase chain reaction, and the enzyme-digested gene elements were ligated with the recombinant plasmid pXYHg1 according to the circuit sequence cusR-PcusR-PcusC-repL-rbs2-sfGFP to construct the recombinant plasmid pCWCu1.

[0014] (3) The cusS gene encoding the background reduction module was amplified by polymerase chain reaction. The amplified gene element was then ligated to the recombinant plasmid pCWCu1 in the circuit sequence cusS-cusR-PcusR-PcusC-repL-rbs2-sfGFP to construct the recombinant plasmid pCWCu18. The E. coli DH5α strain carrying plasmid pCWCu18 is the sensor Cu18.

[0015] (4) The KanR gene encoding kanamycin resistance and the SpecR gene encoding spectinomycin resistance were amplified by polymerase chain reaction, respectively. The resistance gene fragments were electroporated into E. coli DH5α. The cusCFBA and cueO genes in the E. coli DH5α genome were knocked out by DNA homologous recombination. Single colonies grown on the resistance plate were selected for colony PCR. The PCR products were then sequenced and compared. The strains whose sequences matched the resistance gene sequences in the sequence listing were the E. coli DH5αΔcusCFBA / ΔcueO double knockout strains.

[0016] (5) The plasmid pCWCu18 was extracted from the preserved strain and electroporated into competent cells E. Coli DH5αΔcusCFBA / ΔcueO with the cusCFBA and cueO genes knocked out. Single colonies grown on the resistant plate were picked for colony PCR and the strains that were transformed into the constructed plasmid were screened. This strain is the high-sensitivity copper ion whole-cell biosensor Cu26 based on the positive feedback of the cusRS two-component system.

[0017] Furthermore, the PmerT nucleotide sequence in step (1) is shown in SEQ ID NO.1, the rbs1 nucleotide sequence is shown in SEQ ID NO.2, the repL nucleotide sequence is shown in SEQ ID NO.3, the rbs2 nucleotide sequence is shown in SEQ ID NO.4, and the sfGFP green fluorescent protein nucleotide sequence is shown in SEQ ID NO.5.

[0018] Furthermore, the PcusR-PcusC nucleotide sequence in step (2) is shown in SEQ ID NO.6, and the cusR nucleotide sequence is shown in SEQ ID NO.7.

[0019] Furthermore, the cusS nucleotide sequence in step (3) is shown in SEQ ID NO.8.

[0020] Furthermore, the KanR nucleotide sequence in step (4) is shown in SEQ ID NO.9, and the SpecR nucleotide sequence in step (4) is shown in SEQ ID NO.10.

[0021] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:

[0022] First, although current copper whole-cell sensors have advantages such as simple operation and low cost, existing technologies also have significant problems, especially poor signal response to low concentrations of copper (≤10μM), with very low signal enhancement factor, making them difficult to use for practical detection. In the past few decades, although many technologies have been optimized for this type of sensor, this problem has not been well solved. This invention modifies the sensor based on the E. coli cusRS two-component system in the following aspects to solve this problem: (1) In-depth study of the regulatory mechanism of the cusRS two-component system, revealing for the first time the effects of the two components CusR and CusS on the sensor performance. By introducing the cusR gene to form a positive feedback circuit, combined with the repL signal amplification module, the fluorescence output intensity of the whole-cell biosensor is further improved; the introduction of the cusS gene reduces the background fluorescence of the sensor and improves the sensitivity. The combination of these two aspects greatly improves the sensor's response to low concentrations of copper; (2) Using the copper resistance genes cusCFBA and cueO double knockout strains to lower the detection limit, the response to even lower concentrations of copper is increased by 18 times; (3) Optimizing the cell culture conditions during the test process, further significantly improving the sensor sensitivity. This invention introduces a simplified procedure for testing: direct inoculation of -80℃ frozen bacteria for 2-4 hours of activation. This simplifies the detection process, shortens the detection time, and significantly improves the intensity of the output signal, enhancing the signal response. The resulting positive feedback whole-cell biosensor for Cu26, based on the cusRS two-component system, was constructed under the newly invented culture and detection procedure. 2+ The detection limit was reduced to 0.1 μM, and the induction coefficient at 1 μM reached ~100 times, significantly improving both sensitivity and selectivity, while greatly shortening the cell culture time during detection.

