Methods for reliable non-invasive preimplantation genetic testing

Abstract

The present invention relates to one or more accurate methods for non-invasive genetic testing before embryo implantation. Specifically, the present invention relates to a system and method for amplifying trace amounts of DNA in a solution, and a linkage analysis method for analyzing biological samples from culture fluid of in vitro cultured embryos to determine the susceptibility of genetic diseases in the embryos.

Description

Technical Field

[0001] The present invention relates to one or more accurate methods for non-invasive preimplantation genetic testing of embryos. Specifically, the present invention relates to systems and methods for amplifying trace amounts of DNA in a solution, and linkage analysis methods for analyzing biological samples in the culture medium of in vitro cultured embryos to determine the susceptibility of genetic diseases in the embryos. Background Art

[0002] Preimplantation genetic testing (PGT), as known in the art (Handyside et al., 1989 and 1990, for first-borns), has been widely used in clinical in vitro fertilization (IVF) to avoid selection of embryos with single-gene disorders ( monogenic disease )(Kerem et al., 1989; Handyside et al., 1992; Liu et al., 1994; Harton et al., 1996; Ao et al., 1998; Sermon et al., 1998; Xu et al., 1999; Hussey et al., 1999; Ray et al., 2000; De Rycke et al., 2001; Moutou et al., 2001; Verlinsky et al., 2001; Sermon et al., 2001; Girardet et al., 2003; Fiorentino et al., 2006; Kahraman et al., 2014), aneuploidy (Munné et al., 1993; Wilton et al., 2001; Wells et al., 2002; Treff et al., 2010; Gutiérrez-Mateo et al., 2011; Yang et al., 2012; Scott et al., 2013; Forman et al., 2013; Wells et al., 2014; Rubio et al., 2017), structural variation (Conn et al., 1998; Scriven et al., 1998; Coonen et al., 2000; Munné et al., 2000; Escudero et al., 2003; Melotte et al., 2004; Le Caignec et al., 2006; Traversa et al., 2010; Fiorentino et al., 2010; Fiorentino et al., 2010; Rius et al., 2011; Fiorentino et al., 2011; Treff et al., 2016; Zhang et al., 2017; Tan et al., 2013; Chow et al., 2018) or polygenic diseases ( polygenic disease)(Treff et al., 2019; Kumar et al., 2022). It has been reported that chromosome copy number analysis and linkage analysis as well as targeted haplotype analysis for mutations can be performed simultaneously using an NGS-based assay (Yan et al., 2015). Currently, for PGT, a trophectoderm (TE) biopsy is required (Dokras et al., 1990; Handyside et al., 1990; Kokkali et al., 2005), which is invasive and subject to sampling bias.

[0003] Amplification and genetic testing using cell-free DNA in blastocoel fluid (BF) has been reported as minimally invasive preimplantation genetic testing (Palini 2013; Gianaroli et al., 2014; Tobler et al., 2015; Magli et al., 2016; Zhang et al., 2016; Shangguan et al., 2017; Capalbo et al., 2018; Tsuiko et al., 2018; Magli et al., 2018).

[0004] The present invention describes a completely non-invasive preimplantation genetic testing method for aneuploidy and monogenic diseases using free DNA in discarded embryo culture medium (Galluzzi et al., 2015; Wu et al., 2015; Xu et al., 2016; Shamonki et al., 2016; Feichtinger et al., 2017; Lane et al., 2017; Liu et al., 2017; Ho et al., 2018; Vera-Rodriguez et al., 2018; Capalbo et al., 2018; Fang et al., 2019; Huang et al., 2019; Rubio et al., 2019; Yeung et al., 2019; Jiao et al., 2019; Ou et al., 2022).

[0005] Minimally invasive preimplantation genetic testing and non-invasive preimplantation genetic testing are two main methods to avoid biopsy damage in preimplantation genetic testing technology. The embryo culture method and the spent culture medium (SCM) collection method, as well as the single-cell whole genome amplification (scWGA) method for trace free DNA, can directly affect the results. The amplification success rate of samples from blastocyst cavity fluid (BF) and discarded embryo culture medium varies greatly among different clinical centers. When the same amplification method is used, the amplification success rate in BF is much lower than that in spent culture medium (SCM), such as 62.5% SCM vs 44.4% BF reported by Galluzzi et al. (2015) and 89.7% SCM vs 27.4% BF reported by Capalbo et al. (2018). Although the amplification success rate of SCM is higher than that of BF, the results of SCM are affected by maternal contamination and the addition of exogenous proteins in the embryo development culture medium. Studies have shown that maternal DNA fragments in maternal blood are longer than fetal DNA fragments (Chan et al., 2004), and the bias of amplification technology for fragment length makes it inefficient for fetal DNA amplification. In addition, it is also important to ensure the accuracy of amplification while maintaining the yield for clinical detection purposes. Currently, the commercial single-cell amplification kits available are based on DOP-PCR, MDA or MALBAC technology, and these commercial kits differ in amplification efficiency and fidelity (Huang et al., 2015). These methods are all exponential amplifications, which can cause high false negatives and false positives. In 2017, a new amplification method, linear amplification (Chen et al., 2017, US10,894,980, referred to as "LIANTI"), was invented. The false positive rate of SNP detection is much lower than that of other methods. However, these kits do not improve the DNA fragment length characteristics and high protein content contained in the culture medium, but only expand the reaction system, resulting in low amplification efficiency of the culture medium. There is an urgent need for an efficient and accurate amplification method to obtain more fetal DNA information in SCM or / and BF systems. However, the original LIANTI method has a very low yield and low reproducibility, and is not suitable for clinical application because embryos are precious.

[0006] In terms of analysis, there are many reports on non-invasive preimplantation genetic testing for aneuploidy (niPGT-A) (reviewed in Leaver et al., 2020), but only a few reports on non-invasive preimplantation genetic testing for single-gene disorders (niPGT-M) (Galluzzi et al., 2015; Zhang et al., 2016; Shangguan et al., 2018; Wu et al., 2015; Liu et al., 2017; Capalbo et al., 2018; Ou et al., 2022). In reports of niPGT-M testing using SCM, the genotype concordance in successfully expanded SCM compared with the results of trophectoderm biopsy also varies greatly, ranging from 21% to 88% (Capalbo et al., 2018; Liu et al., 2017; Ou et al., 2022). False positive and false negative rates, important indicators for evaluating the accuracy of the test method, were not mentioned in these papers. However, based on the genotype concordance rates reported in the literature, it can be judged that the false negative and false positive rates are very high, which is unfavorable for the clinical application of non-invasive PGT-M (Capalbo et al., 2018; Cimadomo et al., 2020). The most important criterion for PGT-M evaluation is not the genotype concordance rate, but the misdiagnosis rate. The misdiagnosis rate published by the ESHRE PGT Consortium is very low (<0.1%) (De Rycke et al., 2017). The risk of misdiagnosis of new detection methods should be evaluated and compared with traditional PGT-M.

[0007] In addition to detecting disease-associated mutation sites, the analysis method used in the reported papers is the linkage analysis method. When the allele drop-out (ADO) rate is lower than 5%, it is recommended to apply at least two valid information STR markers or SNP sites upstream and downstream of the mutation site (European Society of Human Reproduction and Embryology (ESHRE) 2020). Ou et al. used 4 SNP sites containing valid information, and Liu et al. used 10 valid SNP sites. Since the ADO rate of SCM or BF is much higher than 5%, using only a few valid sites for linkage analysis can easily lead to misdiagnosis. The distance between the effective SNP markers used and the pathogenic gene must also consider the risk of recombination.

[0008] In addition, maternal contamination can also lead to diagnostic errors. Widely used linkage analysis methods are based on the Lander-Green algorithm and its variants, which do not consider maternal contamination and require high-quality sequencing data (Lander et al., 1987; Kruglyak et al., 1996; Idury et al., 1997; Kruglyak et al., 1998; Abecasis et al., 2002). Direct application of these methods will lead to high misdiagnosis rates (Capalbo et al., 2018; Cimadomo et al., 2020). There are few linkage analysis methods that take into account the problem of mixing or contamination with maternal cells (Fan et al., 2002; Nabieva et al., 2020). However, they require higher quality sequencing data than those from culture fluid, and their main applications are based on maternal blood samples during pregnancy or cells in the placenta or amniotic fluid (Fan et al., 2002; Nabieva et al., 2020). These existing methods will lead to more diagnostic errors when applied to sequencing data from culture fluid. The high false-positive and false-negative rates of niPGT-M are mainly related to the low initial DNA content in SCM and the presence of maternal contamination and high ADO rates, which makes all these existing niPGT-M methods unsuitable for clinical application. The key to applying niPGT-M to clinical IVF is that the accuracy of this technology can reach the level of current PGT-M. For niPGT-M, the accuracy should be greater than 97% by detecting the presence of alleles carrying pathogenic mutations in embryos. To the best of our knowledge, there is currently no such linkage analysis method for non-invasive diagnosis. The most critical solution is to develop more accurate linkage analysis methods for samples with high ADO rates in the presence of maternal contamination. Summary of the invention

[0009] The present invention provides a DNA amplification method for amplifying low input amounts of DNA in a solution, and a novel linkage analysis method based on a Bayesian model to perform PGT-M and preimplantation polygenic disease genetic testing (PGT-P) analysis in the presence of maternal contamination and haplotype loss.

[0010] Embodiments of the present disclosure provide an improved wet lab method for DNA lysis, whole genome amplification (WGA) and next generation sequencing (NGS) of limited samples (e.g., clinical waste culture fluid, blastocoel fluid, single cells or a limited number of cells) to achieve high coverage, high accuracy, and high amplification success rate. The systems and methods described herein are intended to effectively amplify DNA with different fragment distributions in complex systems with high protein content.

[0011] The method is improved according to the LIANTI method described in the art to effectively improve amplification efficiency and achieve higher product yields. LIANTI's sequencing data shows high coverage (given sequencing depth), high accuracy (as indicated by low false positive rates), and low mosaicism. High accuracy during single-cell genome amplification is a key requirement for single nucleotide variant (SNV) detection, while low mosaicism is a key requirement for structural variation (SV) detection, both of which are very important for many single-cell genomics-based applications.

[0012] For example, in some embodiments, the present disclosure provides a method for lysing clinical samples before amplification, and a method for uniformly and effectively amplifying whole genome samples using a transposon-based method, including a) removing serum proteins in clinical samples and changing the lysis temperature and time to expose DNA as much as possible. In some embodiments, the sample of free DNA is in a waste culture fluid. In some embodiments, the sample of free DNA is in the blastocyst cavity fluid. Aspects of the present disclosure include b) improving subsequent amplification techniques, including but not limited to adjusting the concentration of proteases and / or transposons, adding DNA primers for reverse transcription, increasing the amplification cycle in the second strand DNA amplification step, etc. Therefore, accurate amplification can be achieved, and the yield can be increased to meet sequencing analysis. The amplified product can be used for library preparation methods for next-generation sequencing, or for targeted amplification of pathogenic locus regions, or for chip sequencing.

[0013] According to one aspect, the present disclosure provides a linkage analysis method to solve the problems of high haplotype large fraction loss (Large Fraction Loss of Haplotype, LFLoH) rate, low coverage, and high maternal cell contamination (Maternal Cell Contamination, MCC) rate, which may hinder the inference of inherited parental chromosomes at pathogenic mutation sites. According to the present disclosure, the linkage analysis described herein increases the number of SNPs or markers compared to existing methods to solve the high ADO rate, and further provides a set of linkage analysis methods based on Bayesian analysis, including: (a) combining the MCC rate and haplotype status of the SNP to calculate the likelihood of each single SNP; (b) recursively estimating the MCC rate and haplotype status of each SNP; (c) calculating the likelihood of observing SNP data in a region adjacent to the pathogenic mutation site; (d) determining whether the embryo carries the pathogenic chromosome and providing a confidence level.

[0014] Embodiments of the present disclosure provide an accurate linkage analysis of waste culture fluid and / or blastocoel fluid and / or samples with low input DNA. The present disclosure provides an amplification method for amplifying lower amounts of DNA in samples (such as waste culture fluid or single cells). The present disclosure also provides a Bayesian model for assisting PGT-M and PGT-P disease carrier analysis to improve accuracy and reduce the risk of misdiagnosis. The linkage analysis combines the MCC rate and haplotype status of the SNP, iteratively calculates the likelihood ratio of genetic disease-carrying chromosomes to disease-free chromosomes, and outputs the confidence level of the disease carrier analysis. The workflow of the analysis is shown in Figure 1 The method described herein minimizes the false negative rate of the output disease carrier analysis and identifies embryos with the highest probability of carrying healthy chromosomes. The Bayesian model takes as input the sequencing data and the parental haplotypes phased by the Merlin algorithm.

[0015] In order to improve the data quality, SNPs with very low quality were filtered out. Several parameters were estimated before calculating the likelihood ratio: sequencing error rate, MCC rate, and haplotype status. The MCC rate is defined as the ratio of DNA fragments derived from maternal chromosomes. Haplotype status is defined as the true parental source of DNA at each SNP and is divided into "paternal chromosome only", "maternal chromosome only" or "parental chromosomes". For example, paternal chromosome only indicates that the DNA detected at this SNP comes only from the father. The MCC rate and haplotype status are repeatedly calibrated until convergence.

[0016] Then, the likelihood of sequencing data within a specific physical distance from the pathogenic mutation site is recursively calculated. To complete the recursion, the recombination probability between adjacent SNPs is determined, and the likelihood of a single SNP is calculated. The recombination probability can be obtained from the long-standing DECODE dataset, while the single SNP likelihood is obtained from a binomial model whose parameters are determined by the estimated sequencing error rate, MCC rate, and haplotype status.

[0017] Unlike the fixed number of SNPs considered in previously published papers, the embodiments of the present disclosure describe adding SNPs one by one from the pathogenic mutation site and calculating the log-likelihood ratio of each SNP subset, thereby generating a curve of the relationship between the log-likelihood ratio and the physical distance of the terminal SNP. Typically, the curve starts at a point with a vertical coordinate close to zero and eventually stabilizes at a plateau as enough SNPs are added. Based on the characteristics of the curve, it is determined which chromosome is inherited and the confidence level of our disease carriage analysis is divided into four categories: high confidence, medium confidence, possible, and uncertain. Using this method, alleles can be accurately distinguished in the presence of maternal contamination. This method can achieve a detection accuracy of 100% for niPGT-M. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A workflow of an embodiment of an exemplary method for accurate non-invasive PGT is shown.

[0019] Figure 2 The mechanism of an exemplary amplification method with the addition of DNA primers is shown.

[0020] Figure 3 A- Figure 3 D shows the univariate titration results of this amplification method, including Figure 3 A) Protease working concentration, Figure 3 B) Transposome working concentration, Figure 3 C) primers for first-strand cDNA synthesis in reverse transcription, and Figure 3 D) PCR cycles for the second strand DNA step.

[0021] Figure 4 is a graph showing the genomic coverage of each sample in Case 1, including gDNA from the patient / proband, amplified discarded fetal DNA, and amplified culture medium DNA.

[0022] Figure 5 is a graph showing the genomic coverage of each sample in Case 2, including gDNA from the patient / proband, amplified discarded fetal DNA, and amplified culture medium DNA.

[0023] Figure 6 This is a schematic diagram of the genetic linkage analysis of the family in case 1. The chromosome with a slash carries the pathogenic mutation.

[0024] Figure 7 PRS scores for three discarded embryos and their corresponding waste media are shown.

[0025] Figure 8 A- Figure 8 C shows the copy number (CN) plot of spent culture fluid. Figure 8 A: Aneuploidy niPGT-A characteristic diagram. Figure 8 B: Characteristic diagram of chimeric niPGT-A. Figure 8 C: Euploid niPGT-A characteristic diagram. DETAILED DESCRIPTION

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. All patents, patent applications, and publications mentioned herein are incorporated by reference.

[0027] As used herein, the term "genetic disease" refers to a disorder caused by an abnormality in an individual's DNA or genes. These disorders can be inherited from both parents, or occur as a result of a spontaneous genetic mutation.

[0028] As used herein, the term "monogenic disease" refers to a genetic disorder caused by a single gene mutation. These diseases typically follow Mendelian inheritance and are passed down from one generation to another in a predictable manner.

[0029] As used herein, the term "polygenic disease" refers to a genetic disorder caused by the combined effects of multiple gene variations. These diseases are usually influenced by both genetic and environmental factors and do not follow simple Mendelian inheritance.

[0030] As used herein, the term "solution" refers to a liquid mixture in which a minor component (e.g., DNA) is distributed in a major component (e.g., solvent). In particular, the solution is a complex system with a high protein content, and the DNA in the solution can be as low as a picogram level. For example, the solution is a spent culture fluid or a blastocoel fluid.

[0031] As used herein, the term "pathogenic chromosome" refers to a chromosome or a chromosomal region that contains one or more genes that cause a specific genetic disease.

[0032] As used herein, the term "pathogenic mutation site" refers to a specific location within a gene or chromosome where a mutation occurs, leading to the development of a genetic disease.

[0033] As used herein, the term "transposon" refers to a nucleic acid sequence in DNA that can change its position within a genome. A transposon includes a transposase binding site and an RNA polymerase promoter sequence, as described in US 10,894,980 entitled "Methods of Amplifying Nucleic Acid Sequences Mediated by Transposase / Transposon DNA Complexes," which relates to linear amplification (which may be referred to as "LIANTI") via a transposon insertion amplification process, which is hereby incorporated by reference in its entirety.

[0034] As used herein, the term "transposome" refers to a group of transposases bound to transposon DNA, ie, a transposase / transposon DNA complex dimer.

[0035] As used herein, the term "first strand cDNA synthesis" refers to the formation of single-stranded DNA by reverse transcribing an RNA transcript of an original DNA fragment.

[0036] As used herein, the term "second strand DNA synthesis" refers to the formation of a complementary strand to the first strand cDNA after removal of RNA by RNase digestion.

[0037] As used herein, the term "allele type" refers to a specific variant of a gene at a specific location (locus) on a chromosome. Different alleles may have different effects on a trait or disease.

[0038] As used herein, the term "allele depth" refers to the number of reads (sequences) obtained for a specific allele at a given position. It indicates the abundance of the allele in a sample.

