Improved bFGF coding sequence and its application in modified cells

Abstract

The present invention provides an improved bFGF coding sequence and an application of modified cells thereof, belonging to the field of cell engineering technology. The present invention provides a modified bFGF coding sequence such as SEQ ID NO.1. Compared with the sequence before modification, the modified sequence of the present invention has a higher expression level, and the modified cells prepared by the modified sequence have a better spinal cord injury treatment effect in the corresponding rat model, and have clinical application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of cell engineering, and in particular relates to an improved bFGF coding sequence and application of the modified cells thereof. Background Art

[0002] Spinal cord injury is caused by spinal displacement or bone fragments protruding into the spinal canal after a spinal fracture, which causes varying degrees of damage to the spinal cord or spinal nerves. It is divided into primary spinal cord injury and secondary spinal cord injury. Stem cell transplantation is an effective means of treating spinal cord injury.

[0003] Stem cells are induced to differentiate into nerve cells and integrate into the patient's damaged tissues, forming synaptic structures between neurons with normal nerve cells, thus improving the function of the central nervous system to a certain extent. Currently, there are many types of transplanted cells available, among which neural stem cells have a more ideal effect.

[0004] Basic Fibroblast Growth Factor (bFGF) is an 18kD polypeptide composed of 155 amino acids. bFGF is expressed at low levels in adult mammalian spinal cord tissue, but bFGF expression is significantly upregulated after spinal cord tissue injury. Many studies have shown that bFGF can promote angiogenesis, axon regeneration, neuroprotection, tissue repair, and mobilization of endogenous neural stem cells, and plays an important role in the development and injury repair of the central nervous system. In the rat acute spinal cord injury model, bFGF can inhibit neuronal apoptosis, increase blood supply to the ischemic area of ​​the spinal cord, significantly repair the area of ​​spinal cord injury, and improve neurological dysfunction. However, as a key nutritional factor in stem cell differentiation, bFGF has a short half-life in vivo and is rapidly degraded after intravenous administration, making it difficult to maintain its biological activity; in terms of spinal cord injury applications, it is a biological macromolecule that is difficult to penetrate the blood-spinal cord barrier; at the same time, FGF receptors are widely distributed in various tissues and organs throughout the body, and the side effects of intravenous systemic administration are large, which also limits its application. Therefore, developing the function of bFGF in modified cells is a good direction for the research and development of spinal cord injury.

[0005] In existing research, an oxygen-regulated basic fibroblast growth factor (bFGF) gene sequence and a method for modifying cells with the gene sequence have been disclosed, the method comprising: step 1, providing a gene sequence; step 2, constructing the gene sequence obtained in step 1 into a recombinant adeno-associated virus vector; step 3, fusing the constructed recombinant adeno-associated virus vector into stem cells to obtain an oxygen-regulated basic fibroblast growth factor-modified controllable bFGF gene expression vector, achieving regulatable expression under specific conditions, different expressions under normoxic and hypoxic environments, and avoiding many side effects such as excessive tissue proliferation and tumorigenic risks caused by long-term overexpression of bFGF by traditional gene therapy vectors (CN201610809410.X). However, the effect of this method is limited, and there is room for further optimization.

[0006] Codon optimization can be used as a research direction. Codon optimization can improve translation efficiency. However, due to problems such as codon preference, codon coordination, and codon sensitivity, some forms of optimization are likely to cause a sharp drop in translation efficiency, pause, or even translation termination. Therefore, codon optimization is actually quite complicated. There is no technical solution for codon optimization of existing technologies disclosed in this field. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a modified bFGF coding sequence. By optimizing the existing bFGF coding sequence, a bFGF coding sequence with better application prospects is obtained.

[0008] In one aspect, the present invention provides a modified bFGF coding sequence.

[0009] The bFGF sequence is SEQ ID NO.1.

[0010] SEQ ID NO.1 is the optimized sequence of SEQ ID NO.2.

[0011] In another aspect, the present invention provides a vector comprising the aforementioned bFGF coding sequence.

[0012] Specifically, the vector includes SEQ ID NO.1 and a PGK promoter sequence, and the SEQ ID NO.1 and the PGK promoter sequence are connected and then inserted into the vector.

[0013] Preferably, the vector is an adeno-associated virus vector, preferably a pAVV vector.

[0014] Preferably, the site for insertion into the vector can be selected from any one or more of ClaI, EcoRI, BamHI, SalI, HindIII, XhoI, and BglII, preferably two.

[0015] More preferably, the insertion sites of the vector are EcoRI and BamHI.

[0016] Preferably, the PGK promoter sequence is SEQ ID NO.3:

[0017] ggggttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggcgccgaccctgggtctcgcacattcttcacgtccgttcgca gcgtcacccggatcttcgccgctacccttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgactc actagtaccctcgcagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctgctcagcggggcgcgccgagagcagcggccgggaaggggcggtgcggga ggcggggtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccag.

[0018] Specifically, the method for constructing the vector includes: constructing an insertion fragment containing SEQ ID NO.1, PGK promoter sequence and restriction site, and inserting the fragment into the corresponding vector.