[0023] This invention demonstrates that in constructing whole-cell sensors based on two-component systems, introducing exogenous positive feedback circuits and signal amplifiers based on elements such as response regulators (RR) to enhance signal output intensity, introducing histidine kinase (SK) genes to reduce background, and simultaneously knocking out related efflux genes and metal ion oxidation / reduction detoxification genes, optimizing the detection method, are feasible strategies for improving whole-cell biosensors for heavy metal ions. Given that histidine kinase (HK) and response regulators (RR) function essentially the same in various two-component systems, these strategies are also applicable to the development of other two-component system-based sensors, providing a new theoretical basis and new technical methods for inventing other biosensors.

[0024] The invention yields several innovative technical benefits after addressing these issues: The Cu26 copper ion whole-cell biosensor provided in this invention, using the provided testing method at low copper ion concentrations, can achieve an induction coefficient of approximately ~100 times at 1 μM. The detection limit is lower than the maximum permissible concentration of copper in the WHO Drinking Water Quality Guidelines, which is 2 mg / L (~30 μM). Furthermore, it exhibits extremely high sensitivity (induction coefficient) at low concentrations, making it promising for on-site, real-time detection of copper ions in water samples. This invention overcomes the limitations of traditional methods based on natural two-component systems. By exploring the influence of each component in the two-component system on sensor performance, a positive feedback module is introduced based on the natural CuSRS two-component system to improve sensor performance. This invention also breaks through the traditional cell activation and culture conditions in whole-cell microbial sensor detection, developing an operating procedure that achieves higher sensitivity and faster detection.

[0025] Second, this invention develops a copper microbial sensor based on the cusRS two-component system, which can achieve ultrasensitive detection of low concentrations of copper. From the perspective of the whole or the product, the technical solution to be protected by this invention has the following advantages: (1) By optimizing the natural cusRS two-component system, introducing the repL plasmid copy number amplifier, knocking out the copper resistance genes cusCFBA and cueO, etc., the obtained sensor strain Cu26 has high sensitivity (~100 times) to low concentrations (1 μM) of copper, while having a low detection limit (0.1 μM). (2) The modified sensor Cu26 has extremely high selectivity for copper, and even for silver, which has signal interference in traditional sensors, it does not show a significant signal response. (3) The new cell culture and detection program developed in this invention achieves rapid detection while greatly improving the output signal and response sensitivity. Traditional conventional culture and detection procedures typically take 2-3 days from preparation to detection (day 1: streak plate activation of bacteria; day 2: single colony pick and overnight activation; day 3: transfer culture to logarithmic phase, then add analyte for detection). In contrast, this invention only requires inoculation and activation of the bacterial strain frozen at -80℃ for 2-4 hours, shortening the entire process by a full 2 ​​days. Furthermore, this new culture and detection procedure can achieve a stronger output signal and higher response sensitivity (I / I0 to 100 times) at a low concentration of 1 μM, truly realizing rapid and ultrasensitive detection for this type of microbial sensor.

[0026] Third, the technical solution of this invention fills a technological gap in the industry both domestically and internationally:

[0027] a. This invention reveals for the first time the influence of two important components in a two-component system—histidine kinase (HK) and response regulatory protein (RR)—on sensor performance. The introduction of the response regulatory protein can increase the output signal intensity of the whole-cell biosensor; the introduction of histidine kinase reduces the background fluorescence of the sensor. This mechanism is utilized for the first time to modify a traditional two-component system-based sensor, significantly improving its sensitivity. This technology has not been reported domestically or internationally, filling a gap in sensitivity performance optimization techniques for two-component based sensors.

[0028] b. This invention provides a novel detection method that uses strains frozen at -80°C for 2-4 hours for direct detection. This reduces the time required for conventional methods (approximately 3 days) to one day, simplifying the testing process for whole-cell biosensors, reducing the number of cell activations, and shortening the overall testing time. Most importantly, it significantly improves detection sensitivity at low concentrations, increasing the reliability of the detection. It also allows for dilution of actual samples to reduce interference. Such a detection method has never been reported before. Therefore, this invention greatly improves detection sensitivity at low concentrations and can be widely applied to all whole-cell biosensors, improving existing detection levels. It is also highly suitable for practical applications and has significant potential.