[0039] As used herein, the term "single nucleotide polymorphism (SNP)" refers to a variation of a single nucleotide base pair within a DNA sequence that occurs between members of a species. SNPs can affect traits, susceptibility to disease, and other genetic characteristics.

[0040] As used herein, the term "SNP density" refers to the number of SNPs in a specific region of the genome obtained from experimental data, divided by the number of all human common SNPs in the database with a minor allele frequency greater than 0.01.

[0041] As used herein, the term "haplotype" refers to a combination of alleles (genetic variants) at multiple loci on the same chromosome that are inherited together due to their physical proximity.

[0042] As used herein, the term "haplotype status" refers to whether the allele inherited from the father or mother at a specific SNP position is missing in the experimental data.

[0043] As used herein, the term "haplotype dropout" refers to a situation where a specific allele in a haplotype is lost in an obtained experimental sample.

[0044] As used herein, the term "mapping" refers to aligning sequence reads to a reference genome to determine their locations.

[0045] As used herein, the term "SNP calling" refers to the process of identifying SNPs from sequencing data.

[0046] As used herein, the term "phasing" refers to the process of distinguishing paternal and maternal chromosomes within a sequencing sample from any individual or embryo. This distinction can determine which specific alleles come from each parent. This is important for accurately understanding the inheritance of genetic variation and understanding how alleles are inherited together in a haplotype.

[0047] As used herein, the term "pre-phasing" refers to phasing the haplotypes of parents prior to performing disease carriage analysis on a biological sample.

[0048] As used herein, the term "recombination probability" refers to the probability that genetic recombination (exchange of genetic material) occurs between two specific loci on a chromosome during meiosis.

[0049] As used herein, the term "recursive algorithm" refers to a method of solving a problem by repeatedly applying the same procedure until convergence.

[0050] Unless specifically indicated to the contrary, articles such as "a," "an," or "the" are intended to mean "one or more."

[0051] Wet test

[0052] In one aspect, the present invention relates to a method for amplifying DNA in a solution, wherein the DNA content in the solution may be as low as a picogram amount, the method comprising the following steps:

[0053] 1) Sample lysis: Add lysis buffer to the solution and heat it, then add protease and incubate to fully expose the DNA, and then inactivate it at high temperature to obtain lysate;

[0054] 2) DNA amplification:

[0055] a. adding a transposome having a transposase and a transposon including a transposase binding site and an RNA polymerase promoter sequence to the lysate and inserting into the DNA fragment;

[0056] b. Fill the 9 bp gap caused by the Tn5 transposon insertion and extend it downward to both ends of each fragment;

[0057] c. performing in vitro transcription using the original sequence as a template;

[0058] d. adding a DNA primer to the reverse transcription system to form a first-strand cDNA by reverse transcription, wherein the DNA primer is complementary to the RNA strand corresponding to the Tn5 transposition binding site sequence; and

[0059] e. Formation of second-strand DNA through cyclic amplification.

[0060] Transposon-based amplification methods are based on those described in US 10,894,980.

[0061] According to one general aspect, a transposition system with an RNA polymerase promoter sequence is combined with an RNA polymerase and a reverse transcriptase together with a DNA primer to form a first-strand cDNA through reverse transcription, wherein the DNA primer is complementary to the corresponding RNA strand of the Tn5 transposition binding site sequence. According to one aspect, the transposon is inserted into the DNA in the sample. The RNA polymerase is used to prepare an RNA amplicon, which is then reversely transcribed into DNA together with the DNA primer. The complementary sequence of the DNA is prepared and a double-stranded genomic DNA sequence is formed.

[0062] According to one aspect, a method for amplifying double-stranded DNA is provided, the method comprising contacting DNA with a transposase (such as TN5 transposase) that binds to transposon DNA, wherein the transposon DNA comprises a double-stranded transposase (Tnp) binding site and an RNA polymerase promoter sequence to form a transposase / transposon DNA complex dimer, referred to as a transposome. The transposon DNA can be in the form of a single-strand extension, or each end is connected to the form of a ring of the corresponding chain of the double-stranded transposase binding site. The transposome is bound to the DNA target position along the double-stranded DNA, and the double-stranded DNA is cracked into a plurality of double-stranded fragments, wherein each double-stranded fragment has a first complex connected to an upper strand by the Tnp binding site and a second complex connected to a lower strand by the Tnp binding site. The transposon binding site is connected to each 5' end of the double-stranded fragment. According to one aspect, the transposase is removed from the complex. The double-stranded fragment is extended along the transposon DNA to make a double-stranded extension product with a T7 promoter at each end. According to one aspect, the gap that may be generated by the connection of the transposase binding site with the double-stranded genomic DNA fragment can be filled and extended. The double-stranded extension product is contacted with an RNA polymerase (such as T7 RNA polymerase) to make an RNA transcript of the double-stranded extension product. According to one aspect, multiple RNA transcripts of the double-stranded extension product are prepared using RNA polymerase. Using reverse transcriptase and a DNA primer complementary to the corresponding RNA strand of the Tn5 transposition binding site sequence, the RNA transcript is reversely transcribed into multiple corresponding single-stranded DNAs. Create a complementary strand of the single-stranded DNA to form multiple double-stranded DNAs. Then, high-throughput sequencing methods such as those known to those skilled in the art can be used to amplify and sequence the double-stranded DNA.

[0063] According to certain aspects, an exemplary transposon system is a Tn5 transposon system. Other available transposon systems are known to those skilled in the art and include the Tn3 transposon system (see Maekawa, T., Yanagihara, K., and Ohtsubo, E. (1996), A cell-free system of Tn3 transposition and transposition immunity, Genes Cells 1, 1007-1016), the Tn7 transposon system (see Craig, NL (1991), Tn7: a target site-specific transposon, Mol. Microbiol. 5, 2569-2573), the Tn10 transposon system (see Chalmers, R., Sewitz, S., Lipkow, K., and Crellin, P. (2000), Complete nucleotide sequence of Tn10, J. Bacteriol 182, 2970-2972), Piggybac transposon system (see Li, X., Burnight, ER, Cooney, AL, Malani, N., Brady, T., Sander, JD, Staber, J., Wheelan, SJ, Joung, JK, McCray, PB, Jr., et al. (2013), PiggyBac transposase tools for genome engineering, Proc. Natl. Acad. Sci. USA 110, E2279-2287), Sleeping-beauty transposon system (see Ivics, Z., Hackett, PB, Plasterk, RH, and Izsvak, Z. (1997), Molecular reconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and its transposition in human cells, Cell 91, 501-510), Tol2 transposon system (see Kawakami, K. (2007), Tol2: a versatile gene transfer vector in vertebrates, Genome Biol. 8 Suppl. 1, S7.).

[0064] According to certain aspects, exemplary RNA polymerase is T7 RNA polymerase. Other RNA polymerases available are known to those skilled in the art, and include T3 RNA polymerase (see Jorgensen, ED, Durbin, RK, Risman, SS, and McAllister, WT (1991) Specific contacts between the bacteriophage T3, T7, and SP6 RNA polymerases and their promoters, J. Biol. Chem. 266, 645-651), and SP6 RNA polymerase (see Melton, DA, Krieg, PA, Rebagliati, MR, Maniatis, T., Zinn, K., and Green, MR (1984) Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter, Nucleic Acids Res. 12, 7035-7056.).

[0065] According to one aspect, transposon DNA is designed to contain double-stranded 19bp Tn5 transposase (Tnp) binding site at one end, and this binding site is connected or connected with strong T7 promoter sequence.After transposition, Tnp and transposon DNA are combined with each other and dimerize to form transposome.Then transposome randomly captures or otherwise combines the DNA in the sample.Then, the transposase in the transposome cuts DNA, wherein a kind of transposase cuts the upper chain and a kind of transposase cuts the lower chain to create DNA fragmentation.Therefore, transposon DNA is randomly inserted into DNA, thereby leaves the gap of 9bp at the two ends of transposition / insertion site.The result is such DNA fragmentation: wherein the transposon DNA Tnp binding site is connected to the 5' position of the upper chain, and the transposon DNA Tnp binding site is connected to the 5' position of the lower chain.

[0066] After transposition, gap extension is performed to fill the 9bp gap and supplement the T7 promoter sequence originally designed in the transposon DNA. As a result, the active double-stranded T7 promoter sequence is connected to the two ends of each DNA fragment. Next, T7 RNA polymerase is added, and in vitro transcription is used to carry out linear amplification of the DNA fragment, thereby generating many RNAs containing the sequence identical with the original double-stranded DNA template. Finally, reverse transcription is carried out to form DNA by using reverse transcriptase and DNA primer as mentioned above, and then the second chain is synthesized, and the RNA of amplification is converted back into the double-stranded DNA molecule. Then the DNA fragment can be further processed to carry out standard library preparation, amplification and sequencing.

[0067] Specific Tn5 transposition systems are described and available to those skilled in the art. See Goryshin, IY and WS Reznikoff, Tn5 in vitro transposition. The Journal of biological chemistry, 1998. 273(13): p. 7367-74; Davies, DR, et al., Three-dimensional structure of the Tn5 synaptic complex transposition intermediate. Science, 2000. 289(5476): p. 77-85; Goryshin, IY, et al., Insertional transposon mutagenesis by electroporation of released Tn5 transposition complexes. Nature biotechnology, 2000. 18(1): p. 97-100; and Steiniger-White, M., I. Rayment, and WS Reznikoff, Structure / function insights into Tn5 transposition. Currentopinion in structural Biology, 2004.14(1): p.50-7, each of which is hereby incorporated by reference in its entirety for all purposes. Kits utilizing the Tn5 transposition system for DNA library preparation and other uses are known.See Adey, A., et al., Rapid, low-input, low-bias construction of shotgun fragment libraries by high-density in vitro transposition. Genome biology, 2010. 11(12): p. R119; Marine, R., et al., Evaluation of a transposase protocol for rapid generation of shotgun high-throughput sequencing libraries from nanogram quantities of DNA. Applied and environmental microbiology, 2011. 77(22): p. 8071-9; Parkinson, N. J., et al., Preparation of high-quality next-generation sequencing libraries from picogram quantities of target DNA. Genome research, 2012. 22(1): p. 125-33; Adey, A. and J. Shendure, Ultra-low-input, tagmentation-based whole-genome bisulfite sequencing. Genome research, 2012. 22(6): p. 1139-43; Picelli, S., et al., Full-length RNA-seq from single cells using Smart-seq2. Nature protocols, 2014. 9(1): p. 171-81; and Buenrostro, J. D., et al., Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nature methods, 2013, which are hereby incorporated by reference in their entireties for all purposes.See also WO 98 / 10077, EP 2527438 and EP 2376517, each of which is hereby incorporated by reference in its entirety.A commercially available transposition kit is sold under the name NEXTERA and is available from Illumina.

[0068] In vitro transcription (IVT) with T7 RNA polymerase can be used to create RNA amplicons. See Van Gelder, RN, et al., Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proceedings of the National Academy of Sciences of the United States of America, 1990.87(5): p.1663-7; Kawasaki, ES, Microarrays and the gene expression profile of a single cell. Annals of the New York Academy of Sciences, 2004.1020: p.92-100; Livesey, FJ, Strategies for microarray analysis of limiting amounts of RNA. Briefings in functional genomics&proteomics, 2003.2(1): p.31-6; Tang, F., K. Lao, and MA Surani, Development and applications of single-cell transcriptome analysis. Nature methods,2011.8(4Suppl):p.S6-11;Hashimshony,T.,et al., CEL-Seq: single-cell RNA-Seq by multiplexed linear amplification. Cell reports, 2012. 2(3): p. 666-73; and Shankaranarayanan, P., et al., Single-tube linear DNA amplification for genome-wide studies using a few thousand cells. Nature protocols, 2012. 7(2): p. 328-38, each of which is hereby incorporated by reference in its entirety. According to the present disclosure, IVT advantageously provides linear amplification in which all copies are generated from the original DNA template.The resulting RNA molecule can be reverse transcribed into single-stranded DNA, followed by complementary strand formation, thereby forming double-stranded DNA, which is the amplicon that is linearly amplified from the original DNA template.

[0069] In one embodiment, the solution is a culture fluid or a blastocoel fluid. In particular, the culture fluid or the blastocoel fluid has a high protein content and a low DNA input. According to one aspect described below, the method is applied to a culture fluid only as an example.

[0070] In one embodiment, the lysis buffer is 2x to 10x lysis buffer. The original volume of the culture fluid is much larger than the volume of a single cell. The amplification of the culture fluid in as many proportions as possible is achieved by using a very small amount of high concentration lysis buffer. This results in the maximum percentage amount of the culture fluid DNA used as a template in the amplification system.

[0071] In one embodiment, the working concentration of the protease in the cleavage mixture is higher than 0.6 mg / mL, preferably in the range of 0.8-2 mg / mL. For example, the working concentration of the protease is 0.6 mg / mL, 0.8 mg / mL, 1 mg / mL, 1.2 mg / mL, 1.4 mg / mL, 1.6 mg / mL, 1.8 mg / mL, 2 mg / mL or higher. The amount of the protease is increased to remove additional exogenous serum proteins.

[0072] In one embodiment, the incubation is performed at 45-60°C for 1 to 3 hours.

[0073] In one embodiment, the inactivation is performed at 80-90° C. The protease reaction time is shortened and the protease inactivation temperature is increased to ensure that there is no excess protease residue in the subsequent reaction.

[0074] In one embodiment, the working concentration of the transposome is above 6 nM, preferably in the range of 10-40 nM. For example, the working concentration of the transposome is 6 nM, 6.25 nM, 8 nM, 10 nM, 12.5 nM, 14 nM, 16 nM, 18.75 nM, 20 nM, 22 nM, 24 nM, 26 nM, 28 nM, 30 nM, 32 nM, 34 nM, 36 nM, 37.5 nM, 40 nM or more.

[0075] In one embodiment, the DNA primer has a length of 15 bp to 25 bp. Preferably, the 3' end of the DNA primer contains a 5'-GACAG-3' or 5'-CTGTC-3' sequence. For example, a random primer 5'-NNNNNNNNNNNNNNGACAG-3' or 5'-NNNNNNNNNNNNNNCTGTC-3' can be used. More preferably, the DNA primer contains a sequence as shown in 5'-AGATGTGTATAAGAGACAG-3' (Seq. ID No.: 1) or 5'-TCTACACATATTCTCTGTC-3' (Seq. ID No.: 2), or has at least 70%, preferably 80%, preferably 90%, preferably 95%, preferably 100% identity to Seq. ID No.: 1 or Seq. ID No.: 2. For example, a primer 5'-AGATGTGTATAAGAG-3' can be used.

[0076] The distribution of DNA in the culture medium was measured, and both long and short fragments of free DNA in the culture medium were determined. Since current commercial kits tend to amplify long fragments, the transposon-based amplification method described herein, which is based on those described in US 10,894,980 and improved herein, is designed to amplify both long fragments (e.g., greater than 1 kb in some embodiments) and short fragments (e.g., 100 bp to 600 bp, or less than 1 kb in some embodiments). The transposon amplification method described herein does not use self-priming, but rather DNA primers with appropriate concentrations added during the reverse transcription step to achieve maximum efficiency. The RNA generated by in vitro transcription is specialized at the 3' end by the sequence of the complete transposon DNA sequence. The two primers designed for reverse transcription (named 19_1 and 19_2) and their binding positions are shown in Figure 2 middle.

[0077] In one embodiment, cyclic amplification performs more than 4 cycles, such as 4 to 20 cycles, preferably 6 to 15 cycles. After the first cDNA chain is formed in reverse transcription, an additional amplification cycle is used to amplify the second DNA chain. As described in US10,894,980 and C Chen, D Xing, L Tan, H Li, G Zhou, L Huang, XS Xie, Science 2017; 356 (6334): 189-194, linear amplification is a high-precision amplification, however, the product yield of linear amplification is lower than exponential amplification. In order to facilitate clinical detection methods, the present disclosure provides a method for increasing amplification yield. In one embodiment, this is achieved during the reaction, wherein the second chain is formed by increasing the number of amplification cycles, so as to obtain enough DNA for sequencing library preparation.

[0078] The methods disclosed herein achieve a nearly 100% amplification success rate while maintaining amplification fidelity.

[0079] Dry experiment

[0080] In another aspect, the present invention relates to a method for analyzing a biological sample of a culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, the method comprising:

[0081] 1) Amplify DNA molecules in biological samples from culture medium of in vitro cultured embryos and / or biological samples from discarded embryos in a family;

[0082] 2) preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain multiple sequence reads;

[0083] 3) Performing positioning and SNP calling by a computer system to generate SNP data and controlling its quality;

[0084] 4) haplotype pre-phasing of blood samples of both parents or only one parent carrying the disease by a computer system;

[0085] 5) Combining the maternal cell contamination (MCC) rate and haplotype status, such as by using a computer system to calculate the likelihood of four possible inheritance scenarios for each single SNP, indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents;

[0086] 6) estimating the MCC rate by a computer system and determining the haplotype status of each SNP indicating whether DNA from only a single parent is present in the culture medium;

[0087] 7) Combining the likelihood of each single SNP with the recombination probability, such as by using a computer system to calculate the likelihood of observing SNP data in a region adjacent to the pathogenic mutation site;

[0088] 8) Determine whether the embryo carries the disease-causing chromosome and provide a confidence level.

[0089] In some embodiments disclosed herein, aforementioned steps 5 and 6 provide specific technical improvements relative to some prior art methods for determining whether an embryo carries a pathogenic chromosome using SNP data. For example, if a wet experiment provides a biological sample of extremely high quality without maternal contamination from a sample, thereby resulting in highly accurate and accurate SNP data, then one or more calculations performed in steps 5 and 6 may only provide slight improvements in accuracy. For example, the method for amplifying trace DNA in a solution (as stated in aforementioned step 1) is sometimes used to improve the quality of the resulting SNP data. However, despite attempts to improve the quality of biological samples (e.g., keeping free of contaminants, amplification, etc.), this is not always possible to achieve desired confidence or level. In addition, high ADO rates and maternal contamination are inherent characteristics of DNA content in certain biological samples (e.g., biological samples from the culture fluid of in vitro cultured embryos), and even if a wet experiment can achieve nearly perfect performance, this is also unavoidable. In contrast to the prior art systems, the novel and non-obvious calculations performed in steps 5 and 6 provide improvements in accuracy for analyzing biological samples from culture fluids of in vitro cultured embryos to more accurately determine the susceptibility of genetic diseases in embryos. The present disclosure does not rely solely on wet experiments and their known techniques to provide only extremely high-quality biological samples for linkage analysis and / or non-invasive preimplantation genetic testing, but includes one or more additional calculation operations performed in steps 5 and / or 6 to overcome various shortcomings in the prior art. In other words, the prior art systems do not have linkage analysis methods for non-invasive procedures similar to the features disclosed herein - for example, several embodiments disclosed herein can achieve very accurate linkage analysis methods even for those samples with high ADO rates in the presence of maternal contamination. Steps 1 to 8 are further described as follows.

