Zmski3 gene related to corn disease resistance and application thereof
By identifying and manipulating the maize ZmSKI3 gene, the problem of lack of disease resistance genes in maize breeding was solved, and effective resistance regulation to Curvularia leaf spot was achieved, providing new breeding resources and molecular targets.
Patent Information
- Application Number
- CN202410246138.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-05
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2044-03-05
AI Technical Summary
The lack of effective disease-resistant genes, especially resistance genes to Curvularia leaf spot, in maize breeding has hindered the development of disease-resistant maize breeding.
The function of the maize ZmSKI3 gene was identified and verified. By inhibiting or overexpressing the ZmSKI3 gene, the disease resistance of maize was regulated. Using EMS mutants and transgenic technology, the resistance of maize to Curvularia leaf spot was enhanced or weakened.
By manipulating the ZmSKI3 gene, the disease-resistant immune response of maize can be significantly activated or suppressed, and its resistance to Curvularia leaf spot can be enhanced or weakened, providing new genetic resources and molecular targets for maize disease-resistant breeding.
Smart Images

Figure CN118048365B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a ZmSKI3 gene associated with maize disease resistance and its applications. Background Technology
[0002] Maize is one of my country's three major grain crops, but in recent years, frequent diseases have severely impacted its yield and quality, making the breeding of disease-resistant maize varieties an urgent priority. However, the lack of resistance genetic resources and the narrow genetic base in maize breeding are highly detrimental to the development and molecular improvement of disease-resistant varieties. Obtaining disease-resistant genes and introducing them into target maize lines or varieties has proven to be an effective method. However, the lack of maize disease-resistant genes has slowed progress in maize disease-resistant breeding. Although there are some reports of cloning and applying maize resistance genes, this is far from meeting the demand for resistance genes in maize disease-resistant breeding. Therefore, discovering genes resistant to different diseases is a pressing issue that needs to be addressed in maize disease-resistant breeding.
[0003] Currently, maize disease resistance breeding lacks disease resistance genes, especially those for Curvularia leaf spot, which hinders the development of molecular breeding for maize disease resistance. Therefore, identifying genes in maize that regulate growth and disease resistance is of great significance for the genetic improvement of maize disease resistance. Previous studies in humans, yeast, Arabidopsis, and rice have shown that SKIs, cofactors of the mRNA splicing complex, may play a crucial role in growth and disease resistance. However, the genetic information of SKIs cofactors in maize and their roles in maize disease resistance and growth remain unknown. Summary of the Invention
[0004] The purpose of this invention is to provide a ZmSKI3 gene related to maize disease resistance and its application, in order to solve the problems existing in the prior art. This invention is the first to identify the ZmSKI3 gene in maize. Using EMS mutants and transgenic technology, the function of the ZmSKI3 gene in negatively regulating maize resistance to Curvularia leaf spot disease was verified, providing a new gene resource for maize disease resistance breeding.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a ZmSKI3 gene associated with maize disease resistance, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides the application of the ZmSKI3 gene in regulating maize disease resistance, wherein inhibiting the expression of the ZmSKI3 gene enhances maize disease resistance; overexpressing the ZmSKI3 gene weakens maize disease resistance; wherein the maize disease resistance is maize resistance to Curvularia leaf spot.
[0008] Furthermore, the curvularia leaf spot disease includes curvularia leaf spot disease caused by Curvularia lunata.
[0009] The present invention also provides a method for enhancing maize disease resistance, comprising the step of inhibiting the expression of the maize ZmSKI3 gene; the nucleotide sequence of the ZmSKI3 gene is shown in SEQ ID NO.1;
[0010] The disease resistance of maize refers to its resistance to Curvularia leaf spot.
[0011] Furthermore, inhibiting the expression of the ZmSKI3 gene includes prematurely terminating the translation of the maize ZmSKI3 protein.
[0012] This invention also provides the application of the ZmSKI3 gene in the breeding of disease-resistant maize varieties.