[0029] Does the technical solution of this invention overcome technical bias? The new detection method provided by this invention uses strains frozen at -80℃, which are activated for about 2-4 hours before being directly added with copper ions for detection. Results can be obtained in about 8 hours, greatly simplifying the testing process of whole-cell biosensors. Moreover, unlike conventional methods, it shortens the number of activations. In conventional methods, the process involves three activations: plating, inoculation, and transfer. The new method only requires one activation. It is generally believed that the more activations, the more newly generated cells, i.e., cells in better condition, which would make it easier to achieve ideal results. However, this invention shortens the number of activations, which greatly increases the induction fold at low concentrations. The signal response fold at 1μM increases from 18 times that of conventional methods to ~100 times. This significantly increases the reliability of experimental results while greatly shortening the overall testing time, showing great application potential.

[0030] Fourth, the design method provided by this invention demonstrates the construction process of a highly sensitive Cu26 microbial sensor for detecting the heavy metal copper. The technological advancements of this method are mainly reflected in the following aspects:

[0031] 1. Sophisticated genetic engineering design: By strategically combining different genetic elements (such as repL, sfGFP, cusR, PcusR-PcusC, etc.), recombinant plasmids with specific functional modules were constructed. This design not only considers signal amplification and reporting but also background signal reduction and the introduction of positive feedback mechanisms, making the sensor's response to copper ions more sensitive and specific.

[0032] 2. Enhance sensitivity by using a positive feedback mechanism: By introducing a positive feedback module (bidirectional promoter PcusR-PcusC and cusR genes), the sensor can amplify the signal after detecting copper ions, further enhancing the detection sensitivity.

[0033] 3. Minimization of background interference: By introducing the background reduction module cusS gene, non-specific signals are reduced, the signal-to-noise ratio of the sensor is improved, and the detection of copper ions is made more accurate.

[0034] 4. Customized host cell construction: By knocking out specific genes (cusCFBA and cueO) in E. coli DH5α and transferring the constructed plasmid into these gene-knockout cells, the performance of the sensor was further optimized, ensuring the specificity and sensitivity of the sensing system to copper ions.

[0035] 5. Practical considerations: The design of this sensor not only focuses on theoretical scientific innovation, but also takes into account the needs of practical applications. For example, by introducing resistance genes (KanR and SpecR), it is easier to screen and maintain the transformed cell lines, thus ensuring the stability and reliability of the sensor system.

[0036] The design method provided by this invention achieves high sensitivity and specificity for copper ion detection by comprehensively considering signal amplification, background reduction, positive feedback mechanisms, and host cell optimization, demonstrating significant technological advancement. This sensor has potential applications in environmental monitoring, food safety testing, and other fields. Attached Figure Description

[0037] Figure 1 This is a flowchart illustrating the design method of a highly sensitive microbial sensor for detecting heavy metal copper, provided in an embodiment of the present invention.

[0038] Figure 2 This is a gene circuit diagram of the pCWCu18 positive feedback plasmid based on the cusRS two-component system provided in this embodiment of the invention.

[0039] Figure 3 This is a Cu26 spectrum of a positive feedback copper ion whole-cell biosensor based on a cusRS two-component system provided in an embodiment of the present invention.

[0040] Figure 4 This is the spectrum of the recombinant plasmid pXYHg1 provided in the embodiments of the present invention.

[0041] Figure 5 This is the spectrum of the recombinant plasmid pCWCu1 provided in the embodiments of the present invention.

[0042] Figure 6 This is the spectrum of the recombinant plasmid pCWCu18 provided in the embodiments of the present invention.

[0043] Figure 7 This is a comparison of the concentration-fluorescence intensity diagrams of the Cu26 and Cu18 sensors provided in this embodiment of the invention under conventional culture conditions.

[0044] Figure 8 This is a schematic diagram of the new culture and detection procedure proposed in this invention.

[0045] Figure 9 This is a comparison of the concentration-response coefficient (I / I0) graphs of the Cu26 sensor provided in this embodiment of the invention under different culture conditions.