[0090] Step 1): Amplify biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family The DNA molecule in this book.

[0091] In one embodiment, the embryo has contamination due to maternal cells and / or haplotype loss.

[0092] When neither the proband nor the grandparents were present, biological samples from discarded embryos in the family were used for the derivation of the following pre-phases, which will be discussed in detail below.

[0093] Step 2): Prepare a DNA library and sequence the DNA molecules in the biological sample to obtain multiple sequence reads.

[0094] Amplicons were sheared and library preparation was performed. The DNA sequencing libraries were sequenced on the Illumina platform to generate raw sequencing data.

[0095] Step 3): Mapping and SNP calling are performed by a computer system to generate SNP data and control its quality.

[0096] The original paired-end reads were Illumina sequencing adapters, inline barcodes, binding sequences, T7 promoter sequences, and low-quality ends trimmed by cutadapt. The valid reads (clean reads) were mapped to the human reference genome hg19 using BWA mem. Each BAM file was labeled in duplicate and sorted by MarkDuplicatesSpark of GATK 4.2.0. Base quality score recalibration (BQSR) was performed using BaseRecalibrator to generate the recalibration table, and then ApplyBQSR was used to adjust the base quality accordingly. For variant calling, GATKHaplotypeCaller generated a genomic variant call format (GVCF) file and a VCF file for each sample. GenotypeGVCF was used to perform joint genotyping for all samples. SNPs were filtered using variant quality score recalibration (VQSR) using HapMap 3.3, Omni 2.5, 1000Genome phase I, and dbSNP 151 as SNP training sets. A sensitivity threshold of 99% was selected for accurate SNP filtering. Bi-allelic SNPs were retained for subsequent analysis. The VCF contained the chromosome number, physical location, identification number (ID) and allele type of each SNP for each blood sample, biological sample of the culture medium of in vitro cultured embryos and / or biological sample of discarded embryos in the family, as well as sequencing quality, sequencing depth (DP, depth) and allele depth (AD).

[0097] SNPs with two different alleles were considered, and all SNPs with DP values ​​less than 5, or sequencing quality values ​​(QUAL) less than 30, or gene quality (GQ) values ​​less than 10 in blood samples were excluded because they were considered to be of too poor quality and too small a signal-to-noise ratio.

[0098] After removing low-quality SNPs, the upstream and downstream 10MB (million base pairs) of the pathogenic mutation site in the biological sample are defined as the adjacent region of the pathogenic mutation site. The sequencing error rate (SER) in the adjacent region is estimated. SNPs with genotype 00 of both parents or genotype 11 of both parents are selected. Ideally, in such SNPs, only the genotype identical to the genotype of the parents should be detected. Therefore, the sequencing data with genotypes different from the genotypes of the parents must be erroneous reads. Therefore, the estimated sequencing error rate (SER) is defined as the ratio of the total number of erroneous reads to the total number of reads.

[0099] The relative density of SNPs detected in the vicinity of the pathogenic mutation site was estimated and defined as the ratio of the total number of SNPs detected in the region to the total number of human common SNPs in the region. Here, human common SNPs are defined as all SNPs with a minor allele frequency (MAF) greater than or equal to 0.01, and the minor allele frequency of a group of alleles refers to the frequency of its second most common allele in the population. The human common SNP data updated in 2018 by dbSNP [Sherry et al., 2001] were used to calculate the relative SNP density of each sample.

[0100] After completing the above steps, culture fluid samples with abnormal MCC rate (>0.65 or <-0.5) or low SNP density (<0.001) or high sequencing error rate (>0.2) are considered to be of very low quality and are therefore excluded. Such culture fluids are classified as "undetermined" and the reasons such as low data quality are output. All samples that pass quality control will enter the next stage.

[0101] Step 4): haplotype prediction of blood samples of both parents or only the parent carrying the disease is performed through a computer system Mutually.

[0102] In order to infer the haplotype of the parents, any one or more of the genomic data of the following samples in the pedigree were used: a blood sample of the proband, a biological sample of an abandoned embryo, or a blood sample of at least one grandparent. When the proband or grandparent did not exist, the abandoned embryo was used for deduction. Since the abandoned embryo is a sample after amplification, it has the error introduced in the amplification process, so in order to ensure the accuracy of the deduction, at least two abandoned embryo data were used in parallel to perform deduction and correct each other for Mendel's error.

[0103] Plink 1.9 with option "--mendel" was used to identify loci with Mendelian errors. In addition, BEAGLE 4.0 was used to phase the genotype data, taking into account the parent-offspring relationship and eliminating loci containing Mendelian errors.

[0104] Step 5): Combining the maternal cell contamination (MCC) rate and haplotype status, the likelihood of four possible inheritance scenarios for each single SNP, indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents, is calculated by a computer system;

[0105] For the single SNP likelihood, a binomial distribution was used to construct the model (see the Appendix of Nabieva et al.

[2020] ), where the parameters of the binomial distribution used are the sequencing error rate MCC Rate And the AD values ​​detected for the two alleles of each single SNP. Specifically, the following

[0106]

[0107]

[0108] Defined as the theoretical ratio of the four chromosomes (paternal inherited chromosomes, paternal non-inherited chromosomes, maternal inherited chromosomes, and maternal non-inherited chromosomes) in the embryo culture medium. Taking LFLoH (defined below) into account, the following two formulas are used

[0109]

[0110] as well as

[0111]

[0112] where H is the haplotype status of the SNP.

[0113] Here, represents the multiplication of the corresponding positions. The paternal genotype of the nth SNP is represented by fGT=fGT1 / fGT2, and the maternal genotype is represented by mGT=mGT1 / mGT2, where fGT1, fGT2, mGT1, mGT2∈{0,1}. n =(fGT1,fGT2,mGT1,mGT2) is represented as a four-dimensional vector and refers to but is the theoretical probability of obtaining the ALT gene by randomly sampling a read at the nth SNP in the culture medium when taking into account the MCC rate and haplotype dropout. Therefore, the formula for the single SNP likelihood is

[0114]

[0115] For i,j=1,2.

[0116] In some embodiments, the same computer system can perform all steps of the method for determining the susceptibility of genetic diseases in the embryo. In other embodiments, one or more different computer processors in a computer system (for example, a computer subsystem) can perform one or more steps of the aforementioned method, without having to perform all steps. In other words, the computer system can comprise a plurality of subsystems, and each has its own computer processor, so that the calculation load of the plurality of steps narrated in the aforementioned method is distributed.

[0117] Step 6): Estimate the MCC rate and determine the haplotype status of each SNP, indicating whether DNA from only one parent is present in the culture medium 。

[0118] Step 6) also includes the following steps:

[0119] Step (a): Preliminary estimation of the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site.

[0120] The maternal cell contamination rate (MCC rate) is defined as the ratio of maternal DNA to the total amount of DNA in the embryo culture medium, and the value should be theoretically between 0 and 1. All SNPs with paternal genotype 00 and maternal genotype 11, or paternal genotype 11 and maternal genotype 00 in the adjacent region are selected. At these SNPs, it is theoretically determined whether each read detected in the culture medium is from the father or the mother, and the proportion of the read from the mother to all reads is calculated and used as an initial estimate of the MCC rate. In contrast to the prior art system that ignores the linkage analysis method for the non-invasive procedure similar to the features disclosed herein, the present disclosure provides various computational operations on SNP data, which can achieve a more accurate linkage analysis method even for samples with a high ADO rate in the presence of maternal contamination, as explained herein. In particular, in wet experiments using non-invasive procedures, poor data quality may sometimes occur because the missing DNA fragments from a single parent are usually long in length and contain dozens or more SNPs, so the sequencing capacity is negatively affected and weakened. The computational operations disclosed herein solve a real-world technical problem by enabling otherwise unusable biological samples to become useful for determining susceptibility to genetic disease in embryos.

[0121] In some instances, disclosed herein is a method for preparing a biological sample that cannot be sequenced originally for the culture fluid of in vitro culture embryo, wherein the basic biological sample quality is low, because it is in the presence of maternal pollution and has a high ADO rate. The preparation method converts the SNP data produced by the biological sample that cannot be sequenced originally into a state that can be analyzed to determine the susceptibility of genetic diseases in the embryo. For the purpose of determining the susceptibility of genetic diseases in the embryo, low-quality DNA samples cause most of the data to be unsequenced. In addition, the DNA in the embryo enters the culture fluid in a fragment form, so if some longer DNA fragments do not enter the culture fluid, it causes it to be unable to sequence (for example, the phenomenon of large haplotype loss (Large Fragment Loss of Haplotypes, LFLoH) defined herein). The present disclosure describes a method for preparing seemingly unsequenced data into a conversion state, wherein the SNP data obtained overcome the shortcomings of LFLoH, and the biological sample that could not be used before now appears to be available. Since the SNP data obtained from the wet experiment is based on a biological sample with less than ideal quality due to the aforementioned situation, a novel and non-obvious computational step is performed on the SNP data to convert seemingly unusable data into usable data; in some embodiments, particularly for the purpose of determining whether an embryo awaiting implantation carries a disease-carrying chromosome. Due to the innovative computational steps disclosed herein, another round of sequencing in the wet experiment can be avoided, saving time, supplies, labor, and other resources. As described in step 6(b) below, analyzing the LFLoH provides a deep understanding of whether parental DNA fragments are detected at each SNP, so that the final haplotype state labels at all SNPs are iteratively updated to become more accurate until the MCC rate converges or other final estimation criteria are reached.

[0122] It is worth noting that the aforementioned preparation method is different from the treatment method. The preparation method described herein is not only to identify the natural association between two naturally occurring characteristics of biological samples. For example, it may not be enough to list patent eligibility topics to identify potential organ rejection using only the natural association between the elevated cfDNA levels in the collected body samples and the health of organ transplantation. In contrast, in some examples disclosed herein, the calculation method disclosed in step 5 and / or step 6 enriches previously unusable biological samples into a transformed state, which provides accurate non-invasive verification of the susceptibility of genetic diseases in their embryos for prospective parents. By avoiding invasive procedures (such as inserting a large needle into the amniotic sac of a pregnant woman), the death of many expectant mothers and fetuses can be avoided. The disclosed preparation method provides a technical solution to real-world problems that previously posed a higher risk to fetuses, women, and their health.

[0123] Ideally, it is advantageous to be able to detect DNA from both parents in embryo culture fluid. However, in fact, in embryo culture fluid, it has been observed that a large part of the genome can only be detected from a single parent. This type of DNA loss is different from the traditional allele dropout (ADO), and ADO is caused by the heterogeneity of amplification, causing some shorter DNA fragments to be amplified unsuccessfully in a certain round of amplification, so the amplified DNA fragments are significantly less than other DNA fragments to be detected. It reflects the efficiency of the amplification method, and it relates to DNA fragments that are usually shorter and only contain about 1 or 2 SNPs. However, in the culture fluid samples obtained by non-invasive methods, the missing DNA fragments from a single parent are usually longer in length, and contain tens or more SNPs. This haplotype loss is not due to low amplification efficiency, but due to poor data quality. The DNA in the embryo enters the culture fluid in a fragmented form, so if some longer DNA fragments do not enter the culture fluid, it will cause it to be unable to sequence. We define Large Loss of Haplotype (LFLoH) as a phenomenon where a long and continuous DNA fragment from one or both parents does not enter the culture medium and is therefore not detectable in sequencing. The present disclosure provides a model to resolve LFLoH in a two-step process.

[0124] First, SNPs can be directly labeled based on their AD value as containing only paternal DNA (F), only maternal DNA (M), or both (FM). Others remain unlabeled.

[0125] In the second step, the SNPs surrounding the upstream and downstream of these marked SNPs are searched, and then it is determined whether the surrounding SNPs can be marked with the same markers as the SNPs marked in the first step. Specifically, in the first step, T is assumed to be a predetermined integer threshold (the default value is 3).

[0126] For SNPs in the vicinity of the pathogenic mutation site, those that met one of the following conditions were marked as F.

[0127] The paternal genotype is 00 and the maternal genotype is 11. AD0>T and AD1=0.

[0128] The paternal genotype is 11 and the maternal genotype is 00. AD1>T and AD0=0.

[0129] The paternal genotype is 01 and the maternal genotype is 00. AD0=0 and AD1>T.

[0130] The paternal genotype is 01 and the maternal genotype is 11. AD0>T and AD1=0.

[0131] Some SNPs marked as F can be further marked as F1 or F2, indicating that the detected SNP comes from the paternal chromosome or maternal chromosome of the father. Specifically, if the SNP meets one of the following conditions, the SNP marked as F is marked as F1.

[0132] The paternal genotype is 1|0 and the maternal genotype is 00. AD1>T and AD0=0.

[0133] The paternal genotype is 0|1 and the maternal genotype is 11. AD0>T and AD1=0,

[0134] Among them, 0|1 and 1|0 represent the paternal genotype, and the numbers on the left and right sides of | represent the paternal and maternal genes of the father at the SNP, respectively.

[0135] Similarly, a SNP labeled F is labeled F2 if the SNP meets one of the following two conditions.

[0136] The paternal genotype is 0|1 and the maternal genotype is 00. AD1>T and AD0=0.

[0137] The paternal genotype is 1|0 and the maternal genotype is 11. AD0>T and AD1=0,

[0138] SNPs that meet one of the following conditions are marked as M.

[0139] The paternal genotype is 00 and the maternal genotype is 11. AD1>T and AD0=0.

[0140] The paternal genotype is 11 and the maternal genotype is 00. AD0>T and AD1=0.

[0141] Due to the presence of MCC, no SNPs were labeled as M1 or M2. SNPs that met one of the following conditions were labeled as FM.

[0142] The paternal genotype is 00 and the maternal genotype is 11. AD1>[T / 2] and AD0>[T / 2];

[0143] The paternal genotype is 00 and the maternal genotype is 11. AD1>[T / 2] and AD0>[T / 2];

[0144] The paternal genotype is 01 and the maternal genotype is 11. AD1>[T / 2] and AD0>[T / 2];

[0145] The paternal genotype is 01 and the maternal genotype is 00. AD1>[T / 2] and AD0>[T / 2];

[0146] Where [] represents the floor function.

[0147] After the initial labeling process is completed, there are 5 possible labels: F, M, FM, F1, F2. Assume that there are several labeled SNPs in the vicinity of the pathogenic mutation site, with ordinal numbers -N1≤s1<s2<...<s D ≤N 2· For a specific SNPS marked d , in the sequence number S d -1 and S d +1 SNPs are searched between. d The first SNP is called the central SNP, and the S d -1 with S d The area between the SNPs is called the search area. The search area is divided into two parts: d The upstream and downstream parts of the nth SNP are assigned a label. In the downstream search, each SNP in the downstream search region is assigned a label. The nth SNP is represented as When searching upstream from the nearest marker SNP downstream, it is represented as

[0148] The search process in the downstream area only is described as follows as an example. First, is initialized to the labels assigned in the first labeling step. Next, assume that S d , S d +1, ..., S d +m-1 are marked as The next step is to search for the d +m) SNPs and determine whether the same label can be assigned to the SNP. The same label is assigned to the (S+m)th SNP if and only if the following equation holds: d +m) SNPs:

[0149]

[0150] Here, express For any l = s d ,s d +1,…,s d +m, λ0 is a predetermined threshold. The H in the summation refers to the summation of H=F, M, FM, F1, F2, and AD sd:sd+m Indicates {AD sd , A.D. sd+1 ...、AD sd+m}. P(·|·) refers to the conditional probability, specifically, dThe probability of observing an AD value at SNP, given that d The conditional probabilities are calculated in exactly the same way as the recursion described in the next section. For each central SNP, the haplotype states of up to 10 SNPs upstream or downstream are inferred.

[0151] Finally, as a result of the search procedure, there are at most two labels for each SNP. For those SNPs with less than two labels, the label is added as "unknown". Then, the two labels for each SNP are merged to finalize the labeling procedure of LFLoH. According to the final labeling principle, a SNP is labeled as F or M only after it is sufficiently confident that only the paternal or maternal DNA fragments are detected, otherwise the SNP is labeled as FM. Specifically, the final label of the nth SNP is

[0152]

[0153] Step (b): Recursively update the MCC rate and haplotype status of each SNP

[0154] The initial calculation of the MCC rate in the previous section was performed based on SNPs with homozygous but different parental genotypes, and it was assumed that both paternal and maternal DNA fragments were detected at these SNPs. However, analyzing the large haplotype loss (LFLoH) can provide new insights into whether parental DNA fragments are detected at each SNP, which can be helpful for re-estimating the MCC rate. With the new estimate of the MCC rate, the likelihood will change, and the final labels at all SNPs should be updated. Since the labels at the SNPs are closely involved in the MCC rate estimate and the two cannot be estimated at the same time, an iterative estimation method is adopted, whereby the estimate of each is updated with the current estimate of the other, and the process is repeated until convergence. At each stage, the MCC rate is first estimated using all SNPs marked as FM, and then the LFLoH of each SNP is estimated using the new MCC rate estimate. This process is repeated until the difference between two adjacent estimates of the MCC rate does not exceed a threshold (the threshold is set to 0.1 or 0.05), and the estimate in the final iteration is used as the final estimate of the MCC rate, and the corresponding LFLoH state is used as the final label of the haplotype state. If the MCC rate estimate does not converge after 10 iterations, the average of the 10 MCC rate estimates is regarded as the final estimate, and the haplotype state is updated using this estimate.