[0019] The inserted fragment may be artificially synthesized, or may be obtained through published or unpublished technical means of obtaining the corresponding fragment, such as through technical means including but not limited to amplification.

[0020] Preferably, the sequence of the inserted fragment is SEQ ID NO.4.

[0021] In some embodiments, the vector is pAVV-bFGF-1.

[0022] In still another aspect, the present invention provides a cell comprising the aforementioned vector.

[0023] The cell types include but are not limited to Escherichia coli and animal cells.

[0024] The cells are preferably cells with expression ability.

[0025] Preferably, the cells can be selected from DH5a, CHO cells, 293 cells and the like.

[0026] More preferably, the cells are AAV-293 cells.

[0027] The cells are prepared by transfecting the aforementioned vector.

[0028] The cells can be obtained by co-transfection of three plasmids: a plasmid containing ITR, pAAV-RC and an E1 deletion helper plasmid.

[0029] In some embodiments, the cells are obtained by co-transfecting AAV-293 cells with pAVV-bFGF-1, pHelper and pAAV-RC.

[0030] The cells can produce recombinant adenovirus, and the present invention also protects the recombinant adenovirus produced by these cells.

[0031] The modified cells prepared by the aforementioned adenovirus are also within the scope of protection of the present invention. Specifically, the modified cells are prepared by the aforementioned recombinant adenovirus. Preferably, the modified cells include but are not limited to: embryonic stem cells, neural stem cells, umbilical cord blood stem cells or bone marrow mesenchymal stem cells modified by recombinant adenovirus, and more preferably neural stem cells.

[0032] In another aspect, the present invention provides the use of the aforementioned bFGF coding sequence or vector or cell or recombinant adenovirus or modified cell in the preparation of a drug for treating spinal cord injury.

[0033] The present invention also provides a medicine comprising the aforementioned bFGF sequence or vector or cell or recombinant adenovirus or modified cell.

[0034] The medicine may also include other pharmaceutically acceptable carriers or excipients.

[0035] Preferably, the medicine is an injection, and the medicine comprises the aforementioned modified cells.

[0036] Beneficial effects of the present invention:

[0037] The present invention provides a method for preparing a modified bFGF coding sequence and related products thereof. Compared with before modification, the modified sequence of the present invention has a higher expression level, and the modified cells prepared therefrom have a better spinal cord injury treatment effect in a corresponding rat model, and have clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The figure shows the agarose gel electrophoresis results of the target gene fragment and the linear vector fragment after restriction digestion.

[0039] Figure 2 The results of Western blotting were used to detect the expression of bFGF-1 or bFGF-2 genes. DETAILED DESCRIPTION

[0040] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0041] Some experimental conditions in the following examples, unless otherwise specified, can be implemented by general technical means in the art, or those skilled in the art can perform conventional optimization based on existing technical means. Including but not limited to: when it comes to enzyme cleavage or enzyme ligation, in the case of clarifying the substrate and enzyme type, those skilled in the art can routinely adjust the reaction conditions, such as the amount of each reagent, buffer system, reaction temperature and reaction time to achieve the purpose of enzyme cleavage or enzyme ligation, and then purify the product according to general technical means, such as purifying according to the instructions of the gel recovery kit instructions, and the selection or improvement of similar means does not affect the final product (enzyme cleavage fragment or enzyme ligation product), and the product can achieve the technical solution of the present invention after the sequence is verified to be correct.

[0042] Example 1 A modified bFGF sequence

[0043] This example is based on the sequence shown in SEQ ID NO.2:

[0044] SEQ ID NO.2:

[0045] atggcagccg ggagcatcac cacgctgccc gccttgcccg aggatggcgg cagcggcgccttcccgcccg gccacttcaa ggaccccaag cggctgtact gcaaaaacgg gggcttcttc ctgcgcatccaccccgacgg ccgagttgac ggggtccggg agaagagcga ccctcacatc aagctacaac ttcaagcagaagagagagga gttgtgtcta tcaaaggagt gtgtgctaac cgttacctgg ctatgaagga agatggaagattactggctt ctaaatgtgt tacggatgag tgtttctttt ttgaacgatt ggaatctaat aactacaatacttaccggtc aaggaaatac accagttggt atgtggcact gaaacgaact gggcagtata aacttggatccaaaacagga cctgggcaga aagctatact ttttcttcca atgtctgcta agagctga;

[0046] SEQ ID NO.2 was optimized by point mutation, and a variety of point mutations and truncations were designed for screening, and finally a modified sequence was determined, as shown in SEQ ID NO.1.