[0046] Figure 10 This is a fluorescence response diagram of the Cu26 sensor provided in this embodiment of the invention for different heavy metals. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0048] like Figure 1 As shown, the present invention provides a method for developing a highly sensitive microbial sensor for the detection of heavy metal copper, comprising the following steps:

[0049] S101, the repL gene encoding the signal amplification module and the sfGFP green fluorescent protein gene encoding the reporter gene were amplified by polymerase chain reaction, respectively. The ribosome binding site sequence obtained from the iGEM database was used to connect the enzyme-digested gene elements with plasmid pXW109Hg according to the circuit sequence PmerT-rbs1-repL-rbs2-sfGFP to construct recombinant plasmid pXYHg1;

[0050] S102, the bidirectional promoters PcusR-PcusC and cusR genes encoding the positive feedback module were amplified by polymerase chain reaction. The digested gene elements were then ligated with the recombinant plasmid pXYHg1 in the circuit sequence cusR-PcusR-PcusC-repL-rbs2-sfGFP using T4 DNA ligase to construct the recombinant plasmid pCWCu1.

[0051] S103 amplifies the cusS gene, which encodes the background reduction module, using polymerase chain reaction. The amplified gene element is then ligated to the recombinant plasmid pCWCu1 in the circuit sequence cusS-cusR-PcusR-PcusC-repL-rbs2-sfGFP using seamless cloning to construct the recombinant plasmid pCWCu18. The E. coli DH5α strain carrying plasmid pCWCu18 serves as the sensor Cu18.

[0052] S104, the KanR gene encoding kanamycin resistance and the SpecR gene encoding spectinomycin resistance were amplified separately by polymerase chain reaction. The resistance gene fragments were electroporated into E. coli DH5α. The cusCFBA and cueO genes in the E. coli DH5α genome were knocked out by DNA homologous recombination. Single colonies grown on resistance plates were selected for colony PCR. The PCR products were then sequenced and compared. The strains whose sequences matched the resistance gene sequences in the sequence listing were the E. coli DH5αΔcusCFBA / ΔcueO double knockout strains.

[0053] S105, plasmid pCWCu18 was extracted from the preserved strain and electroporated into competent cells E. coli DH5αΔcusCFBA / ΔcueO with the cusCFBA and cueO genes knocked out. Single colonies grown on the resistant plate were picked for colony PCR to screen for strains that were transformed into the constructed plasmid. This strain is the constructed high-sensitivity copper ion whole-cell biosensor Cu26 based on the positive feedback of the cusRS two-component system.

[0054] The gene circuit of plasmid pCWCu18 of S103 is as follows: Figure 2 As shown;

[0055] The gene circuit of the sensor Cu26 in S105 is as follows: Figure 3 As shown;

[0056] The recombinant plasmid pXYHg1 in S101 is shown in the image below. Figure 4 As shown;

[0057] The PmerT nucleotide sequence in S101 provided by this invention is shown in SEQ ID NO.1, the rbs1 nucleotide sequence is shown in SEQ ID NO.2, the repL nucleotide sequence is shown in SEQ ID NO.3, the rbs2 nucleotide sequence is shown in SEQ ID NO.4, and the sfGFP green fluorescent protein nucleotide sequence is shown in SEQ ID NO.5.

[0058] The recombinant plasmid pCWCu1 pattern in S102 is shown below. Figure 5 As shown;

[0059] The PcusR-PcusC nucleotide sequence in S102 provided by the present invention is shown in SEQ ID NO.6, and the cusR nucleotide sequence is shown in SEQ ID NO.7.

[0060] The recombinant plasmid pCWCu18 in S103 is shown in the image below. Figure 6 As shown;

[0061] The cusS nucleotide sequence in S103 provided by this invention is shown in SEQ ID NO.8.

[0062] The KanR nucleotide sequence in S104 provided by the present invention is shown in SEQ ID NO.9, and the SpecR nucleotide sequence in S104 is shown in SEQ ID NO.10.

[0063] The present invention provides that the recombinant plasmid pXYHg1 gene circuit in S101 is split to obtain the rbs1-repL-rbs2-sfGFP fragment, the sensor gene circuit in S102 is split to obtain cusR-PcusR-PcusC and repL-rbs2-sfGFP, the amplified genes are ligated, and the split fragments are assembled. The sensor gene circuit in S103 is split to obtain the cusR-PcusR-PcusC-repL-rbs2-sfGFP fragment.