[0013] The present invention also provides a method for breeding disease-resistant maize varieties, comprising enhancing the disease resistance of the obtained maize plants by inhibiting the expression of the maize ZmSKI3 gene; the nucleotide sequence of the ZmSKI3 gene is shown in SEQ ID NO.1.
[0014] Furthermore, the disease resistance refers to resistance to Curvularia leaf spot disease.
[0015] Furthermore, the curvature leaf spot disease includes curvature leaf spot disease caused by Curvature lunulae.
[0016] Furthermore, inhibiting the expression of the ZmSKI3 gene includes prematurely terminating the translation of the maize ZmSKI3 protein.
[0017] The present invention discloses the following technical effects:
[0018] This invention identifies the ZmSKI3 gene in maize for the first time and demonstrates that this gene can regulate maize resistance to Curvularia leaf spot. In a specific embodiment of this invention, two mutants, Zmski3-1 and Zmski3-2, with premature termination of ZmSKI3 protein translation were obtained by screening an EMS mutant library. Phenotypic observation revealed that Zmski3-1 and Zmski3-2 plants were dwarfed, but their resistance to maize Curvularia leaf spot was significantly improved. Furthermore, transgenic lines overexpressing ZmSKI3 were obtained, showing no impact on growth, but significantly reduced resistance to maize Curvularia leaf spot. In addition, hormone testing of the Zmski3 mutants and corresponding controls revealed that the levels of the disease-resistant defense hormones salicylic acid and jasmonic acid were significantly increased in the resistant Zmski3 mutants. Transcriptome sequencing revealed that disease-resistant defense-related genes in Zmski3-1 were significantly upregulated compared to the control, while their expression was significantly downregulated in the susceptible ZmSKI3 overexpression transgenic lines. The above experiments confirmed that maize plants overexpressing the ZmSKI3 gene are more susceptible to disease, while mutant ZmSKI3 genes enhance maize's disease resistance.
[0019] The mutation of the ZmSKI3 gene obtained in this invention significantly activates the disease-resistant immune response of maize and enhances its resistance to Curvularia leaf spot. It is a new maize disease-resistant breeding gene resource. By manipulating this gene, maize plants with enhanced disease resistance can be obtained, providing an important molecular target for the breeding of resistant maize. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 Phylogenetic tree of maize ZmSKI3 protein;
[0022] Figure 2 This is a schematic diagram of the ZmSKI3 gene structure, where the long black arrows indicate mutation sites;
[0023] Figure 3 Phenotypic images of Zmski3-1 mutant seedlings (A) and Zmski3-2 mutant seedlings (B) 15 days after sowing;
[0024] Figure 4RT-qPCR analysis of defense-related genes in leaves of wild-type and Zmski3-1 mutant (A) and determination of the contents of JA, JA precursor, SA and SAG in leaves (B), where values are mean ± standard deviation, three biological replicates (**0.001<P≤0.01, ***P≤0.001, t test);
[0025] Figure 5 Phenotypic images of wild-type and Zmski3 mutant (homozygous mutant containing Zmski3-1 mutation site) 8 days after inoculation with Curvularia cristata during the silking stage of leaves under the background of Chang7-2(A) and Huangzao4(B);
[0026] Figure 6 Quantitative analysis of Curvularia lunata DNA 8 days after inoculation of leaves of wild-type and Zmski3 mutant (homozygous with Zmski3-1 mutation site) under Chang7-2(A) and Huangzao4(B) backgrounds. Maize ZmGAPC1 DNA was used as an internal control. Values are mean ± standard deviation. Three biological replicates (*0.01<P≤0.05, t test).
[0027] Figure 7 RT-qPCR analysis of defense-related genes in leaves of wild-type and Zmski3 mutants (homozygous mutants containing the Zmski3-1 mutation site) under Chang7-2(A) and Huangzao4(B) backgrounds, with ZmGAPC1 as a control. Values are mean ± standard deviation, with three biological replicates (*0.01<P≤0.05, **0.001<P≤0.01, t test).