[0155] At least one advantage of the recursive program described herein is that it simplifies the calculation of the likelihood function to the calculation of the recombination probability and the single SNP likelihood ratio. Due to the technological progress resulting from the recursive program, the computational load on the processor in the computer system is improved. In addition to reducing the processor load, the recursive program can also result in less memory usage due to the calculation of the integration equation. The recursive program described herein is novel and non-obvious and is not well-known, conventional, and traditional.

[0156] Step 7: Combine the likelihood and recombination probability of each single SNP to calculate the region adjacent to the pathogenic mutation site The likelihood of observing SNP data within .

[0157] The present disclosure provides a method for recursively calculating the likelihood ratio. First, if the pathogenic mutation site is on the paternal chromosome, all SNPs with the final haplotype state labeled as F or FM and the paternal genotype being heterozygous are selected for recursion. If the pathogenic mutation site is on the maternal chromosome, all SNPs with the final haplotype state labeled as M or FM and the maternal genotype being heterozygous are selected. The pathogenic mutation site is still denoted as the 0th SNP. Among all the retained SNPs, those downstream have serial numbers 1, 2,..., N2, while the upstream SNPs have serial numbers -1, -2,... –N1. For the ith SNP, it is denoted as

[0158]

[0159]

[0160] AD i denotes the allele depth (AD) at the ith SNP, and AD i:j ={AD i , AD i+1 ..., AD i+j}, i < j. Since the genotype and haplotype labels at the pathogenic mutation site are given, the recombination and sequencing data in the upstream and downstream are conditionally independent, and the upstream and downstream analyses are processed separately. Here, the recursive formula for the downstream region is further described. Conditional on all the detected AD values and the inferred haplotype states of the SNPs in the observed neighboring region, the probabilities that the paternal embryonic chromosome is inherited from the grandfather or grandmother and that the maternal embryonic chromosome is inherited from the grandfather or grandmother are calculated. Specifically, the goal is to calculate

[0161] For i, j = 1, 2...

[0162] The following Bayesian formula is utilized

[0163]

[0164] With an uninformative prior:

[0165] For i,j=1,2

[0166] The next step is to recursively calculate

[0167] Using the formula

[0168]

[0169] The likelihood of a single SNP is And the initial value is

[0170] P(F n+1 =k,M n+1 =l|F n =i,M n =j) is the recombination probability.

[0171] The above recursive procedure simplifies the calculation of the likelihood function to the calculation of the recombination probability and the single SNP likelihood. The estimated recombination probability between any two positions in the human genome is obtained from the high-precision recombination rate database, as described by Kong et al.

[2002] . The single SNP likelihood is described in step (5).

[0172] Step 8): Determine whether the embryo carries the pathogenic chromosome and provide a confidence level.

[0173] After calculating the likelihood ratio, the log-likelihood ratio (LLR) is calculated to determine which of the two chromosomes from the father is passed on to the embryo and which of the chromosomes from the mother is passed on to the embryo. If the pathogenic mutation site is on the paternal chromosome, it is defined as follows

[0174]

[0175] Otherwise we define

[0176]

[0177] A positive LLR indicates that the data under consideration supports that the allele is inherited from the father of the parent carrying the disease. Otherwise, the data supports that it is inherited from the mother of the parent carrying the disease.

[0178] However, it is recognized that it is not possible to determine in advance how many SNPs are used to calculate the likelihood ratio. If a fixed number of SNPs are used for calculation, or if all SNPs within a fixed physical distance from the pathogenic mutation site are used for calculation, it is not possible to determine with certainty whether the information implied by these SNPs is sufficient to support the conclusion, and to what extent the likelihood ratio varies with the number of SNPs used.

[0179] Therefore, the log-likelihood ratio curve is plotted as a function of the number of SNPs used, and the characteristics of the curve are used to determine whether the embryo carries the pathogenic mutation site. SNPs are added to the likelihood ratio calculation successively, and for each N2=1, 2, ..., the likelihood ratio is calculated based on which chromosome of the parent the pathogenic mutation site is located, and the result is expressed as Then the physical distance from the N2th SNP to the pathogenic mutation site is plotted . Ideally, when the number of SNPs used is small, the data itself contains insufficient information about whether the embryo carries the disease-carrying allele, so the absolute value of the log-likelihood ratio is expected to be small and the curve should be close to the horizontal axis. As the number of SNPs used increases, more and more information is taken into account, and if the internal consistency of the data is good enough, the curve will rise or fall to a platform with a large enough absolute value. In order to make the log-likelihood curve more stable, the change in the log-likelihood ratio of each pair of adjacent SNPs is limited to no more than 5. When the log-likelihood ratio change is greater than the specified threshold, the change in the log-likelihood ratio value of the adjacent SNP pair will be truncated.

[0180] Finally, when the number of SNPs used is large enough to determine whether an embryo carries a disease-carrying allele, adding new SNPs can hardly change the log-likelihood ratio. Therefore, when the ordinate of the curve tends to be stable, the sign of the stable value can be used as a criterion for determining whether an embryo carries a disease-carrying allele, and its absolute value serves as a measure of the confidence level. In practice, the steady-state log likelihood ratio (SLLR) downstream of the pathogenic mutation site is defined as

[0181]

[0182]

[0183] in

[0184] Here, ε0 is a predetermined threshold. In the experiment, ε=0.1. Here, N0 is the number of SNPs required to identify stability, which is 30 by default. If there are no 30 consecutive SNPs with a log-likelihood ratio range of less than 0.1, N0 is reduced to 10 to detect whether the curve is stable. If there are fewer than 10 SNPs in the upstream or downstream region in the data, the region is ignored and the confidence interval is determined based on the curve on the other side. This occurs when the pathogenic mutation site is at either end of the chromosome or near the spindle. Similarly, we calculate the upstream steady-state log-likelihood SLLRup and express its arithmetic mean as the average steady-state log-likelihood ratio (Average Steady Log-Likelihood Ratio, ASLLR).

[0185] According to SLLR, ASLLR, and other characteristics of the log-likelihood curve, the confidence level of the judgment is divided into four categories: high confidence, medium confidence, possible, and uncertain. Specifically, if the SLLRup · SLLRdown of a sample is < 0, the sample is directly classified as "uncertain" because opposite conclusions are obtained from the upstream and downstream areas. For the remaining samples, the maximum different log-likelihood ratio (Maximally Different Log-Likelihood Ratio, MDLLR) is defined as:

[0186]

[0187] Finally, the confidence level is determined by

[0188] High confidence: If ASLLR>4, MDLLR=0 and |SLLR up |>1,|SLLR down |>1,N0=30

[0189] Medium confidence: If ASLLR≤4, MDLLR=0, |SLLR up |>1,|SLLR down |>1,N0=30orASLLR>4,MDLLR≥-5,N0=30

[0190] Possibly: If none of the above statements are true and the sample is not classified as “uncertain”

[0191] Following the above scheme, the genotype at any single SNP and which allele is inherited from each parent can be determined. This information can then be used to perform disease carrier analysis for single-gene diseases and to combine multiple identified SNPs of an embryo to determine its susceptibility to polygenic diseases.

[0192] The present invention also relates to a method for analyzing chromosome aneuploidy through biological samples of culture fluid of in vitro cultured embryos to perform pre-implantation aneuploidy gene detection.

[0193] In some instances, after determining in step 8 whether the embryo carries a disease-causing chromosome, optional additional step 9 can be performed. In an example, if the computer system determines that the embryo may carry a disease-carrying chromosome, and the confidence level is higher than the threshold value, the computer system output alarm can be caused, and it is suggested to abandon the embryo of prospective parents. On the contrary, if it is determined that the embryo carries a disease-carrying chromosome, but the determination value is lower than the threshold confidence level, the computer system can generate an alarm to the parties concerned. In an example, a specific treatment method (for example, retaining embryos, retaining embryos and transplanting them, discarding embryos, using the same, similar or other non-invasive or invasive methods to re-detect embryos, or other options) for a specific patient whose medical history has been known by a medical institution / provider can be generated by a computer system, so that medical professionals can be used to make suggestions to prospective parents. In another example, one or more method steps described herein can be used to select the embryo of the patient to carry out specific treatment or additional detection or preparation to achieve a specific result. For example, for some embryos that do not pass quality control, the determination of the computer system may not determine whether it carries a disease-carrying chromosome, and then one or more non-invasive techniques may be used to detect the embryo again, otherwise it may be discarded. Meanwhile, for those embryos that pass quality control, the computer system can output whether they carry disease-carrying chromosomes, with a certain confidence level. For those whose confidence level is above a threshold and diagnosed as not carrying disease-carrying chromosomes, the embryos may be selected and transplanted. Meanwhile, for those whose confidence level is below a high confidence level, the computer system can generate an alert, suggesting several options to medical professionals, including implantation with a certain risk, additional embryo testing, and other options.

[0194] Computer Systems

[0195] Any computer system mentioned herein can utilize any suitable number of subsystems. In some embodiments, the computer system includes a single computer device, wherein the subsystem can be a component of the computer device. In other embodiments, the computer system can include multiple computer devices, each of which is a subsystem with internal components.

[0196] A computer system may include multiple identical components or subsystems, for example, connected together through an external interface or through an internal interface. In some embodiments, a computer system, subsystem, or device may communicate via a network. In such an example, a computer may be considered as a client, and another computer may be considered as a server, wherein each computer may be part of the same computer system. The client and server may each include multiple systems, subsystems, or components.

[0197] It should be understood that any embodiment of the present invention can be implemented in a modular or integrated manner using hardware (e.g., an application specific integrated circuit or a field programmable gate array) in the form of control logic and / or using computer software with a general-purpose programmable processor. Based on the disclosure and teachings provided herein, those of ordinary skill in the art should know and understand other ways and / or methods of implementing embodiments of the present invention using hardware and a combination of hardware and software.

[0198] Any software component or function described in this application may be implemented as software code executed by a processor using, for example, conventional or object-oriented techniques, using any suitable computer language (e.g., Java, C++, or Perl). The software code may be stored as a series of instructions or commands on a computer-readable medium for storage and / or transmission, suitable media including random access memory (RAM), read-only memory (ROM), magnetic media (such as a hard drive or floppy disk) or optical media (such as a compact disk (CD) or DVD (digital versatile disk)), flash memory, etc. The computer-readable medium may be any combination of such storage or transmission devices.

[0199] Such program can also be used to be suitable for encoding and transmitting via the carrier signal of wired, optical fiber and / or wireless network transmission that meets multiple protocols (including the Internet).Like this, the data signal through such program coding can be used to create the computer-readable medium according to the embodiment of the present invention.The computer-readable medium encoded with program code can be encapsulated with compatible devices or provided separately with other devices (for example, via Internet download).Any such computer-readable medium can reside on or within a single computer program product (for example, hard disk drive, CD or whole computer system), and can be present on or within different computer program products in a system or network.Computer system can include monitor, printer, or other suitable display for providing any result mentioned herein to the user.

[0200] Any method described herein can be performed in whole or in part with a computer system comprising one or more processors, and the computer system can be configured to perform each step. Therefore, the embodiment can be related to a computer system configured to perform any method step described herein, and may have different components for performing corresponding steps or corresponding groups of steps. Although presented as numbered steps, the method steps herein can be performed simultaneously or in different orders. In addition, the parts of these steps can be used together with the parts of other steps from other methods. Moreover, all or part of the steps can be optional. In addition, any step of any method can be performed using a module, a circuit or other devices for performing these steps.

[0201] Example

[0202] The present invention will now be illustrated, but not limited, by reference to the specific embodiments described in the following examples.

[0203] Example 1: Study Subjects

[0204] The first case was an autosomal dominant disease. The wife had a family history of autosomal dominant disorders and had hereditary osteogenesis imperfecta (OI), which is characterized by easy fractures without obvious cause or minor injury. The couple already had an affected son who also had OI. The wife's genetic diagnosis showed a COL1A1 (collagen, type I, α1) gene deletion c.299-14_c.302del, which is a known cause of this disease. The couple was treated with PGT-M. Eighteen metaphase-II oocytes were collected and fertilized by intracytoplasmic sperm injection (ICSI). Twelve embryos developed to the blastocyst stage, and several trophectoderm cells were removed from each embryo for biopsy for PGT-M.

[0205] The second case is an autosomal recessive disease. Both parents carry recessive hereditary deafness. The wife's genetic diagnosis showed an insertion of c.99_100insT at the USH2A gene. The husband's genetic diagnosis showed the presence of a duplication of c.991dupA and a mutation c.5699G>T at the USH2A gene. The couple already has a deaf daughter whose genetic diagnosis showed that she inherited the insertion of c.99_100insT, a duplication of c.991dupA, and a mutation c.5699G>T at the USH2A gene from her parents. These mutations cause deafness. The couple was treated with PGT-M. Nine metaphase-II oocytes were collected and fertilized by ICSI. Four embryos developed to the blastocyst stage, and several trophectoderm cells were removed from each embryo for biopsy for PGT-M.

[0206] Blastocyst biopsy and PGT-M testing. ICSI uses a standard protocol. Embryos are cultured individually in 15-μL droplets of Vitrolife G series culture medium balanced with human serum albumin (HSA) (LifeGlobal) covered with mineral oil in a dry atmosphere of 5% O2, 6-7% CO2 and N2 balanced in a Miri incubator (ESCO) at 37°C. On day 5 or 6, embryos are evaluated for trophectoderm (TE) biopsy. Some TE cells from each hatched blastocyst are biopsied and sent to an external PGT laboratory for PGT-M testing.

[0207] Example 2: Sample Collection

[0208] Culture fluid samples and discarded embryo collection. After the blastocyst is transferred to another culture dish for biopsy, 13 μL of waste culture fluid is taken out from each remaining waste culture fluid droplet. Abandoned embryos and their corresponding waste culture fluid samples are also collected for analysis. Each discarded embryo is gently moved to the edge of its microdroplet with a pipette tip, then removed and transferred to a PCR tube containing 3 μL of lysis buffer without RNase-DNase. The pipette tip is replaced between the collection of each sample to avoid cross contamination of the sample. The culture fluid droplets incubated and collected under the same conditions as those for blastocyst culture (but never containing embryos) serve as negative controls.

[0209] All samples were frozen immediately after collection and stored at −80°C until analysis.

[0210] Example 3: Lysis Protocol

[0211] Spent culture lysis. Thaw the frozen 13 μL spent culture sample and mix gently, and transfer 10.8 μL into a PCR tube (Maximum Recovery, Axygen) containing 1.2 μL 10x lysis buffer (1x lysis buffer: 60 mM Tris-Ac pH 8.3, 2 mM EDTA pH 8.0, 15 mM DTT, 0.5 μM vector ssDNA (5'-TCAGGTTTTCCTGAA-3', Thermo Fisher Scientific, PAGE purified oligonucleotides)) and spun down. Heat it at 75°C for 30 minutes. Then incubate at 75°C for 30 minutes. Add 0.5 μL 35 mg / mL QIAGEN protease (dissolved in water and stored at 4°C), centrifuge, and incubate at 55°C for 2 hours, then incubate at 80°C for 30 minutes. The resulting lysates in PCR tubes can be immediately subjected to modified linear transposon-based amplification as described herein, or stored in a freezer for later use.

[0212] Discarded embryo lysis. Frozen discarded embryos were thawed and heated at 75°C for 30 minutes. Discarded embryo samples were then lysed by adding 0.5 μL of 5 mg / mL Qiagen protease and heating in 3 μL of lysis buffer (55°C for 2 hours and 80°C for 30 minutes).

[0213] Example 4: Whole genome amplification

[0214] Transposome preparation. Transposon DNA (5' / Phos / CTGTCTCTTATACACATCTGAACAGAATTTAATACGACTCACTATAGGGAGATGTGTATAAGAGACAG-3', Thermo Fisher Scientific, PAGE-purified oligonucleotide) was annealed into a 1.5 μM self-circular structure by gradual cooling in annealing buffer (20 mM Tris-Ac pH 8.3, 50 mM NaCl, 2 mM EDTA pH 8.0). Then, 1.5 μM annealed transposon DNA was mixed with an equal volume of about 1 μM Tn5 transposase (Lucigen, EZ-Tn5 TM Transposase) was mixed and incubated at room temperature for 30 minutes to dimerize into a transposome with a final concentration of about 0.25 μM. The transposome can be stored at -20°C for a long time, and about 0.5 μL of the transposome is required for each single-cell transposon-based amplification.

[0215] Whole genome amplification was performed by a modified LIANTI (linear amplification via transposon insertion) method. Starting with culture lysate, 20 μL of transposition mixture was assembled in a buffer containing 2.5 mM MgCl2 and 18.75 nM transposome. The transposition reaction was performed at 55 ° C for 12 minutes. Then, 0.84 μL of EDTA and ssDNA mixture was added to each tube and incubated at 68 ° C for 30 minutes. After removing the transposase reaction, 0.2 μL Q5 HF DNA polymerase (New England Biolabs) was added and heated at 73 ° C for 45 seconds in the presence of 2 mM MgCl2 and 200 μM dNTPs to fill in and extend the fragment ends. 0.5 μL of 4 mg / mL Qiagen protease was added, and the PCR tube was heated at 50°C for 1 hour in the presence of 4 mM EDTA to inactivate the DNA polymerase, followed by heat inactivation of the protease at 77°C for 20 minutes in the presence of 450 mM NaCl (total volume of about 25 μL). The DNA fragments were amplified to RNA in 90 μL T7 in vitro transcription reaction mixture at 37°C overnight as described in US10,894,980 and C Chen, D Xing, L Tan, H Li, G Zhou, L Huang, XS Xie Science 2017; 356(6334): 189-194.