[0064] The recombinant and target screening plasmid provided in S103 of this invention is a recombinant plasmid pCWCu18 containing sensor gene circuitry. The pCWCu18 recombinant plasmid map is shown below. Figure 6 As shown.

[0065] Through the above steps, the chassis cells of the positive feedback high-sensitivity copper ion whole-cell biosensor Cu26 based on the cusRS two-component system constructed in this invention are E. coli DH5αΔcusCFBA / ΔcueO, and the recombinant plasmid contained is pCWCu18.

[0066] The steps for using the high-sensitivity microbial sensor for detecting heavy metal copper provided by this invention are as follows:

[0067] a. Cell activation: The sensor cells stored in glycerol tubes at -80℃ were seeded into 1 mL of LB liquid medium containing ampicillin resistance and cultured in a shaker at 37℃ and 250 rpm for 2-4 hours.

[0068] b. Copper ion induction: Add different concentrations of Cu to each test tube. 2+ (0μM, 1μM, 10μM), after adding, place the test tube in a shaker at 37℃ and 250rpm for 5 hours.

[0069] c. Testing: After culturing for 5 hours, take 500 μl of each sample and wash it once with PBS buffer solution, then resuspend it with 1.5 ml of PBS buffer solution. Then, take 200 μl of each resuspended sample and place it in a 96-well microtiter plate. Measure the optical density at 600 nm using a microplate reader, and measure the fluorescence intensity using the excitation / emission wavelengths of 475 / 513 nm green fluorescent protein.

[0070] The induction coefficient I / I0 is defined as the fluorescence signal amplification factor, i.e., I / I0 = AFUX / AFU0. The relative fluorescence value (RFU) is divided by the sample absorbance to obtain the fluorescence value (AFU). The fluorescence value of samples with different concentrations of copper ions is AFUX; the fluorescence value of samples without copper ions is AFU0, serving as a control.

[0071] The LB culture medium for bacterial strain cultivation provided by this invention consists of: 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, diluted with deionized water, and sterilized at 121°C for 20 minutes.

[0072] Example 1: Construction of a positive feedback copper ion whole-cell biosensor based on a cusRS two-component system

[0073] (1) PCR amplification of gene fragments: Design specific primers for amplification fragments, and use high-fidelity polymerase to amplify rbs1-repL-rbs2-sfGFP (primers pMT012-SalI-repL-f and pMT012-ClaI-sfGFP-r), cusS (primers cuss-f4 and cuss-r4), cusR-PcusR-PcusC (primers F2 and R2), repL-rbs2-sfGFP (primers F1 and R1), cusR-PcusR-PcusC-repL-rbs2-sfGFP (primers cu18-VF and cu18-VR), kanR (pmt010-kana-f and pmt010-kana-r), specR (pTKRED-smr-f and pTKRED-smr-r). Each primer includes the module-specific primer sequence and restriction site or homologous arm.

[0074] I want to make sure that I have the right to vote:

[0075] pMT012-SalI-repL-f:tcg-GTCGAC-aaagaggagaataactagatgctgg;

[0076] pMT012-ClaI-sfGFP-r:tcc-ATCGAT-agtagcagcctgagtcgtt

[0077] pXW109Hg-claI-f:tcc-ATCGAT-tagcatgcataccgaacagc;

[0078] pXW109Hg-SalI-r:tct-GTCGAC-tagtaggattggatagcgtaac;

[0079] F1:cg-gaattc-atgctggctaaagtcact;

[0080] R1:act-GTCGAC-cagaaatcatccttagcgaaag;

[0081] F2:cg-gaattc-ataatttctggtgatttatgccgccaactttactcg;

[0082] R2:acg-GTCGAC-TTACTGACCATCCGGCACCT;

[0083] cuss-f4:ctaaggatgatttgGTCG-AGGATTAAGCGGGTAATGTGAT;

[0084] cuss-r4:AGGTGCCGGATGGTCAGTAA-GCCATTTCAGCGCCCGTTTTC;

[0085] cu18-VF:TTACTGACCATCCGGCACCTCAAG;

[0086] cu18-VR:CGACcagaaatcatccttagcg;