[0028] Figure 8 The relative expression levels of ZmSKI3 in three ZmSKI3 overexpressing lines (OE-ZmSKI3) were plotted for RT-qPCR detection. ZmGAPC1 was used as an internal control. Values are expressed as mean ± standard deviation, and three biological replicates were performed. Different letters indicate statistically significant differences (P < 0.05).
[0029] Figure 9 Phenotypic figures of B104 and three ZmSKI3 overexpressing lines OE-ZmSKI3 8 days after inoculation with Curvularia cristata during the silking stage of leaves;
[0030] Figure 10 The quantitative analysis of Curvularia lunata DNA was performed on leaves of B104 and three ZmSKI3 overexpression lines OE-ZmSKI3 8 days after inoculation. Maize ZmGAPC1 DNA was used as an internal control. The values are mean ± standard deviation. Three biological replicates were performed. Different letters indicate statistically significant differences. P < 0.05.
[0031] Figure 11 The image shows the RT-qPCR analysis of defense-related genes in leaves of B104 and OE-ZmSKI3(#1), with ZmGAPC1 as an internal control. Values are expressed as mean ± standard deviation, with three biological replicates (**0.001<P≤0.01, ns, no significant difference, t test).
[0032] Figure 12 A diagram showing the analysis of differentially expressed genes in the transcriptomes of Zmski3 mutants and OE-ZmSKI3;
[0033] Figure 13 GO analysis diagram of differentially expressed genes in the Zmski3 mutant transcriptome;
[0034] Figure 14 Heatmap (A) and GO analysis diagram (B) of 223 genes that were significantly upregulated in the Zmski3 mutant and significantly downregulated in the OE-ZmSKI3 mutant. Detailed Implementation
[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0040] Example
[0041] 1. Evolutionary analysis of maize ZmSKI3 protein
[0042] Based on previous studies of the SKI3 protein in humans, yeast, and rice, the inventors constructed a phylogenetic tree using MEGAX and performed homologous sequence alignment using the Muscle function in MEGAX. This yielded the ZmSKI3 protein in maize, which exhibits the highest similarity and most homologous sequence to the SKI3 protein, with the encoding gene Zm00001d029833. Figure 1 The nucleotide sequence is shown in SEQ ID NO.1.
[0043] SEQ ID NO.1:
[0044] ATGCCCGAAACCGCGGCGGAGGCCAACCTCCGTAGGCAACTGGAGCAAACCCTCGCCGCTGAACCCTCCAGCCCGCTCCACCACTACAACCTTGGCGTCTTCCTATGGGACCGCGCCGAGGCAGAGCAGGAGGGTGATGGGGAAGAGGCGCGGAAGCTCCGCGCGGAAGCGTCGGAGCATTTTCTCGCGGCGGCCAAGCTGAATCCCAACGATGGCGTCCCCTTCCGCTTCCTTGGCCACCACTATGCGCGCGGCGGTGACAATCAACGAGCGGTCAAGTGCTATCACCGTGCCGTGACCCTCAACCCTGACGACTCTGAGGCTGGTGACACACTCTGTGGCTTGCTAGATGTTGAAGGGAAGGAGAGCTTGGAGCTTGCTGTCTGCAAGGAGGCAGCTGGCAAGTCACCGCGTGCGTTCTGGGCTTTTCGGAGACTTGGCTATTTACAGGTTCATCAGAGGAAATGGTCAGAGGGTATACAAAGCCTTCAGCATGGAATACGAGGTTACCCAACATGTGCAGATTTATGGGAGGCACTTGGTCTGGCATACCACCGTTTGGGCATGTTCACCGCAGCAGTAAAGTCATATGGACGAGCTATTGAACTTGATAGTTCCAGGGTCTTTGCATTGATAGAAAGTGGAAACATCCAGTTAATGCTTGGTTACTATAGAAAGGGAGTGGAGCAGTTTCGTTCTGCTTTGGAAATGGCTCCATGTAATCATTCAGCATACTTTGGCCTTGCTTCTGCATTGCTTGCATG G GCAAGGAATTGTGTAACTACTGGGGCCTTTGGTTGGGCTGCTAGCCTGTTGAAGGAAGCTTCAGAAGCTTCCAGAATTTGTACTTCTTTGACTGGAAACCTTTCATGCGTCTGGAAATTGCATGGAGATGTTCAGCTCACACTTGCGAGATGCTTTCCATGGGTGGATGGGAAAATCAAAAGGGTCATGGATGCACAGATGTTCAAAAATTCTGTTCAAGAGTGG