[0216] The next day, 10 μL of 0.5M EDTA was added to each tube, and the RNA was column purified (Zymo Research). 18 μL of RNA was transferred to a PCR tube containing 3.1 μL of a mixture of 6.5 mM each dNTP, 9.7 μM carrier ssDNA (5'-TCAGGTTTTCCTGAA-3', Thermo Fisher Scientific, PAGE-purified oligonucleotides) and 3.2 U / μL SUPERase In RNase inhibitor (Invitrogen). Denaturation incubation was 1 minute at 70°C, 15 seconds at 90°C, and then quenched on ice. Reverse transcription for the first strand was performed in 30 μL SuperScript IV reverse reaction system, which included 0.67 mM of each dNTP, 0.6 U / μL SUPERase In RNase inhibitor (Invitrogen) and 6 U / μL SuperScript IV reverse transcriptase (Invitrogen) in SuperScript IV buffer, and primer 5'-AGATGTGTATAAGAGACAG-3' (Thermo Fisher Scientific, PAGE purified oligonucleotides), and incubation program was 25°C 1 min, 37°C 1 min, 42°C 1 min, 50°C 1 min, 55°C 15 min, 60°C 10 min, 65°C 12 min, 70°C 8 min, 75°C 5 min, 80°C 10 min. RNA was then removed by incubation at 37°C with 10 ng / μL affinity purified RNaseA (Invitrogen) and 0.08 U / μL RNase H (New England Biolabs) for 30 min. Second strand synthesis was performed in 100 μL Q5 DNA polymerase system (New England Biolabs, 1X Q5 reaction buffer, 1X Q5High GC enhancer, 200 μM dNTP, 0.5 μM primer, 0.02 U / μL Q5 DNA polymerase), and primer 5'-NNNNNNNNGGGAGATGTGTATAAGAGACAG-3' (Thermo Fisher Scientific, oligonucleotides purified by PAGE). Each tube was heated at 98°C for 30 seconds, and then 10 cycles were used, i.e. 10 seconds at 98°C, 30 seconds at 58°C, 30 seconds at 60°C, 30 seconds at 65°C, 2.5 minutes at 70°C, and then 6 minutes at 72°C, to extend the chain. The resulting amplicon was column purified into 23 μL elution buffer and stored at -20°C.

[0217] The DNA concentration of the amplified product was measured using the Qubit dsDNA HS Assay Kit (Life Technologies) using a Qubit 2.0 Fluorometer (ThermoFisher Scientific). In the first case, 17 spent cultures were successfully amplified. In the second case, 9 spent cultures were amplified using this method. Eight of the cultures were successfully amplified, but one failed. The amplification success rate of the spent cultures was 96.15%.

[0218] Amplification of discarded embryo DNA. DNA was amplified according to the LIANTI amplification method described in US10,894,980 and C Chen, D Xing, L Tan, H Li, G Zhou, L Huang, XS Xie. Science 2017; 356(6334): 189-194, except that DNA primer 19_1 5'-AGATGTGTATAAGAGACAG-3' (Thermo Fisher Scientific, PAGE-purified oligonucleotide) was added to the first-strand cDNA synthesis reaction. Four discarded embryos in the first case and five discarded embryos in the second case were successfully amplified.

[0219] Example 5: Comparison of variables in lysis and amplification methods

[0220] As described in the LIANTI paper (Chen 2017) and the comparison of single-cell whole genome amplification methods paper (Huang 2015), the diploid human cell line BJ primary human foreskin fibroblasts (ATCC CRL-2522) were used. The BJ cell line was used as a standard sample for comparison of different lysis and amplification methods. To compare the performance of different amplification methods on spent culture medium, the BJ cell line was cultured in Eagle's minimum essential medium (ATCC) supplemented with 10% fetal bovine serum, 100 I.U. / mL penicillin and 100 μg / mL streptomycin in a 5% CO2 37°C incubator. After 48 hours, the culture medium of the BJ cell line was collected. Then, the BJ cells were trypsinized and washed in 1X PBS and then resuspended in 1X PBS. Then, single BJ cells were orally pipetted into a PCR tube containing 3 μL of lysis buffer.

[0221] Three single cells and three culture fluid samples were amplified using 0.5 mg / ml (working concentration) QIAGEN protease, 6.25 nM (working concentration) transposome, and the LIANTI procedure described in US10,894,980 and C Chen, D Xing, L Tan, H Li, G Zhou, L Huang, XS Xie. Science 2017; 356(6334): 189-194. No DNA was successfully amplified.

[0222] Then, the culture broth DNA was amplified using the amplification method described in Examples 3-4, except that a single variable was adjusted each time. Specifically, the variables included the working concentration of the protease, the working concentration of the transposome, the PCR cycles, and the primer sequences. Each variable was repeated three times.

[0223] The comparison results are shown in Table 1 and Figure 3 When 0.5 mg / ml (working concentration) of QIAGEN protease or 6.25 nM (working concentration) of transposome was used in combination with DNA primer 19_1, considerable DNA could be successfully amplified. When the working concentration of QIAGEN protease or transposome was increased, the amount of amplified DNA increased accordingly.

[0224] When no DNA primer (wo) is added, no DNA is successfully amplified regarding the LIANTI procedure described in US10,894,980 and C Chen, D Xing, L Tan, H Li, G Zhou, L Huang, XS Xie. Science 2017; 356 (6334): 189-194. However, when primers 19_1, 19_2, 15_1 or random primers 3+14N with specific sequences are added, considerable DNA can be successfully amplified. The amplification result of primer 25_1 is not as good as primers 19_1 or 19_2, which may be caused by the increased mismatch between primer 25_1 and the RNA chain of the Tn5 transposition binding site sequence. Preferably, the primer length is 15bp to 20bp. Compared with 3+14N, when random primers 5+14N are added, no DNA is successfully amplified, thereby verifying the importance of the 3' end sequence of the DNA primer.

[0225]

[0226]

[0227] Example 6: Library preparation for sequencing

[0228] After library preparation, the amplicon was subjected to conventional ultrasonic treatment (Covaris S2) to the length required by the sequencing platform. The final insert sequence size is suitable for 2X150 bp double-end Illumina sequencing. Following the manufacturer's instructions and skipping the optional size selection step, library preparation was performed by the NEBNext Ultra II DNA library preparation kit (New England Biolabs) for Illumina. For gDNA of blood samples, all samples were subjected to conventional ultrasonic treatment (Covaris S2). Library preparation was performed by PCR-free library preparation kit, NEBNext Ultra II DNA library preparation kit (NEB#E7645S / L) for Illumina.

[0229] Illumina sequencing. Bulk samples, culture fluid samples, and discarded embryo samples were sequenced on the Illumina NovaSeq 6000 system or Illumina HiSeq HiSeq 4000 platform by 2X150 bp paired-end sequencing. Using NEBNext indexing, sequencing lanes were shared by 24 samples. Each gDNA sample was sequenced to generate approximately 90Gb of raw data, and each culture fluid sample or discarded embryo was sequenced to generate approximately 30Gb of raw data.

[0230] Example 7: Mapping and SNP calling

[0231] The genome coverage and allele dropout rate of each sample were calculated. Although the LIANTI method described in US 10,894,980 and CChen, D Xing, L Tan, H Li, G Zhou, L Huang, XS Xie. Science 2017; 356(6334): 189-194 provides the highest genome coverage compared with other single-cell whole genome amplification methods (Chen et al., 2017), the genome coverage of DNA in the spent culture fluid showed extremely low genome coverage and high allele dropout rate. In the first case, the genome coverage of 17 spent culture fluids varied from 16.38% to 70.34%, as shown in Figure 2. Figure 4 In the second case, the genome coverage of the nine successfully amplified spent cultures varied from 4.79% to 34.97%, as shown in Figure 5 Their ADO rates are well above 5%. The genome coverage is far from reaching the standard that would allow linkage analysis of several loci (ESHRE 2020).

[0232] Example 8: Bayesian linkage analysis and disease carriage analysis

[0233] The dry experimental method described above was used for linkage analysis.

[0234] In the first case, the wife's heterozygous SNP on chromosome 17 and the husband's homozygous SNP were the subjects analyzed. Figure 6 In the figure, the linkage analysis diagram of the four SCMs in case 1 is shown. Among the four SCMs, 1-SCM-02 has the largest and most compact number of SNP loci, so the corresponding confidence level is "high confidence" when determining the genetic result of the absence of the mother's pathogenic allele in the embryo. In 1-SCM-05 and 1-SCM-07, although large haplotype fragments were lost, the detected SNPs were calculated by the Bayesian model, thereby supporting the inheritance of the pathogenic allele in the embryo at a "high confidence" level for disease carrier analysis. In contrast, in 1-SCM-06, fewer SNP loci were detected than in the other three SCMs, and the disease carrier analysis was at a "medium confidence" level when determining the absence of alleles causing genetic diseases.

[0235] For the second case, in order to perform linkage analysis on each embryo, the genomes of blood samples of the wife, husband and daughter carrying the disease were sequenced. All SNPs of these three individuals were called with a sequencing depth of >10x within 2Mb of the USH2A gene. For the mutation site carried by the wife (c.99_100insT), the heterozygous SNP on chromosome 1 of the wife and the homozygous SNP of the husband were the focus of analysis, and for the mutation site carried by the husband (c.991dupA and c.5699G>T), the heterozygous SNP on chromosome 1 of the husband and the homozygous SNP of the wife were the focus of analysis.

[0236] The results of all spent cultures from Cases 1 and 2 are summarized in Table 2 .

[0237] Table 2

[0238]

[0239]

[0240] For the first case, because the corresponding abandoned embryos were not collected, the sample lacked reliable standards, so the culture fluid of the abandoned embryo 1-SCM-11 was discarded. Among the remaining 16 culture fluids, two were excluded due to abnormal maternal cell contamination (MCC) rates. Before calibration, both MCC rates exceeded the standardized range (the ratio of 1-SCM-12 was -0.53, and the ratio of 1-SCM-15 was +0.663), which caused them to be eliminated from subsequent disease carrier analysis. The only culture fluid considered as "uncertain" in Example 1 is 1-SCM-10, which is attributed to the different tendencies of the steady-state log-likelihood ratios on both sides of the pathogenic mutation site. In the upstream, the log-likelihood ratio converges to about +10.1, and the log-likelihood ratio of the downstream converges to a value of about -11.3. Nevertheless, 13 samples were analyzed for disease carriers, and 8 samples were classified as high confidence, 2 samples were medium confidence, and 3 were possible. These results are consistent with biopsy examination.

[0241] For the second case, all 14 samples (7 culture fluids of each parent) are included in the final result. 2-SCM-03 was disqualified in the quality control stage due to its abnormal MCC rate (-0.501) after calibration, which excluded it from further analysis of two pathogenic mutation sites. In addition, 2-SCM-04 (maternal) and 2-SCM-08 (maternal) were marked as "uncertain", indicating uncertain results about whether the genetic genes from the mother are pathogenic. In the remaining 10 samples (6 paternal and 4 maternal), 3 were classified as "high confidence", 2 were "medium confidence", and 5 were "possible". Similarly, these results are consistent with those results from biopsy.

[0242] As a specific demonstration, the culture fluid 1-SCM-01 in the first case is the subject analyzed. Qualified SNPs are selected in the region extending 10Mbp upstream and downstream from the pathogenic mutation site, so that basic statistics, such as sequencing error rate and maternal cell contamination (MCC) rate, can be estimated. This includes removing all SNPs with parental allele depths lower than 5 or QUAL values ​​lower than 30. All SNPs with more than two alleles are removed. In this region, among 74935 SNPs, 11913 genotype quality (Genotype Quality, GQ) values ​​are 3 or lower. All GQ values ​​are 6 or lower SNPs are eliminated, which corresponds to the lowest 20% of all SNP GP values. In the remaining SNPs, 4911 SNPs are identified, wherein both parents show identical homozygous genotypes (that is, both are 00 or both are 11). In this subset, 220 SNPs show at least one error read. These 4911 SNPs generated a total of 45499 reads, of which there were 629 erroneous reads, resulting in an estimated sequencing error rate of 0.0138.

[0243] After scrutinizing all qualified SNPs, 484 SNPs were identified in which both parents showed different but homozygous genotypes (i.e., the paternal genotype was 00 and the maternal genotype was 11, or vice versa). The total number of reads of these SNPs was 4779, of which 3097 were derived from the mother and the remainder from the father. The data yielded an MCC rate of 0.296, calculated as (3097*2-4779) / 4779. After calibration, 332 of these 484 SNPs were classified as "only containing paternal chromosomes" or "only containing maternal chromosomes". The remaining 152 SNPs were considered as "containing parental chromosomes" for calculating the estimated MCC rate after calibration. These SNPs generated a total of 1761 reads, of which 955 were from the mother and the remainder were from the father, resulting in an estimated MCC rate of 0.0846. Using the calibrated MCC rate, the log-likelihood value was iteratively calculated according to the pathogenic mutation site. The log-likelihood ratio of any fragment of SNP (whether upstream or downstream) is negative. From the 21st SNP upstream (48003174th base pair), the log-likelihood ratio stabilizes at about -15.1. At the same time, in the downstream region, from the 7th SNP (48321621st base pair), the log-likelihood ratio stabilizes at about -11.2. Based on this analysis, it is inferred that the sample does not carry genes from maternal genetic diseases, and this result is marked as "high confidence". The allele classification results of SCM are compared with the results of TE biopsy or abandoned embryos, and the consistency rate is 100%. The method described herein has a sufficiently high accuracy for PGT-M.

[0244] Example 9: Disease carriage analysis of PGT-P

[0245] To demonstrate the efficacy of the methods described herein in determining susceptibility to polygenic diseases, a polygenic risk score (PRS) for type 2 diabetes was calculated for the second case. The PRS is derived from a combination of multiple genetic variations, especially single nucleotide polymorphisms (SNPs) that are directly associated with the disease. Of the 139 common SNPs associated with type 2 diabetes mentioned in Xue et al., 2018, 57 SNPs were identified to be present in the parental samples of the family. For each SNP, a Bayesian model was used to determine the genotype of each disease-associated SNP. The possible scores of the SNP are 0, 1, or 2, which represent homozygous non-effect alleles, heterozygous alleles, and homozygous effect alleles, respectively. The PRS is defined as the weighted sum of these scores, and the weight is equal to the absolute value of the logarithmic difference ratio of the minor alleles of each SNP. We examined three discarded embryos in the second case together with their corresponding culture media. The results indicate the comparison and correlation between the PRS scores of the discarded embryos and those derived from the culture media, as shown in Tables 3 and Figure 7 As explained in .

[0246] Table 3.

[0247] Embryo name 2-Embryo-03 2-Embryo-07 2-embryo-08 PRS in culture medium 3.532 3.767 3.288 PRS in discarded embryos 3.634 3.814 3.36

[0248] Example 10: Non-invasive preimplantation genetic testing for aneuploidy

[0249] In addition to niPGT-M and niPGT-P, the sequencing data of the present invention is also used for non-invasive preimplantation genetic testing (niPGT-A) of aneuploidy. After high-quality reads were compared with human reference genome hg19, copy number variation (CNV) detection of each sample was performed. The reads located were subjected to GC bias correction produced by the GC content of DNA. The read counts of each 1000kb bin are defined as copy number (CN). CNV analysis was performed using HMMcopy (v1.28.0) and DNAcopy (v1.58.0) with a resolution of 1Mb. Segmentation was performed via HMMcopy with an e value of 0.9999 and DNAcopy with an α value of 0.0001. The identification of CNV was performed by using the results of both HMMcopy and DNA to identify aneuploid fragments greater than 10Mb, while retaining double positive counts as true events. The chromosomal band positions of these aneuploid fragments were calculated using the chromosome band file of hg19 from the University of California (Santa Cruz) database (available on the World Wide Web at hgdownload.cse.ucsc.edu / downloads.html).

[0250] In the first case, the CNV map of the spent culture fluid was compared with the TE biopsy. When the corresponding TE biopsy result was abnormal, the CNV result of the spent culture fluid was abnormal. Figure 8 In (a), the niPGT-A result of 1-SCM-02 showed aneuploidy of monomer 10, which is consistent with the corresponding TE result. Figure 8 In (b), the niPGT-A result of 1-SCM-04 showed a chromosome loss on the q arm of chromosome 9, which was consistent with its TE biopsy result. Figure 8 In (c), the niPGT-A result of 1-SCM-14 was normal, and the corresponding TE-biopsy result was also normal. These results indicate that the method described herein can be used to analyze the copy number of spent culture fluid.

[0251] The features disclosed in the foregoing detailed description or the appended claims are expressed in their specific forms or in terms of devices for performing the disclosed functions, or methods or processes for obtaining the disclosed results, and may be used to implement the present invention in its various forms alone or in any combination of these features, as appropriate.

[0252] For the purpose of clarity and understanding, the foregoing invention has been described in some detail by way of illustration and example. It is apparent to those skilled in the art that changes and modifications may be practiced within the scope of the appended claims. Therefore, it should be understood that the above description is intended to be illustrative rather than restrictive. Therefore, the scope of the present invention should not be determined with reference to the above description, but should be determined with reference to the following appended claims together with the full scope of equivalents authorized by these claims.

[0253] The patents, published applications, and scientific literature mentioned herein establish the knowledge of those skilled in the art and are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated.

[0254] The specific details of the specific embodiments can be combined in any suitable way without departing from the spirit and scope of the embodiments of the invention. However, other embodiments of the invention may be directed to specific embodiments related to each individual aspect or specific combinations of these individual aspects.

[0255] The sequences used in the present invention are summarized in Table 4.

[0256]

[0257] Implementation

[0258] Aspects of the present disclosure relate to a method for amplifying DNA in a solution, wherein the DNA content in the solution can be as low as a picogram level, the method comprising the following steps: mixing a lysis buffer with a solution, heating the solution, then mixing a protease with the solution, incubating the solution, and then inactivating the protease at high temperature to obtain a lysate; mixing a transposome with the lysate, wherein the transposome includes a transposase and a transposon, wherein the transposon contains a transposase binding site and an RNA polymerase promoter sequence, wherein the transposome binds to the DNA in the solution, the transposase cuts the DNA in the solution to produce DNA fragments and the transposon becomes incorporated or inserted into the DNA fragments; filling the 9 bp gap caused by the insertion of the transposon and extending it downward to both ends of each fragment; performing in vitro transcription using the original sequence as a template to form RNA; mixing the RNA with a DNA primer and a reverse transcription system to form a first-strand cDNA via reverse transcription, wherein the DNA primer is complementary to the corresponding RNA strand of the sequence of the transposition binding site; and forming a second-strand DNA via cyclic amplification. According to one aspect, the solution is a culture fluid or a blastocyst cavity fluid. According to one aspect, the DNA primer has a length of 15 bp to 20 bp. According to one aspect, the 3' end of the DNA primer contains a 5'-GACAG-3 or 5'-CTGTC-3' sequence, preferably the DNA primer contains a sequence as shown in 5'-GATGTGTATAAGAGACAG-3' (Seq. ID No.: 1), or 5'-TCTACACATATTCTCTGTC-3' (Seq. ID No.: 2), or has at least 70%, preferably 80%, preferably 90%, preferably 95%, preferably 100% identity to Seq. ID No.: 1 or Seq. ID No.: 2. According to one aspect, the lysis buffer is a 2x to 10x lysis buffer. According to one aspect, the working concentration of the protease in the lysis mixture is higher than 0.6 mg / mL, preferably in the range of 0.8-2 mg / mL. According to one aspect, the incubation is performed at 45-60° C. for 1 to 3 hours. According to one aspect, the inactivation is performed at 80-90° C. According to one aspect, the working concentration of the transposome is higher than 6 nM, preferably in the range of 10-40 nM. According to one aspect, the cyclic amplification is performed for more than 4 cycles, such as 4 to 20 cycles, preferably 6 to 15 cycles.