[0087] pmt010-kana-f:TAAATCGGCCATATCTTCGGCTTCAGACTCGCTGAGCGCGTAACTGTTTG-ctcataggtgtcctggtaag;

[0088] pmt010-kana-r:GCTTATGCGCTGCCGGATGATGTGAAGTAAGACTTGCTCAGATTG

[0089] CTGAC-gcctcgtgatacgcctatt;

[0090] pTKRED-smr-f:GAGCCTATGTCTCCTTGTAAACTTCTGCCATTTTGTGTGGCCCTTGCGCT-taggcgcaatcactttcgtc;

[0091] pTKRED-smr-f:GTAATCCGCGATGAAGCGTCGGCTCTTGATTCGACGCAGTATCTCCGAT-tccagaaccttgaccgaac;

[0092] The PCR system for sequence amplification was 50 μL, including 25 μL of 2×Phanta Flash Master Mix (Dye Plus), 2 μL each of upstream and downstream primers, and 1 μL of template;

[0093] The PCR conditions for sequence amplification were: 95℃ pre-denaturation for 30s, 95℃ denaturation for 30s, 60℃ annealing for 30s (the annealing temperature was determined by the primers), 72℃ extension for 5-30s (the extension time was determined by the length of the amplified fragment), and 35 cycles followed by a final extension at 72℃ for 1 min.

[0094] (2) Construction of recombinant plasmids: The PCR amplification products with restriction enzyme sites were recovered and double-digested, and then ligated with the double-digested plasmid vector. The operation was performed according to the NEB T4 DNA ligase instructions. The ligation reaction system was 10 μL, including 1 μL of T4 DNA ligase buffer, 0.5 μL of T4 DNA ligase, and the vector and insert fragment were added at the optimal molar ratio of 1:10 (or 1:5). Then, deionized water was added to make up the system volume to 10 μL. The PCR amplification products with homologous arms were recovered and ligated with the PCR amplified plasmid vector. The operation was performed according to Monad's seamless cloning kit. The ligation reaction system was 10 μL, including 5 μL of Hi-Fusion cloning Mix V2, and the vector and insert fragment were added at the optimal molar ratio of 1:2. Then, deionized water was added to make up the system volume to 10 μL.

[0095] (3) Transformation: The recombinant plasmid was transformed into competent E. coli DH5α cells. Single colonies grown on antibiotic plates were picked for colony PCR to screen for strains correctly transformed with the construction plasmid. The plasmid was extracted from the correctly transformed E. coli DH5α cells and sent to a sequencing company for sequence alignment. For strains with correct sequences, the plasmid was extracted again for the next step of recombination, verification, and sequencing.

[0096] (4) Gene knockout / electroporation: The PCR fragment of the resistance gene was electroporated into E. coli DH5α(+PKD46) competent cells, and 2% arabinose was added. Single colonies on resistance plates grown at 30℃ were picked for colony PCR to screen for successfully knocked-out strains. The PCR products were purified and sent to a sequencing company for sequence alignment. Strains with correct sequences were cultured overnight at 42℃ to remove the PKD46 plasmid. The plasmid was extracted from E. coli DH5α cells containing the final recombinant plasmid and electroporated into double knockout cells E. coli DH5αΔcueO / cusCFBA. Strains that correctly incorporated the plasmid were screened by colony PCR. This strain is the constructed positive feedback high-sensitivity copper ion whole-cell biosensor based on the cusRS two-component system.

[0097] Example 2: Sensor Sensitivity Measurement

[0098] (1) Conventional method steps:

[0099] a. Cell activation: Sensor cells stored in glycerol tubes at -80°C were seeded onto LB solid medium plates containing ampicillin resistance and incubated overnight at 37°C. Single plaques from the overnight culture plates were picked and seeded into 5 mL of LB liquid medium containing ampicillin resistance and incubated overnight at 37°C and 250 rpm in a shaker to activate the cells.

[0100] b. Transfer culture: Dilute the activated strain 1:100 into 1 mL of fresh LB liquid medium containing ampicillin resistance, and incubate at 37°C and 250 rpm until the OD600 is about 0.6.

[0101] c. Copper ion induction: Add different concentrations of Cu to each test tube. 2+ (0μM, 1μM, 10μM), after adding, place the test tube in a shaker at 37℃ and 250rpm for 5h.