[0045] 2. Effects of ZmSKI3 gene mutation in maize on plant development and disease resistance
[0046] To investigate the function of the ZmSKI3 gene, two mutants, Zmski3-1 and Zmski3-2, with premature termination of ZmSKI3 protein translation were obtained by screening the EMS mutant library. Figure 2 As shown, mutant Zmski3-1 has a G-to-A mutation at position 765bp of the sequence shown in SEQ ID NO.1, forming the stop codon TGA, which causes premature termination of the ZmSKI3 protein; mutant Zmski3-2 has a G-to-A mutation at position 990bp of the sequence shown in SEQ ID NO.1, forming the stop codon TGA, which also causes premature termination of the ZmSKI3 protein (the mutation positions of the two mutants are underlined and bolded in SEQ ID NO.1).
[0047] Phenotypic observation revealed that the two different mutants of the ZmSKI3 gene, Zmski3-1 and Zmski3-2, both exhibited a similar phenotype of weak plant growth. Figure 3 This indicates that ZmSKI3 is the gene controlling the growth defects in mutants Zmski3-1 and Zmski3-2. Furthermore, the dwarf phenotype of mutants Zmski3-1 and Zmski3-2 is very similar to that of plant immune-activated mutants, suggesting that the disease resistance immune response in mutants Zmski3-1 and Zmski3-2 may have been activated. Therefore, the expression levels of disease resistance-related genes and the accumulation of disease resistance hormones were examined. The results showed that the transcriptional levels of disease resistance-related genes ZmPR1, ZmPR5, ZmAOC, and ZmAOS were significantly upregulated. Figure 4 (A). Simultaneously, the disease-fighting hormone jasmonic acid and its synthetic precursor OPC-4 significantly accumulated, and the contents of salicylic acid and salicylic acid 2-O-β-d-glucoside significantly increased (A). Figure 4 (B). The above results indicate that mutations in the ZmSKI3 gene lead to premature termination of the translation of the ZmSKI3 protein, affecting or eliminating the function of the ZmSKI3 gene, thereby impacting plant development, but significantly activating the disease resistance response of maize.
[0048] 3. The ZmSKI3 mutation in maize significantly enhances the plant's resistance to maize curvularia leaf spot.
[0049] Given the significantly activated immune response to maize disease in Zmski3-1, this study investigated whether mutations in Zmski3-1 enhance maize disease resistance. The Zmski3-1 mutation site was introduced into two susceptible inbred lines, Chang7-2 and Huangzao4, via hybridization. The results showed that, under both genetic backgrounds, homozygous plants containing the Zmski3-1 mutation site exhibited significantly enhanced resistance to maize curvularia leaf spot compared to the wild-type (WT). Figure 5 Furthermore, the DNA content of Curvularia lunata was detected by RT-qPCR. It was found that the DNA content of Curvularia lunata in plants containing the ZmSKI3 mutation was significantly lower than that in the WT group, further confirming the positive contribution of the Zmski3-1 mutation site to disease resistance. Figure 6 Furthermore, under both genetic backgrounds, the expression of disease resistance genes was significantly upregulated in materials containing the Zmski3-1 mutation site. Figure 7 ).