[0259] The present disclosure provides a method for amplifying DNA in a culture medium, wherein the DNA content in the culture medium can be as low as a picogram level, and the method comprises the following steps: mixing a 2x to 10x lysis buffer with the culture medium, heating the culture medium, mixing a protease with the culture medium to a working concentration of 0.8-2 mg / mL, and incubating the culture medium at 45-60° C. for 1 to 3 hours, and then inactivating the protease at 80-90° C. to obtain a lysate; mixing a transposome with the lysate to a working concentration of 10-40 nM, wherein the transposome comprises a transposase and a transposon, wherein the transposon comprises a transposase binding site and an RNase binding site. A. a polymerase promoter sequence, wherein the transposome binds to the DNA in the solution, the transposase cuts the DNA in the solution to generate DNA fragments and the transposon is incorporated or inserted into the DNA fragments; the 9 bp gap caused by the transposon insertion is filled and extended downward to both ends of each fragment; in vitro transcription is performed using the original sequence as a template to form RNA; the RNA and a DNA primer paired with the nucleic acid sequence conjugated to the transposome are mixed with a reverse transcription system to form a first-strand cDNA through reverse transcription, wherein the DNA primer contains a sequence as shown in 5'-AGATGTGTATAAGAGACAG-3' (Seq. ID No.: 1) or 5'-TCTACACATATTCTCTGTC-3' (Seq. ID No.: 2), or has at least 70%, preferably 80%, preferably 90%, preferably 95%, preferably 100% identity with Seq. ID No.: 1 or Seq. ID No.: 2; and c. forming a second-strand DNA through 6 to 15 cycles of amplification.

[0260] The present disclosure provides a method for analyzing biological samples in the culture medium of in vitro cultured embryos to determine the susceptibility of the embryos to genetic diseases, the method comprising: 1) amplifying DNA molecules in the biological samples in the culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in a family; 2) preparing a DNA library and sequencing the DNA molecules in the biological samples to obtain a plurality of sequence reads; 3) performing positioning and SNP calling by a computer system to generate SNP data and controlling its quality; 4) performing single-nucleotide polymorphism on blood samples of both parents or a single parent carrying the disease by a computer system; ploidy pre-phasing; 5) combining the maternal cell contamination (MCC) rate and haplotype status, calculate the likelihood of four possible inheritance situations of each single SNP indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents; 6) estimate the MCC rate and determine the haplotype state of each SNP indicating whether there is only DNA from a single parent in the culture medium; 7) combining the likelihood and recombination probability of each single SNP, calculate the likelihood of observing SNP data in the region adjacent to the pathogenic mutation site; 8) determine whether the embryo carries the pathogenic chromosome and provide a confidence level. According to one aspect, the embryo has contamination caused by maternal cells and / or haplotype loss. According to one aspect, in step 3), positioning and SNP calling output the physical location, allele type, allele depth and sequencing quality of each SNP in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family. According to one aspect, in step 3), the quality of SNP data is controlled by filtering out SNPs with low genetic quality (GQ) values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, it includes filtering out SNPs with the lowest 20% GQ values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, in step 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and samples of culture medium with extremely low SNP density or high sequencing error rate are excluded. According to one aspect, the excluded SNP density is less than 0.001, or the excluded sequencing error rate is greater than 0.2. According to one aspect, in step 4), any one or more of the following samples in the family are used: blood samples of probands, biological samples of discarded embryos, or blood samples of at least one grandparent. According to one aspect, in step 5), when calculating the likelihood of each individual SNP, the estimated sequencing error rate is combined. According to one aspect, step 6) further comprises the following steps: a) preliminarily estimating the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and haplotype status of each SNP. According to one aspect, step b) comprises using a tag search method. According to one aspect, after step a), samples with abnormal MCC rates are excluded.According to one aspect, the abnormal MCC rate is greater than 0.65 or less than -0.5. According to one aspect, in step 7), a Bayesian model and a recursive algorithm are used. According to one aspect, in step 8), the log-likelihood curves of the upstream and downstream regions of the pathogenic mutation site are first drawn. According to one aspect, hereditary diseases include both monogenic diseases and polygenic diseases. According to one aspect, after step 8), multiple identified SNPs of the embryo are combined to determine its susceptibility to polygenic diseases.

[0261] The present disclosure provides a method for analyzing biological samples in the culture medium of in vitro cultured embryos to determine the susceptibility of the embryos to genetic diseases, the method comprising: 1) using the method according to any one of claims 1 to 12 to amplify DNA molecules in the biological samples of the culture medium of in vitro cultured embryos, and / or amplifying DNA molecules in biological samples of discarded embryos in a family; 2) preparing a DNA library and sequencing the DNA molecules in the biological samples to obtain a plurality of sequence reads; 3) performing positioning and SNP calling by a computer system to generate SNP data and control its quality; 4) performing a computer system to perform a single-nucleotide polymorphism (SNP) analysis on the parents or only the parents; and 5) performing a single-nucleotide polymorphism analysis on the parents or only the parents. 5) Combine the maternal cell contamination (MCC) rate and haplotype status to calculate the likelihood of four possible inheritance situations of each single SNP indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents; 6) Estimate the MCC rate and determine the haplotype state of each SNP indicating whether there is only DNA from a single parent in the culture medium; 7) Combine the likelihood and recombination probability of each single SNP to calculate the likelihood of observing SNP data in the region adjacent to the pathogenic mutation site; 8) Determine whether the embryo carries the pathogenic chromosome and provide a confidence level. According to one aspect, the embryo has contamination caused by maternal cells and / or haplotype loss. According to one aspect, in step 3), positioning and SNP calling output the physical location, allele type, allele depth and sequencing quality of each SNP in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family. According to one aspect, in step 3), the quality of SNP data is controlled by filtering out SNPs with low genetic quality (GQ) values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, it includes filtering out SNPs with the lowest 20% GQ values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, in step 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and samples of culture medium with extremely low SNP density or high sequencing error rate are excluded. According to one aspect, the excluded SNP density is less than 0.001, or the excluded sequencing error rate is greater than 0.2. According to one aspect, in step 4), any one or more of the following samples in the family are used: blood samples of probands, biological samples of discarded embryos, or blood samples of at least one grandparent. According to one aspect, in step 5), when calculating the likelihood of each individual SNP, the estimated sequencing error rate is combined. According to one aspect, step 6) further comprises the following steps: a) preliminarily estimating the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and haplotype status of each SNP. According to one aspect, step b) uses a tag search method.According to one aspect, after step a), samples with abnormal MCC rates are excluded. According to one aspect, the abnormal MCC rate is greater than 0.65 or less than -0.5. According to one aspect, a Bayesian model and a recursive algorithm are used in step 7). According to one aspect, in step 8), the log-likelihood curves of both the upstream and downstream regions of the pathogenic mutation site are first drawn. According to one aspect, genetic diseases include monogenic diseases and polygenic diseases. According to one aspect, step 8) includes combining multiple identified SNPs of the embryo to determine its susceptibility to polygenic diseases.

[0262] The present disclosure provides a computer program, which includes a plurality of instructions, which can be executed by a computer system and are arranged to control the computer system when executed to analyze a biological sample in the culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, including one or more of the following steps: 1) amplifying DNA molecules in the biological sample of the culture medium of the in vitro cultured embryo, and / or amplifying DNA molecules in the biological sample of a discarded embryo in a family; 2) preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) performing positioning and SNP calling by the computer system to generate SNP data and controlling the computer system to generate SNP data and to control the computer system to generate SNP data and to control the computer system to generate SNP data and to control the computer system to generate SNP data and to control the computer system to analyze a biological sample in the culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, including one or more of the following steps: 1) amplifying DNA molecules in the biological sample of the culture medium of the in vitro cultured embryo, and / or amplifying DNA molecules in the biological sample of a discarded embryo in a family; 2) preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) performing positioning and SNP calling by the computer system to generate SNP data and to control the computer system to generate SNP data and to control the computer system to generate SNP data and to control the computer system to generate SNP data and to control the computer system to analyze a biological sample in the culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, Its quality; 4) haplotype pre-phase of blood samples of parents or only single parents carrying the disease by computer system; 5) combining maternal cell contamination (MCC) rate and haplotype status, calculate the likelihood of four possible inheritance situations of each single SNP indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents; 6) estimate the MCC rate and determine the haplotype state of each SNP indicating whether there is only DNA from a single parent in the culture medium; 7) combine the likelihood of each single SNP and recombination probability, calculate the likelihood of observing SNP data in the region adjacent to the pathogenic mutation site; 8) determine whether the embryo carries the pathogenic chromosome and provide a confidence level. According to one aspect, the embryo has contamination caused by maternal cells and / or haplotype loss. According to one aspect, in step 3), positioning and SNP calling output the physical position, allele type, allele depth and sequencing quality of each SNP of the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family. According to one aspect, in step 3), the quality of SNP data is controlled by filtering out SNPs with low genetic quality (GQ) values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, it includes filtering out SNPs with the lowest 20% GQ values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, in step 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and samples of culture medium with extremely low SNP density or high sequencing error rate are excluded. According to one aspect, the excluded SNP density is less than 0.001, or the excluded sequencing error rate is greater than 0.2. According to one aspect, in step 4), any one or more of the following samples in the family are used: blood samples of probands, biological samples of discarded embryos, or blood samples of at least one grandparent. According to one aspect, in step 5), when calculating the likelihood of each individual SNP, the estimated sequencing error rate is combined. According to one aspect, step 6) further comprises the following steps: a) preliminarily estimating the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and haplotype status of each SNP.According to one aspect, step b) uses a tag search method. According to one aspect, after step a), samples with abnormal MCC rates are excluded. According to one aspect, the abnormal MCC rate is greater than 0.65 or less than -0.5. According to one aspect, a Bayesian model and a recursive algorithm are used in step 7). According to one aspect, in step 8), the log-likelihood curves of both the upstream and downstream regions of the pathogenic mutation site are first drawn. According to one aspect, genetic diseases include both monogenic diseases and polygenic diseases. According to one aspect, after step 8), multiple identified SNPs of the embryo are combined to determine its susceptibility to polygenic diseases.

[0263] The present disclosure provides a computer system for analyzing biological samples of culture fluid of in vitro cultured embryos to determine the susceptibility of embryos to genetic diseases, the computer system comprising: 1) a device for amplifying DNA molecules in biological samples of culture fluid of in vitro cultured embryos, and / or amplifying biological samples of discarded embryos in a family; 2) a device for preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) a device for performing positioning and SNP calling by a computer system to generate SNP data and control its quality; 4) a device for performing blood samples of both parents or a single parent carrying only the disease by a computer system to detect the presence of SNPs in the biological sample; and 5) a device for performing SNP calling by a computer system to detect the presence of SNPs in the biological sample. 5) a device for performing haplotype pre-phasing; 6) a device for calculating the likelihood of four possible inheritance situations of each single SNP indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents in combination with the maternal cell contamination (MCC) rate and haplotype status; 7) a device for calculating the likelihood of observing SNP data in the region adjacent to the pathogenic mutation site in combination with the likelihood of each single SNP and the recombination probability; 8) a device for determining whether the embryo carries the pathogenic chromosome and providing a confidence level. According to one aspect, the embryo has contamination caused by maternal cells and / or haplotype loss. According to one aspect, in device 3), positioning and SNP calling output the physical location, allele type, allele depth and sequencing quality of each SNP in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family. According to one aspect, in device 3), the quality of SNP data is controlled by filtering out SNPs with low genetic quality (GQ) values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, it includes filtering out SNPs with the lowest 20% GQ values ​​in biological samples of culture medium of in vitro cultured embryos and / or biological samples of discarded embryos in the family. According to one aspect, in device 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and samples of culture medium with extremely low SNP density or high sequencing error rate are excluded. According to one aspect, the excluded SNP density is less than 0.001, or the excluded sequencing error rate is greater than 0.2. According to one aspect, in device 4), any one or more of the following samples in the family are used: blood samples of probands, biological samples of discarded embryos, or blood samples of at least one grandparent. According to one aspect, in device 5), when calculating the likelihood of each individual SNP, the estimated sequencing error rate is combined. According to one aspect, the device 6) further comprises the following functions: a) preliminarily estimating the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and haplotype status of each SNP. According to one aspect, function b) uses a tag search method.According to one aspect, after function a), samples with abnormal MCC rates are excluded. According to one aspect, the abnormal MCC rate is greater than 0.65 or less than -0.5. According to one aspect, a Bayesian model and a recursive algorithm are used in device 7). According to one aspect, in device 8), the log-likelihood curves of both the upstream and downstream regions of the pathogenic mutation site are first drawn. According to one aspect, genetic diseases include both monogenic diseases and polygenic diseases. According to one aspect, the computer system also includes a device for combining a plurality of identified SNPs of an embryo to determine its susceptibility to polygenic diseases.

[0264] The present disclosure provides a method for preparing a biological sample of the culture medium of an in vitro cultured embryo that is originally not sequenceable into a transformed state, and the transformed state can be analyzed to determine the susceptibility of the embryo to a genetic disease, the method comprising: 1) amplifying DNA molecules in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family; 2) preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) performing positioning and SNP calling by a computer system to generate SNP data and controlling its quality; 4) performing haplotype pre-phasing on the blood samples of the parents or the single parent carrying the disease by a computer system; 5) combining maternal cell contamination (MCC) The computer system calculates the likelihood of four possible inheritance scenarios of each single SNP, indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents; 6) The SNP data are converted by estimating the MCC rate through a computer system and determining the haplotype state of each SNP indicating whether only DNA from a single parent is present in the culture medium; 7) Combining the likelihood rate and recombination probability of each single SNP, the computer system calculates the likelihood of observing the SNP data in the region adjacent to the pathogenic mutation site; and 8) Determining whether the embryo carries the pathogenic chromosome by the computer system and providing a confidence level, wherein the biological sample has a high ADO rate in the presence of maternal contamination.

[0265] References

[0266] The following fully cited references correspond respectively to the abbreviated form references used above and are incorporated by reference as if fully set forth herein.

[0267] 1.Handyside AH,Penketh RJ,Winston RM,Pattinson JK,Delhanty JD,Tuddenham EG.Biopsy of human preimplantation embryos and sexing by DNAamplification.The Lancet.1989Feb 18;333(8634):347-9.

[0268] 2.Handyside AH,Kontogianni EH,Hardy KR,Winston RM.Pregnancies frombiopsied human preimplantation embryos sexed by Y-specific DNAamplification.Nature.1990Apr 19;344(6268):768-70.

[0269] 3.Kerem BS,Rommens JM,Buchanan JA,Markiewicz D,Cox TK,Chakravarti A,Buchwald M,Tsui LC.Identification of the cystic fibrosis gene: geneticanalysis.Science.1989Sep 8;245(4922):1073-80.

[0270] 4.Handyside AH,Lesko JG,Tarín JJ,Winston RM,Hughes MR.Birth of anormal girl after in vitro fertilization and preimplantation diagnostictesting for cystic fibrosis.New England Journal of Medicine.1992 Sep 24;327(13):905-9.

[0271] 5.Liu J,Lissens W,Silber SJ,Devroey P,Liebaers I,Van SteirteghemA.Birth after preimplantation diagnosis of the cystic fibrosis△F508 mutationby polymerase chain reaction in human embryos resulting from intracytoplasmicsperm injection with epididymal sperm.Jama.1994 Dec 21;272(23):1858-60.

[0272] 6.Harton GL,Tsipouras P,Sisson ME,Starr KM,Mahoney BS,Fugger EF,Schulman JD,Kilpatrick MW,Levinson G,Black SH.Preimplantation genetic testingfor Marfan syndrome.MHR:Basic science of reproductive medicine.1996 Sep 1;2(9):713-5.

[0273] 7.Ao A,Wells D,Handyside AH,Winston RM,Delhanty JD.Preimplantationgenetic diagnosis of inherited cancer:familial adenomatous polyposiscoli.Journal of assisted reproduction and genetics.1998 Mar;15:140-4.

[0274] 8.Sermon K,Goossens V,Seneca S,Lissens W,De Vos A,Vandervorst M,VanSteirteghem A,Liebaers I.Preimplantation diagnosis for Huntington's disease(HD):clinical application and analysis of the HD expansion in affectedembryos.Prenatal Diagnosis:Published in Affiliation With the InternationalSociety for Prenatal Diagnosis.1998 Dec;18(13):1427-36.

[0275] 9.Xu K,Shi ZM,Veeck LL,Hughes MR,Rosenwaks Z.First unaffectedpregnancy using preimplantation genetic diagnosis for sickle cellanemia.Jama.1999 May 12;281(18):1701-6.

[0276] 10.Hussey ND,Donggui H,Froiland DA,Hussey DJ,Haan EA,Matthews CD,Craig JE.Analysis of five Duchenne muscular dystrophy exons and genderdetermination using conventional duplex polymerase chain reaction on singlecells.Molecular human reproduction.1999 Nov 1;5(11):1089-94.

[0277] 11.Ray PF,Gigarel N,Paul Bonnefont J,AttiéT,Hamamah S,Frydman N,Vekemans M,Frydman R,Munnich A.First specific preimplantation geneticdiagnosis for ornithine transcarbamylase deficiency.Prenatal diagnosis.2000Dec;20(13):1048-54.