[0102] d. Testing: After culturing for 5 hours, 500 μl of each sample was washed once with PBS buffer, then resuspended in 1.5 ml of PBS buffer. 200 μl of the resuspended sample was then placed in a 96-well microtiter plate. The optical density at 600 nm was measured using a microplate reader, and the fluorescence intensity was measured using the excitation / emission wavelengths of 475 / 513 nm green fluorescent protein. The fluorescence value (AFU) and induction coefficient (I / I0) were calculated.

[0103] The fluorescence signal intensities of Cu18 and Cu26 at different copper concentrations under conventional methods are shown in the attached figure. Figure 7 As shown, the detection limit of sensor Cu26 is 0.1 μM under conventional detection conditions. The detection limit of sensor Cu18 is 1 μM. Moreover, the overall output signal of Cu26 is higher than that of Cu18, indicating that knocking out the copper resistance genes CusCFBA and cueO can reduce the detection limit while increasing the output signal strength.

[0104] (2) Steps of the new method developed in this invention:

[0105] a. Cell activation: Sensor cells stored in glycerol tubes at -80℃ were seeded into 1 mL of LB liquid medium containing ampicillin resistance and cultured in a shaker at 37℃ and 250 rpm for 3 h.

[0106] b. Copper ion induction: Add different concentrations of Cu to each test tube. 2+ (0μM, 1μM, 10μM), after adding, place the test tube in a shaker at 37℃ and 250rpm for 5h.

[0107] c. Testing: After 5 hours of incubation, take 500 μl of each sample, wash once with PBS buffer, then resuspend in 1.5 ml of PBS buffer. Next, take 200 μl of the resuspended sample from each well and place it in a 96-well microtiter plate. Measure the optical density at 600 nm using a microplate reader, and measure the fluorescence intensity using the excitation / emission wavelengths of green fluorescent protein at 475 / 513 nm. Calculate the fluorescence value (AFU) and the induction coefficient (I / I0). The new culture and detection procedure is attached. Figure 8 As shown.

[0108] The induction coefficients I / I0 of the Cu26 sensor under the new and conventional methods are shown in the appendix. Figure 9 As shown, under conventional detection methods, the I / I0 of Cu26 at a copper concentration of 1 μM is 18 times; under the new detection method, the I / I0 at a copper concentration of 1 μM is as high as 100 times, and the signal response is much higher than that of conventional methods.

[0109] When the induction coefficient is used to reflect the sensor's sensitivity, the Cu26 sensor exhibits extremely high sensitivity at low concentrations. This indicates that the combined use of the positive feedback module, RepL signal amplification module, CuS background reduction module, and gene knockout module effectively improves the sensor's sensitivity at low concentrations. Furthermore, optimizing cell culture conditions during detection can significantly enhance the output signal and detection sensitivity. The constructed sensor demonstrates higher sensitivity at low concentrations than almost all sensors constructed in related studies.

[0110] Example 3: Sensor Selectivity Measurement

[0111] (1) The cell activation and transfer culture procedures were the same as those in Example 2. The sensor cells were cultured in a shaker at 37°C and 250 rpm until the OD600 reached approximately 0.6. Then, different heavy metals (Co) were added. 2+ Hg 2+ As 3+ Zn 2+ Fe 3 + Ag + Cu 2+ Add the stock solution to each test tube in a certain proportion to make the final concentration 5 μM, and then place the test tubes in a shaker at 37℃ and 250 rpm for incubation.

[0112] (2) After culturing for 5 hours, samples were taken. Each sample was 500 μl and washed once with PBS buffer solution, then resuspended with 1.5 ml of PBS buffer solution. Then, each sample was 200 μl and resuspended in a 96-well microtiter plate. The optical density at 600 nm was measured using an ELISA reader, and the fluorescence intensity was measured using the excitation / emission wavelengths of 475 / 513 nm green fluorescent protein. The induction coefficient I / I0 was calculated in the same way as above.