[0050] 4. Overexpression of the ZmSKI3 gene significantly reduces resistance to Curvularia leaf spot in maize.
[0051] To investigate the disease resistance of plants overexpressing ZmSKI3, the ZmSKI3 gene was transformed into a maize B104 background using the maize UBI promoter. RT-qPCR analysis yielded three transgenic lines with significantly increased transcriptional levels of ZmSKI3 overexpression. Figure 8 After inoculation with the dominant race Curvularia crescentis CX-3 for Curvularia leaf spot, all three overexpression lines showed stronger susceptibility to the disease compared to the wild-type (WT). Figure 9 The colony quantification experiment further confirmed its pathogenic effect. Figure 10 Meanwhile, the expression levels of disease resistance-related genes were also significantly reduced in the overexpression lines. Figure 11 ).
[0052] 5. Differences in disease resistance-related pathways between Zmski3 mutants and ZmSKI3 overexpression lines
[0053] To further elucidate the molecular pathways activated or inhibited by Zmski3-1, transcriptome analysis was performed on the Zmski3-1 mutant and the ZmSKI3 overexpression line (OE-ZmSKI3). Compared with the wild-type control, the Zmski3-1 mutant transcriptome identified 943 significantly upregulated and 929 significantly downregulated genes. Figure 12 GO analysis of these upregulated and downregulated genes showed that the upregulated genes were mainly enriched in molecular pathways related to disease resistance and defense, while the downregulated genes were mainly enriched in molecular pathways related to growth and development. Figure 13 These results indicate that the mutant Zmski3-1 extensively activates the plant's disease-resistant immune response at the molecular level.
[0054] Further analysis of genes significantly upregulated in the resistant Zmski3-1 mutant and significantly downregulated in the susceptible ZmSKI3 overexpression lines identified 223 co-regulated genes. GO enrichment analysis revealed that these genes primarily clustered in pathways related to disease resistance defense responses, further supporting the negative regulatory effect of the Zmski3-1 mutation on maize resistance to Curvularia leaf spot. Figure 14 ).
[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of the ZmSKI3 gene, which is associated with maize disease resistance, in regulating maize disease resistance, characterized in that... By prematurely terminating the translation of the maize ZmSKI3 protein encoded by the ZmSKI3 gene, the disease resistance of maize is enhanced. The disease resistance of maize refers to its resistance to Curvularia leaf spot disease; The nucleotide sequence of the ZmSKI3 gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The curvularia leaf spot disease includes those caused by Curvularia crescentis (… Curvularia lunata Curvularia leaf spot disease caused by ).
3. A method for enhancing the disease resistance of maize, characterized in that, Premature termination of translation of the maize ZmSKI3 protein encoded by the ZmSKI3 gene can enhance maize's resistance to Curvularia leaf spot; the nucleotide sequence of the ZmSKI3 gene is shown in SEQ ID NO.
1. The disease resistance of maize refers to its resistance to Curvularia leaf spot.
4. The application of a ZmSKI3 gene related to maize disease resistance in the breeding of disease-resistant maize varieties, wherein the resistance of maize to Curvularia leaf spot can be improved by prematurely terminating the translation of the maize ZmSKI3 protein encoded by the ZmSKI3 gene; the nucleotide sequence of the ZmSKI3 gene is shown in SEQ ID NO.
1.
5. A method for breeding disease-resistant maize varieties, characterized in that, This includes prematurely terminating the translation of the maize ZmSKI3 protein encoded by the ZmSKI3 gene, thereby enhancing the disease resistance of the obtained maize plants; the nucleotide sequence of the ZmSKI3 gene is shown in SEQ ID NO.1; the disease resistance is resistance to Curvularia leaf spot.
6. The method according to claim 5, characterized in that, The curvature leaf spot disease includes curvature leaf spot disease caused by Curvature lunulae.