[0278] 12.De Rycke M,Van de Velde H,Sermon K,Lissens W,De Vos A,VandervorstM,Vanderfaeillie A,Van Steirteghem A,Liebaers I.Preimplantation geneticdiagnosis for sickle-cell anemia and forβ-thalassemia.Prenatal Diagnosis:Published in Affiliation With the International Society for PrenatalDiagnosis.2001 Mar;21(3):214-22.

[0279] 13.Moutou C,Gardes N,Rongieres C,Ohl J,Bettahar-Lebugle K,Wittemer C,Gerlinger P,Viville S.Allele-specific amplification for preimplantationgenetic diagnosis(PGD)of spinal muscular atrophy.Prenatal diagnosis.2001 Jun;21(6):498-503.

[0280] 14.Verlinsky Y,Rechitsky S,Schoolcraft W,Strom C,KulievA.Preimplantation diagnosis of Fanconi anemia combined with HLAmatching.Jama.2001 Jun 27:285(24):3130-3.

[0281] 15.Sermon K, Seneca S, De Rycke M, Goossens V, Van de Velde H, De Vos A, Platteau P, Lissens W, Van Steirteghem A, Liebaers I Endocrinology.2001 Oct 22:183:S77-85.

[0282] 16.Girardet A,Hamamah S,Anahory T,Dechaud H,Sarda P,Hedon B,DemailleJ,Claustres M.First preimplantation genetic diagnosis of hereditaryretinoblastoma using informative microsatellite markers.MHR:Basic science ofreproductive medicine.2003 Feb 19(2):111-6.

[0283] 17.Fiorentino F,Biricik A,Nuccitelli A,De Palma R,Kahraman S,Iacobelli M,Trengia V,Caserta D,Bonu MA,Borini A,Baldi M.Strategies andclinical outcome of 250 cycles of preimplantation genetic diagnosis forsingle gene disorders.Human Reproduction.2006 Mar 1;21(3):670-84.

[0284] 18.Kahraman S,Beyazyurek C,Yesilipek MA,Ozturk G,Ertem M,Anak S,Kansoy S,Aksoylar S, B,Oniz H,Slavin S.Successful haematopoieticstem cell transplantation in 44 children from healthy siblings conceivedafter preimplantation HLA matching.Reproductive biomedicine online.2014 Sep1;29(3):340-51.

[0285] 19.MunnéS,Lee A,Rosenwaks Z,Grifo J,Cohen J.Fertilization and earlyembryology:Diagnosis of major chromosome aneuploidies in humanpreimplantation embryos.Human reproduction.1993 Dec 1;8(12):2185-91.

[0286] 20.Wilton L,Williamson R,McBain J,Edgar D,Voullaire L.Birth of ahealthy infant after preimplantation confirmation of euploidy by comparativegenomic hybridization.New England Journal of Medicine.2001 Nov 22;345(21):1537-41.

[0287] 21.Wells D,Escudero T,Levy B,Hirschhorn K,Delhanty JD,Munne S.Firstclinical application of comparative genomic hybridization and polar bodytesting for preimplantation genetic diagnosis of aneuploidy.Fertility andsterility.2002 Sep 1;78(3):543-9.

[0288] 22.Treff NR,Su J,Tao X,Levy B,Scott Jr RT.Accurate single cell 24chromosome aneuploidy screening using whole genome amplification and singlenucleotide polymorphism microarrays.Fertility and sterility.2010 Nov 1;94(6):2017-21.

[0289] 23.Gutiérrez-Mateo C,Colls P,Sánchez-García J,Escudero T,Prates R,Ketterson K,Wells D,MunnéS.Validation of microarray comparative genomichybridization for comprehensive chromosome analysis of embryos.Fertility andsterility.2011 Mar 1;95(3):953-8.

[0290] 24.Yang Z,Liu J,Collins GS,Salem SA,Liu X,Lyle SS,Peck AC,Sills ES,Salem RD.Selection of single blastocysts for fresh transfer via standardmorphology assessment alone and with array CGH for good prognosis IVFpatients:results from a randomized pilot study.Molecular cytogenetics.2012Dec;5:1-8.

[0291] 25.Scott Jr RT,Upham KM,Forman EJ,Hong KH,Scott KL,Taylor D,Tao X,Treff NR.Blastocyst biopsy with comprehensive chromosome screening and freshembryo transfer significantly increases in vitro fertilization implantationand delivery rates:a randomized controlled trial.Fertility and sterility.2013Sep 1;100(3):697-703.

[0292] 26.Forman EJ,Hong KH,Ferry KM,Tao X,Taylor D,Levy B,Treff NR,Scott JrRT.In vitro fertilization with single euploid blastocyst transfer:arandomized controlled trial.Fertility and sterility.2013 Jul 1;100(1):100-7.

[0293] 27.Wells D,Kaur K,Grifo J,Glassner M,Taylor JC,Fragouli E,MunneS.Clinical utilisation of a rapid low-pass whole genome sequencing techniquefor the diagnosis of aneuploidy in human embryos prior toimplantation.Journal of medical genetics.2014 Aug 1;51(8):553-62.

[0294] 28.Rubio C,Bellver J,Rodrigo L,Castillón G,Guillén A,Vidal C,Giles J,Ferrando M,Cabanillas S,RemohíJ,Pellicer A.In vitro fertilization withpreimplantation genetic diagnosis for aneuploidies in advanced maternal age:arandomized,controlled study.Fertility and sterility.2017 May 1;107(5):1122-9.

[0295] 29.Conn CM,Harper JC,Winston RM,Delhanty JD.Infertile couples withRobertsonian translocations:preimplantation genetic analysis of embryosreveals chaotic cleavage divisions.Human Genetics.1998 Jan;102:117-23.

[0296] 30.Scriven PN,Handyside AH,Ogilvie CM.Chromosome translocations:segregation modes and strategies for preimplantation geneticdiagnosis.Prenatal Diagnosis:Published in Affiliation With the InternationalSociety for Prenatal Diagnosis.1998 Dec;18(13):1437-49.

[0297] 31.Coonen E,Martini E,Dumoulin JC,Hollanders-Crombach HT,de Die-Smulders C,Geraedts JP,Hopman AH,Evers JL.Preimplantation genetic diagnosisof a reciprocal translocation t(3;11)(q27.3;q24.3)in siblings.Molecular humanreproduction.2000 Mar 1;6(3):199-206.

[0298] 32.MunnéS,Sandalinas M,Escudero T,Fung J,Gianaroli L,Cohen J.Outcomeof preimplantation genetic diagnosis of translocations.Fertility andSterility.2000 Jun 1;73(6):1209-18.

[0299] 33.Escudero T,Abdelhadi I,Sandalinas M,Munne S.Predictive value ofsperm fluorescence in situ hybridization analysis on the outcome ofpreimplantation genetic diagnosis for translocations.Fertility andsterility.2003 Jun 1;79:1528-34.

[0300] 34.Melotte C,Debrock S,D'Hooghe T,Fryns JP,VermeeschJR.Preimplantation genetic diagnosis for an insertional translocationcarrier.Human Reproduction.2004 Dec 1;19(12):2777-83.

[0301] 35.Le Caignec C,Spits C,Sermon K,De Rycke M,Thienpont B,Debrock S,Staessen C,Moreau Y,Fryns JP,Van Steirteghem A,Liebaers I.Single-cellchromosomal imbalances detection by array CGH.Nucleic acids research.2006 Jan1;34(9):e68-.

[0302] 36.Traversa MV,Carey L,Leigh D.A molecular strategy for routinepreimplantation genetic diagnosis in both reciprocal and Robertsoniantranslocation carriers.MHR:Basic science of reproductive medicine.2010 Feb19;16(5):329-37.

[0303] 37.Fiorentino F,Kokkali G,Biricik A,Stavrou D,Ismailoglu B,De PalmaR,Arizzi L,Harton G,Sessa M,Pantos K.Polymerase chain reaction-baseddetection of chromosomal imbalances on embryos:the evolution ofpreimplantation genetic diagnosis for chromosomal translocations.Fertilityand sterility.2010 Nov 1;94(6):2001-11.

[0304] 38.Rius M,Obradors A,Daina G,Ramos L,Pujol A,Martínez-Passarell O,Marquès L,Oliver-Bonet M,Benet J,Navarro J.Detection of unbalanced chromosomesegregations in preimplantation genetic diagnosis of translocations by shortcomparative genomic hibridization.Fertility and sterility.2011 Jul 1;96(1):134-42.

[0305] 39.Fiorentino F,Spizzichino L,Bono S,Biricik A,Kokkali G,Rienzi L,Ubaldi FM,Iammarrone E,Gordon A,Pantos K.PGD for reciprocal and Robertsoniantranslocations using array comparative genomic hybridization.HumanReproduction.2011 Jul 1;26(7):1925-35.

[0306] 40.Treff NR,Thompson K,Rafizadeh M,Chow M,Morrison L,Tao X,Garnsey H,Reda CV,Metzgar TL,Neal S,Jalas C.SNP array-based analyses of unbalancedembryos as a reference to distinguish between balanced translocation carrierand normal blastocysts.Journal of Assisted Reproduction and Genetics.2016Aug;33:1115-9.

[0307] 41.Zhang S,Lei C,Wu J,Zhou J,Sun H,Fu J,Sun Y,Sun X,Lu D,Zhang Y.Theestablishment and application of preimplantation genetic haplotyping inembryo diagnosis for reciprocal and Robertsonian translocation carriers.BMCmedical genomics.2017 Dec;10(1):1-9.

[0308] 42.Tan YQ,Tan K,Zhang SP,Gong F,Cheng DH,Xiong B,Lu CF,Tang XC,LuoKL,Lin G,Lu GX.Single-nucleotide polymorphism microarray-basedpreimplantation genetic diagnosis is likely to improve the clinical outcomefor translocation carriers.Human Reproduction.2013 Sep 1;28(9):2581-92.

[0309] 43.Chow JF,Yeung WS,Lee VC,Lau EY,Ng EH.Evaluation of preimplantationgenetic testing for chromosomal structural rearrangement by a commonly usednext generation sequencing workflow.European Journal of Obstetrics&Gynecologyand Reproductive Biology.2018 May 1;224:66-73.

[0310] 44.Treff NR,Eccles J,Lello L,Bechor E,Hsu J,Plunkett K,Zimmerman R,Rana B,Samoilenko A,Hsu S,Tellier LC.Utility and first clinical applicationof screening embryos for polygenic disease risk reduction.Frontiers inendocrinology.2019 Dec 4;10:845.

[0311] 45.Kumar A,Im K,Banjevic M,Ng PC,Tunstall T,Garcia G,Galhardo L,SunJ,Schaedel ON,Levy B,Hongo D.Whole-genome risk prediction of common diseasesin human preimplantation embryos.Nature medicine.2022 Mar;28(3):513-6.

[0312] 46.Yan L,Huang L,Xu L,Huang J,Ma F,Zhu X,et al.Live births aftersimultaneous avoidance of monogenic diseases and chromosome abnormality bynext-generation sequencing with linkage analyses.Proc Natl Acad Sci U S A2015;112:15964-9

[0313] 47.Dokras A,Sargent IL,Ross C,Gardner RL,Barlow DH.Trophectodermbiopsy in human blastocysts.Hum Reprod 1990;5:821–825.

[0314] 48.Kokkali G,Vrettou C,Traeger-Synodinos J,Jones GM,Cram DS,StavrouD,Trounson AO,Kanavakis E,Pantos K.Birth of a healthy infant followingtrophectoderm biopsy from blastocysts for PGD ofβ-thalassaemia major:casereport.Hum Reprod 2005;20:1855–1859.

[0315] 49.Palini S,Galluzzi L,De Stefani S,Bianchi M,Wells D,Magnani M,Bulletti C.Genomic DNA in human blastocoele fluid.Reprod Biomed Online 2013;26:603–610.

[0316] 50.Gianaroli L,Magli MC,Pomante A,Crivello AM,Cafueri G,Valerio M,Ferraretti AP.Blastocentesis:a source of DNA for preimplantation genetictesting.Results from a pilot study.Fertil Steril 2014;102:1692–1699.

[0317] 51.Tobler KJ,Zhao Y,Ross R,Benner AT,Xu X,Du L,Broman K,Thrift K,Brezina PR,Kearns WG.Blastocoel fluid from differentiated blastocysts harborsembryonic genomic material capable of a whole-genome deoxyribonucleic acidamplification and comprehensive chromosome microarray analysis.Fertil Steril2015;104:418–425.

[0318] 52.Magli MC,Pomante A,Cafueri G,Valerio M,Crippa A,Ferraretti AP,Gianaroli L.Preimplantation genetic testing:Polar bodies,blastomeres,trophectoderm cells,or blastocoelic fluid?Fertil Steril 2016;105:676–683e5.

[0319] 53.Zhang Y,Li N,Wang L,Sun H,Ma M,Wang H,Xu X,Zhang W,Liu Y,Cram DSet al.Molecular analysis of DNA in blastocoele fluid using next-generationsequencing.J Assist Reprod Genet 2016;33:637–645.

[0320] 54.Shangguan T,He W,Li H,Shang X,Liu Y,Bai X,Li M,Xie J.Detection andanalysis of DNAmaterial in human blastocoel fluid.Biomed Genet Genomics 2017;2:1–5.

[0321] 55.Capalbo A,Romanelli V,Patassini C,Poli M,Girardi L,Giancani A,Stoppa M,Cimadomo D,Ubaldi FM,Rienzi L.Diagnostic efficacy of blastocoelfluid and spent media as sources of DNA for preimplantation genetic testingin standard clinical conditions.Fertil Steril 2018;110:870–879.

[0322] 56. O,Zhigalina DI,Jatsenko T,Skryabin NA,Kanbekova OR,Artyukhova VG,Svetlakov AV,Teearu K, A,Salumets A,Kurg A.Karyotype ofthe blastocoel fluid demonstrates low concordance with both trophectoderm andinner cell mass.Fertility and sterility.2018 Jun 1;109(6):1127-34.

[0323] 57.Magli MC,Albanese C,Crippa A,Tabanelli C,Ferraretti AP,GianaroliL.Deoxyribonucleic acid detection in blastocoelic fluid:a new predictor ofembryo ploidy and viable pregnancy.Fertil Steril 2018;111:77–85.

[0324] 58.Galluzzi L,Palini S,De Stefani S,Andreoni F,Primiterra M,Diotallevi A,Bulletti C,Magnani M.Extracellular embryo genomic DNA and itspotential for genotyping applications.Futur Sci OA 2015;1:FSO62.

[0325] 59.Wu H,Ding C,Shen X,Wang J,Li R,Cai B,Xu Y,Zhong Y,Zhou C.Medium-based noninvasive preimplantation genetic diagnosis for humanα-thalassemias-SEA.Medicine(Baltimore)2015;94:e669.

[0326] 60.Xu J,Fang R,Chen L,Chen D,Xiao J-P,Yang W,Wang H,Song X,Ma T,Bo Set al.Noninvasive chromosome screening of human embryos by genome sequencingof embryo culture medium for in vitro fertilization.Proc Natl Acad Sci 2016;113:11907–11912.

[0327] 61.Shamonki MI,Jin H,Haimowitz Z,Liu L.Proof of concept:preimplantation genetic screening without embryo biopsy through analysis ofcell-free DNA in spent embryo culture media.Fertil Steril 2016;106:1312–1318.

[0328] 62.Feichtinger M,Vaccari E,Carli L,Wallner E, U,Figl K,Palini S,Feichtinger W.Non-invasive preimplantation genetic screening using arraycomparative genomic hybridization on spent culture media:a proof-of-conceptpilot study.Reprod Biomed Online 2017;34:583–589.

[0329] 63.Lane M,Zander-Fox DL,Hamilton H,Jasper MJ,Hodgson BL,Fraser M,BellF.Ability to detect aneuploidy from cell free DNA collected from media isdependent on the stage of development of the embryo.Fertil Steril 2017;108:e61.

[0330] 64.Liu WQ,Liu JQ,Du HZ,Ling JW,Sun XF,Chen DJ.Non-invasivepreimplantation aneuploidy screening and diagnosis of beta thalassemiaIVSII654 mutation using spent embryo culture medium.Ann Med 2017;49:319–328.

[0331] 65.Ho JR,Arrach N,Rhodes-Long K,Ahmady A,Ingles S,Chung K,BendiksonKA,Paulson RJ,McGinnis LK.Pushing the limits of detection:investigation ofcell-free DNA for aneuploidy screening in embryos.Fertil Steril 2018;110:467–475.e2.

[0332] 66.Vera-Rodriguez M,Diez-Juan A,Jimenez-Almazan J,Martinez S,NavarroR,Peinado V,Mercader A,Meseguer M,Blesa D,Moreno I et al.Origin andcomposition of cell-free DNA in spent medium from human embryo culture duringpreimplantation development.Obstet Gynecol Surv 2018;33:745–756.

[0333] 67.Capalbo A,Romanelli V,Patassini C,Poli M,Girardi L,Giancani A,Stoppa M,Cimadomo D,Ubaldi FM,Rienzi L.Diagnostic efficacy of blastocoelfluid and spent media as sources of DNA for preimplantation genetic testingin standard clinical conditions.Fertil Steril 2018;110:870–879.

[0334] 68.Fang R,Yang W,Zhao X,Xiong F,Guo C,Xiao J,Chen L,Song X,Wang H,Chen J et al.Chromosome screening using culture medium of embryos fertilisedin vitro:A pilot clinical study.J Transl Med 2019;17:1–8.

[0335] 69.Huang L,Bogale B,Tang Y,Lu S,Xie XS,Racowsky C.Noninvasivepreimplantation genetic testing for aneuploidy in spent medium may be morereliable than trophectoderm biopsy.Proc Natl Acad Sci 2019;116:201907472

[0336] 70.Rubio C,Rienzi L,Navarro-Sánchez L,Cimadomo D,García-Pascual CM,Albricci L,Soscia D,Valbuena D,Capalbo A,Ubaldi F et al.Embryonic cell-freeDNA versus trophectoderm biopsy for aneuploidy testing:concordance rate andclinical implications.Fertil Steril 2019;112:510–519.

[0337] 71.Yeung QSY,Zhang YX,Chung JPW,Lui WT,Kwok YKY,Gui B,Kong GWS,Cao Y,Li TC,Choy KW.A prospective study of non-invasive preimplantation genetictesting for aneuploidies(NiPGT-A)using next-generation sequencing(NGS)onspent culture media(SCM).J Assist Reprod Genet 2019;36:1609–1621.