[0113] As attached Figure 10 As shown, the Cu26 sensor exhibits a significant fluorescence response only to Cu2+ after the addition of different heavy metal ions, at a final concentration of 5 μM (Co 2+ Hg 2+ As 3+ Zn 2+ Fe 3+ Ag + Cu 2+ The induction coefficients are 0.84, 0.66, 1.14, 0.81, 1.12, 0.94, and 22.76, respectively, except for Cu. 2+ The induction coefficients of other heavy metal ions are all around 1, which is much lower than that of Cu. 2+ The induction coefficient proves that the sensor Cu26 is influenced by Cu. 2+ It has good selectivity.

[0114] The experimental results of the three sets of examples above demonstrate that the Cu26 positive feedback copper ion whole-cell biosensor based on the cusRS two-component system, constructed using the method provided in this invention, exhibits high sensitivity (induction coefficient), high selectivity, and low detection limit. Using the novel testing method proposed in this invention at low copper ion concentrations, an induction coefficient of approximately 100 times can be obtained at 1 μM. The sensor's detection limit is approximately 0.1 μM, far below the maximum permissible concentration of copper of 2 mg / L (~30 μM) in the WHO Drinking Water Quality Guidelines, making it a promising candidate for on-site, real-time detection of copper ions in water samples. This sensor possesses significant application value and potential, providing new methods and ideas for a deeper understanding of the efficient circuit combinations of positive feedback functional modules and control modules in two-component whole-cell sensors and for achieving real-time detection of heavy metal pollution in the environment.

[0115] It should be noted that embodiments of the present invention can be implemented in hardware, software, or a combination of both. The hardware portion can be implemented using dedicated logic; the software portion can be stored in memory and executed by a suitable instruction execution system, such as a microprocessor or dedicated-design hardware. Those skilled in the art will understand that the above-described devices and methods can be implemented using computer-executable instructions and / or included in processor control code, for example, such code provided on a carrier medium such as a disk, CD, or DVD-ROM, a programmable memory such as read-only memory (firmware), or a data carrier such as an optical or electronic signal carrier. The devices and modules of the present invention can be implemented by hardware circuitry such as very large-scale integrated circuits or gate arrays, semiconductors such as logic chips, transistors, or programmable hardware devices such as field-programmable gate arrays, programmable logic devices, etc., or by software executed by various types of processors, or by a combination of the above-described hardware circuitry and software, such as firmware.

[0116] This invention introduces the cusR gene to form a positive feedback circuit, combined with a repL signal amplification module to further enhance the fluorescence output intensity of the whole-cell biosensor; introduces the cusS gene to reduce the sensor's background fluorescence, improve sensitivity, and optimize its selectivity for copper ions; and uses a double knockout strain to lower the detection limit. Optimizing cell culture conditions during testing further significantly improves sensor sensitivity. The finally constructed positive feedback whole-cell biosensor Cu26 based on the cusRS dual-component system, under the newly invented culture and detection procedure, effectively detects Cu ions. 2+The detection limit was reduced to 0.1 μM, and the induction coefficient at 1 μM reached ~100-fold, significantly improving both sensitivity and selectivity while greatly shortening the cell culture time for detection. This invention demonstrates that using a two-component system, introducing a positive feedback circuit and a signal amplifier, introducing relevant genes to reduce background and knocking out relevant efflux genes and metal ion oxidation / reduction genes, and optimizing the detection method are feasible strategies for improving whole-cell biosensors for heavy metal ions, providing new ideas for the development and improvement of other biosensors.

[0117] The results in the above embodiments show that the sensor constructed using the novel detection method provided by this invention achieves extremely high sensitivity at low concentrations, as shown in the attached figure. Figure 8 As shown, the induction coefficient (sensitivity) of the Cu26 sensor can reach 100 times at 1 μM. Therefore, in practical detection, the actual sample can be serially diluted for detection, which can greatly reduce the interference of other impurities. For example, if the copper in the actual sample is between 30 and 50 μM, after dilution by 10, 50, and 100 times, the new method can still detect a signal change of about 100 times, with the induction coefficient far exceeding 10 times, greatly improving the reliability. At the same time, the interference is also greatly reduced after dilution. Moreover, the implementation method can be combined with hardware and software to develop small and portable devices for practical detection. Therefore, this new method has high value and application prospects in practical applications.

[0118] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

[0119] This invention relates to sequence listing:

[0120]

[0121]

[0122]

Images