[0338] 72.Jiao J,Shi B,Sagnelli M,Yang D,Yao Y,LiW,Shao L,Lu S,Li D,WangX.Minimally invasive preimplantation genetic testing using blastocyst culturemedium.Hum Reprod 2019;34:1369–1379.

[0339] 73.Ou Z,Deng Y,Liang Y,Chen Z,Sun L.Improved non-invasivepreimplantation genetic testing for beta-thalassemia using spent embryoculture medium containing blastocoelic fluid.Frontiers in endocrinology.2022Jan 20;12:1941.

[0340] 74.Galluzzi L,Palini S,De Stefani S,Andreoni F,Primiterra M,Diotallevi A,Bulletti C,Magnani M.Extracellular embryo genomic DNA and itspotential for genotyping applications.Futur Sci OA2015;1:FSO62.

[0341] 75.Chan KA,Zhang J,Hui AB,Wong N,Lau TK,Leung TN,Lo KW,Huang DW,LoYD.Size distributions of maternal and fetal DNA in maternal plasma.Clinicalchemistry.2004 Jan 1;50(1):88-92.

[0342] 76.Huang L,Ma F,Chapman A,Lu S,Xie XS.Single-cell whole-genomeamplification and sequencing:methodology and applications.Annual review ofgenomics and human genetics.2015 Aug 24;16:79-102.

[0343] 77.Chen C,Xing D,Tan L,Li H,Zhou G,Huang L,Xie XS.Single-cell whole-genome analyses by Linear Amplification via Transposon Insertion (LIANTI).Science.2017 Apr 14;356(6334):189-94.

[0344] 78.CHEN,Chongyi;XING,Dong;XIE,Xiaoliang Sunney.Methods of amplifyingnucleic acid sequences mediated by transposase / transposon DNAcomplexes.U.S.Patent No 10,894,980,2021.

[0345] 79.Leaver M,Wells D.Non-invasive preimplantation genetic testing(niPGT):the next revolution in reproductive genetics?.Human reproductionupdate.2020 Jan 1;26(1):16-42.

[0346] 80.Cimadomo D,Rienzi L,Capalbo A,Rubio C,Innocenti F,García-PascualCM,Ubaldi FM,Handyside A.The dawn of the future:30 years from the firstbiopsy of a human embryo.The detailed history of an ongoing revolution.HumanReproduction Update.2020 Jul;26(4):453-73.

[0347] 81.De Rycke M.,Goossens V.,Kokkali G.,Meijer-Hoogeveen M.,Coonen E.,Moutou C.ESHRE PGD Consortium data collection XIV-XV:Cycles from January 2011to December 2012 with pregnancy follow-up to October 2013.Hum.Reprod.2017;32:1974–1994.doi:10.1093 / humrep / dex265.

[0348] 82.ESHRE PGT-M Working Group,Carvalho F,Moutou C,Dimitriadou E,Dreesen J,Giménez C,Goossens V,Kakourou G,Vermeulen N,Zuccarello D,De RyckeM.ESHRE PGT Consortium good practice recommendations for the detection ofmonogenic disorders.Human reproduction open.2020(3):1-18.Doi:10.1093 / hropen / hoaa018.

[0349] 83.Xue,A.et al.Genome-wide association analyses identify 143 riskvariants and putative regulatory mechanisms for type 2 diabetes.Nat.Commun.9,2941(2018).

[0350] 84.Fan,H.C.,Gu,W.,Wang,J.,Blumenfeld,Y.J.,El-Sayed,Y.Y.,&Quake,S.R.(2012).Non-invasive prenatal measurement of the fetal genome.Nature,487(7407),320-324.

[0351] 85.Nabieva,E,Sharma,S M,Kapushev Y,et al.Accurate fetal variantcalling in the presence of maternal cell contamination.European Journal ofHuman Genetics,2020,28(11):1615-1623.

[0352] 86.Lander,E.S.and Green,P.Construction of multilocus genetic linkagemaps in humans,Proceedings of the National Academy of Sciences,1987;84(8),2363–2367

[0353] 87.Kruglyak L,Daly M J,Reeve-Daly M P,et al.Parametric andnonparametric linkage analysis:a unified multipoint approach.American journalof human genetics,1996,58(6):1347.

[0354] 88.Idury R M,Elston R C.Afaster and more general hidden Markov modelalgorithm for multi-point likelihood calculations.Human heredity,1997,47(4):197-202.

[0355] 89.Kruglyak L,Lander E S.Faster multipoint linkage analysis usingFourier transforms.J.Comput.Biol.1998;5(1):1–7.

[0356] 90.Abecasis G R,Cherny S S,Cookson W O,et al.Merlin—rapid analysisof dense genetic maps using sparse gene flow trees.Nature genetics,2002,30(1):97-101.

Claims

1. A method for amplifying DNA in a solution, wherein the DNA content in the solution can be as low as picogram level, the method comprising the following steps: mixing a lysis buffer with the solution, heating the solution, then mixing a protease with the solution, incubating the solution, and then inactivating the protease at high temperature to obtain a lysate; mixing a transposome with the lysate, wherein the transposome comprises a transposase and a transposon, wherein the transposon comprises a transposase binding site and an RNA polymerase promoter sequence, wherein the transposome binds to the DNA in the solution, the transposase cuts the DNA in the solution to generate DNA fragments, and the transposon is incorporated into or inserted into the DNA fragments; Fill the 9 bp gap caused by the transposon insertion and extend it down to both ends of each fragment; performing in vitro transcription using the original sequence as a template to form RNA; Mixing the RNA with a DNA primer and a reverse transcription system to form a first-strand cDNA through reverse transcription, wherein the DNA primer is complementary to the RNA strand corresponding to the sequence of the transposition binding site; and The second strand of DNA is formed through cyclic amplification.

2. The method according to claim 1, wherein the solution is culture fluid or blastocoel fluid. The method according to claim 1 , wherein the DNA primer has a length of 15 bp to 20 bp. The method according to claim 2 , wherein the 3′ end of the DNA primer contains a 5′-GACAG-3 or 5′-CTGTC-3′ sequence.

5. The method of claim 2, wherein the DNA primer comprises a sequence as shown in 5'-AGAT GTGTATAAGAGACAG-3' (Seq. ID No.: 1) or 5'-TCTACACATATTCTCT GTC-3' (Seq. ID No.: 2), or has an identity with Seq. ID No.: 1 or Seq. ID No.: 2 selected from any one of the following: at least 70%, at least 80%, at least 90%, at least 95% or at least 100%. The method of claim 1 , wherein the lysis buffer is a 2× to 10× lysis buffer.

7. The method of claim 1, wherein the working concentration of the protease is higher than 0.6 mg / mL.

8. The method of claim 1, wherein the working concentration of the protease is in the range of 0.8-2 mg / mL.

9. The method of claim 1, wherein the incubation is performed at 45-60°C for 1 to 3 hours.

10. The method of claim 1, wherein the inactivation is performed at 80-90°C.

11. The method of claim 1, wherein the working concentration of the transposome is higher than 6 nM.

12. The method of claim 1, wherein the working concentration of the transposome is in the range of 10-40 nM.

13. The method of claim 1, wherein the cyclic amplification is performed for more than 4 cycles.

14. The method according to claim 1, wherein the number of cycles performed in the cyclic amplification is selected from any one of the following: 4 to 20 cycles, or 6 to 15 cycles.

15. A method for amplifying DNA in a culture medium, wherein the DNA content in the culture medium can be as low as a picogram level, the method comprising the following steps: Mixing 2x to 10x lysis buffer with the culture solution, heating the culture solution, mixing protease with the culture solution to a working concentration of 0.8-2 mg / mL, and incubating the culture solution at 45-60° C. for 1 to 3 hours, and then inactivating the protease at 80-90° C. to obtain a lysate; mixing a transposome with the lysate to a working concentration of 10-40 nM, wherein the transposome comprises a transposase and a transposon, wherein the transposon comprises a transposase binding site and an RNA polymerase promoter sequence, wherein the transposome binds to the DNA in the culture fluid, the transposase cuts the DNA in the culture fluid to generate DNA fragments, and the transposon is incorporated into or inserted into the DNA fragments; Fill the 9 bp gap caused by the transposon insertion and extend it down to both ends of each fragment; performing in vitro transcription using the original sequence as a template to form RNA; Mixing the RNA and a DNA primer paired with the nucleic acid sequence conjugated to the transposome with a reverse transcription system to form a first-strand cDNA by reverse transcription, wherein the DNA primer comprises a sequence as shown in 5'-AGATGTGTATAAGAGACAG-3' (Seq. ID No.: 1) or 5'-TCTACACATATT CTCTGTC-3' (Seq. ID No.: 2), or has any one of the following identities selected from Seq. ID No.: 1 or Seq. ID No.: 2: at least 70%, at least 80%, at least 90%, at least 95% or at least 100% identity; and Second-strand DNA is formed through 6 to 15 amplification cycles.

16. A method for analyzing a biological sample in a culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, comprising: 1) amplifying DNA molecules in the biological sample in the culture medium of the in vitro cultured embryos and / or amplifying DNA molecules in the biological sample of discarded embryos in a family using the method according to any one of claims 1 to 15; 2) preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) Perform mapping and SNP calling through a computer system to generate SNP data and control its quality; 4) haplotype prephasing of blood samples from both parents or only the parent carrying the disease by a computer system; 5) Combined with the maternal cell contamination (MCC) rate and haplotype status, the likelihood of four possible inheritance scenarios for each single SNP indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents is calculated; 6) Estimate the MCC rate and determine the haplotype status of each SNP indicating whether DNA from only a single parent is present in the culture medium; 7) Combining the likelihood and recombination probability of each single SNP, calculate the likelihood of observing SNP data in the region adjacent to the pathogenic mutation site; 8) Determine whether the embryo carries the pathogenic chromosome and provide a confidence level.

17. The method of claim 16, wherein the embryo has contamination by maternal cells and / or haplotype loss.

18. The method according to claim 16, wherein in step 3), positioning and SNP calling output the physical position, allele type, allele depth and sequencing quality of each SNP in the biological sample in the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family.

19. The method according to claim 16, wherein in step 3), the quality of the SNP data is controlled by filtering out the SNPs with the lowest 20% genetic quality (GQ) values ​​or all SNPs with GQ values ​​less than 10 in the biological samples in the culture medium of the in vitro cultured embryos and / or the biological samples of the discarded embryos in the family.

20. The method according to claim 16, wherein in step 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and biological samples of the culture fluid with a SNP density less than 0.001 or a sequencing error rate greater than 0.2 are excluded.

21. The method according to claim 16, wherein in step 4), any one or more of the following samples in the family are used: a blood sample of a proband, a biological sample of a discarded embryo, or a blood sample of at least one grandparent.

22. The method according to claim 16, wherein in step 5), when calculating the likelihood of each individual SNP, the estimated sequencing error rate is incorporated.

23. The method according to claim 16, wherein step 6) further comprises the following steps: a) Preliminary estimation of the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and the haplotype status of each SNP.

24. The method of claim 23, wherein step b) uses a tag search method.

25. The method of claim 23, wherein after step a), samples with abnormal MCC rates are excluded.

26. The method of claim 25, wherein the abnormal MCC rate is greater than 0.65 or less than -0.

5.

27. The method according to claim 16, wherein a Bayesian model and a recursive algorithm are used in step 7).

28. The method according to claim 16, wherein in step 8), the log-likelihood curves of both the upstream and downstream regions of the pathogenic mutation site are first drawn.

29. The method of claim 16, wherein the genetic disease comprises a single gene disease and a multi-gene disease.

30. The method according to any one of claims 16 to 29, wherein after step 8), the plurality of identified SNPs of the embryo are combined to determine its susceptibility to a polygenic disease.

31. A computer program product, comprising a computer readable medium storing a plurality of instructions, the instructions being executable by a computer system and arranged to control the computer system when executed to analyze a biological sample in a culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, comprising the following items: 1) amplifying DNA molecules in the biological sample in the culture medium of the in vitro cultured embryos and / or amplifying DNA molecules in the biological sample of discarded embryos in a family using the method according to any one of claims 1 to 15; 2) preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) Perform mapping and SNP calling through a computer system to generate SNP data and control its quality; 4) haplotype prephasing of blood samples from both parents or only the parent carrying the disease by a computer system; 5) Combined with the maternal cell contamination (MCC) rate and haplotype status, the likelihood of four possible inheritance scenarios for each single SNP indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents is calculated; 6) Estimate the MCC rate and determine the haplotype status of each SNP indicating whether DNA from only a single parent is present in the culture medium; 7) Combining the likelihood and recombination probability of each single SNP, calculate the likelihood of observing SNP data in the region adjacent to the pathogenic mutation site; 8) Determine whether the embryo carries the pathogenic chromosome and provide a confidence level.

32. The program product of claim 31, wherein the embryo has contamination caused by maternal cells and / or haplotype loss.

33. The program product according to claim 31, wherein in step 3), the positioning and SNP calling outputs the physical position, allele type, allele depth and sequencing quality of each SNP in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family.

34. The program product according to claim 31, wherein in step 3), the quality of the SNP data is controlled by filtering out the SNPs with the lowest 20% genetic quality (GQ) values ​​or all SNPs with GQ values ​​less than 10 in the biological samples in the culture medium of the in vitro cultured embryos and / or the biological samples of the discarded embryos in the family.

35. The program product according to claim 31, wherein in step 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and biological samples of the culture fluid with a SNP density less than 0.001 or a sequencing error rate greater than 0.2 are excluded.

36. The program product according to claim 31, wherein in step 4), any one or more of the following samples in the family are used: a blood sample of a proband, a biological sample of a discarded embryo, or a blood sample of at least one grandparent.

37. The program product of claim 31, wherein in step 5), when calculating the likelihood of each individual SNP, an estimated sequencing error rate is incorporated.

38. The program product according to claim 31, wherein step 6) further comprises the following steps: a) Preliminary estimation of the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and the haplotype status of each SNP.

39. The program product of claim 38, wherein step b) uses a tag search method.

40. The program product of claim 38, wherein after step a), samples with abnormal MCC rates are excluded.

41. The program product of claim 40, wherein the abnormal MCC rate is greater than 0.65 or less than -0.

5.

42. The program product according to claim 31, wherein a Bayesian model and a recursive algorithm are used in step 7).

43. The program product according to claim 31, wherein in step 8), the log-likelihood curves of both the upstream and downstream regions of the pathogenic mutation site are first drawn.

44. The program product of claim 31, wherein the genetic disease comprises a single gene disease and a multi-gene disease.

45. The program product according to any one of claims 31 to 44, wherein after step 8), the multiple identified SNPs of the embryo are combined to determine its susceptibility to a polygenic disease.

46. ​​A computer system for analyzing a biological sample of a culture medium of an in vitro cultured embryo to determine the susceptibility of the embryo to a genetic disease, comprising: 1) A device for amplifying DNA molecules in the biological sample of the culture fluid of the in vitro cultured embryo using the method according to any one of claims 1 to 15, and / or amplifying the biological sample of discarded embryos in a family; 2) a device for preparing a DNA library and sequencing the DNA molecules in the biological sample to obtain a plurality of sequence reads; 3) means for performing mapping and SNP calling by a computer system to generate SNP data and control its quality; 4) means for pre-phasing haplotypes of blood samples of both parents or only one parent carrying the disease by means of a computer system; 5) A device for calculating the likelihood of four possible inheritance scenarios for each single SNP, indicating whether the genetic chain is inherited from the paternal or maternal allele of the parents, in combination with the maternal cell contamination (MCC) rate and haplotype status; 6) a device for estimating the MCC rate and determining the haplotype status of each SNP, indicating whether DNA from only a single parent is present in the culture medium; 7) a device for combining the likelihood of each single SNP with the recombination probability to calculate the likelihood of observing SNP data in a region adjacent to the pathogenic mutation site; 8) A device for determining whether the embryo carries a pathogenic chromosome and providing a confidence level.

47. The computer system of claim 46, wherein the embryo has contamination due to maternal cell and / or haplotype loss.

48. A computer system according to claim 46, wherein in device 3), positioning and SNP calling outputs the physical position, allele type, allele depth and sequencing quality of each SNP in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family.

49. A computer system according to claim 46, wherein in device 3), the quality of SNP data is controlled by filtering out SNPs with the lowest 20% genetic quality (GQ) values ​​or all SNPs with GQ values ​​less than 10 in the biological sample of the culture medium of the in vitro cultured embryo and / or the biological sample of the discarded embryo in the family.

50. The computer system of claim 46, wherein in device 3), the sequencing error rate and relative density of SNPs in the region adjacent to the pathogenic mutation site are estimated, and biological samples of the culture fluid with a SNP density less than 0.001 or a sequencing error rate greater than 0.2 are excluded.

51. The computer system according to claim 46, wherein in means 4), any one or more of the following samples in the family are used: a blood sample of a proband, a biological sample of a discarded embryo, or a blood sample of at least one grandparent.

52. The computer system of claim 46, wherein in means 5), when calculating the likelihood of each individual SNP, an estimated sequencing error rate is incorporated.

53. The computer system according to claim 46, wherein the means 6) further comprises the following functions: a) Preliminary estimation of the MCC rate and haplotype status of each SNP in the region adjacent to the pathogenic mutation site; and b) recursively updating the MCC rate and the haplotype status of each SNP.

54. The computer system of claim 53, wherein function b) uses a tag search method.

55. The computer system of claim 53, wherein after function a), samples with abnormal MCC rates are excluded.

56. The computer system of claim 55, wherein the abnormal MCC rate is greater than 0.65 or less than -0.

5.

57. The computer system of claim 46, wherein a Bayesian model and a recursive algorithm are used in means 7).

58. The computer system of claim 46, wherein in device 8), log-likelihood curves of both the upstream and downstream regions of the pathogenic mutation site are first plotted.

59. The computer system of claim 46, wherein the genetic disease comprises a single gene disease and a multi-gene disease.

60. A computer system according to any one of claims 46 to 59, further comprising means for combining multiple identified SNPs of the embryo to determine its susceptibility to a polygenic disease.

Images