[0047] SEQ ID NO.1:

[0048] atggcagccg ggagcatcac cacgctgccc gccttgcccg aggatggcgg cagcggcgccttcccgcccg gccacttcaa ggaccccaag cggctgtact gcaaaaacgg gggcttcttc ctgcgcatccaccccgacgg ccgagttgac ggggtccggg agaagagcga ccctcacatc aagctacaac ttcaagcagaagagagagga gttgtgtcta tcaaaggagt gtgtgctaac cgttatttgg cgatgaaaga agatggaagattactcgctt ctaagtgtgt tacggatgag tgtttcttct tcgaacgatt ggaatctaat aactacaatacttaccggtc aaggaaatac accagttggt atgtggcact gaaacgaact gggcagtata aacttggatccaaaacagga cctgggcaga aagctatact ttttcttcca atgtctgcta agagctga.

[0049] Example 2 Construction of recombinant adenovirus plasmid

[0050] The PGK promoter sequence was designed at the 5' end of SEQ ID NO.1, and the restriction site BamHI was designed. Another restriction site EcoRI was designed at the 3' end to obtain SEQ ID NO.4. SEQ ID NO.4 was artificially synthesized:

[0051] GAATTCggggttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggcgccgaccctgggtctcgcacattcttcacgtccgt tcgcagcgtcacccggatcttcgccgctacccttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacg actcactagtaccctcgcagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctgctcagcggggcgcgccgagagcagcggccgggaaggggcggtgcg ggaggcggggtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccag atggcag ccgggagcatcaccacgctgcccgccttgcccgaggatggcggcagcggcgccttcccgcccggccacttcaagga ccccaagcggctgtactgcaaaaacgggggcttcttcctgcgcatccaccccgacggccgagttgacggggtccgg gagaagagcgaccctcacatcaagctacaacttcaagcagaagagagaggagttgtgtctatcaaaggagtgtgtg ctaaccgttatttggcgatgaaagaagatggaagattactcgcttctaagtgtgttacggatgagtgtttcttctt cgaacgattggaatctaataactacaatacttaccggtcaaggaaatacaccagttggtatgtggcactgaaacga actgggcagtataaacttggatccaaaacaggacctgggcagaaagctatactttttcttccaatgtctgctaaga gctga GGATCCC;

[0052] The synthetic fragment and plasmid AAV-MCS (Cell Biolabs, VPK-411) were double-digested with EcoRI and BamHI to obtain the target fragment and linear vector, respectively. After the enzyme digestion products were purified and verified to be correct, the recombinant adenovirus plasmid was constructed by enzyme ligation and named pAVV-bFGF-1.

[0053] Using the sequence SEQ ID NO.2 before mutation as a control, the design was carried out according to the above scheme to obtain the recombinant adenovirus plasmid pAVV-bFGF-2.

[0054] The specific steps are as follows:

[0055] (1) Double enzyme digestion conditions:

[0056] Incubate in a 37°C water bath for 2 h;

[0057] Target gene double enzyme digestion system:

[0058] Reagents Dosage Synthetic Clips 500ng 10×Buffer 2μL EcoRI / BamHI 1μL each Total Add ddH2O to 20 μL

[0059] Plasmid AAV-MCS double restriction enzyme digestion system:

[0060] Reagents Dosage AAV-MCS 1000ng 10×Buffer 2μL EcoRI / BamHI 1μL each Total Add ddH2O to 20 μL

[0061] The target gene fragment and the linear vector fragment were verified by 1% agarose gel electrophoresis. Figure 1 , the left is the target gene fragment, and the right is the linear vector fragment.

[0062] The above enzyme digestion products were recovered and purified using a gel recovery kit.

[0063] (2) Enzyme ligation conditions:

[0064] React at 16℃ for 12 hours; Enzyme-linked system:

[0065]

[0066]

[0067] Product verification: The enzyme-linked product was mixed with DH5a competent cells at a volume ratio of 1:10, then placed on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, and immediately placed on ice for 5 minutes. 700 μL LB medium preheated to room temperature was added, and cultured at 37°C for 50 minutes. The bacterial solution was aspirated, mixed with a pipette, and evenly spread on an LB plate containing 100 μg / mL ampicillin resistance, and incubated in a 37°C incubator overnight. After the positive clones were selected for amplification and culture, the plasmids were extracted and sent for verification. The verified plasmid pAVV-bFGF-1 was selected for recombinant adenovirus packaging.

[0068] Example 3 Packaging of recombinant adenovirus

[0069] pAVV-bFGF-1 and pHelper (Solarbio, VT000182) and pAAV-RC (Solarbio, VT000184) plasmids were co-transfected into AAV-293 cells. Virus AVV-bFGF-1 was collected and purified.

[0070] pAVV-bFGF-2 was used as a control according to the above steps to obtain AVV-bFGF-2.

[0071] Specific methods:

[0072] (1) Resuscitate AAV-293 cells in a 15 cm culture dish. After 24-72 hours, when the cells reach 70% confluence, split the dish at a ratio of 1:3. After 48 hours, split the dish at a ratio of 1:10. After 48 hours, plasmid transfection can be performed.

[0073] (2) Using obio virus packaging transfection reagent (OGTR(C)20131001), three plasmids (pAVV-bFGF-1: pAAV-RC: pHelper mass ratio 1:1:1) were co-transfected into AAV-293 cells according to the instructions. The culture medium was aspirated every 6 hours, the cells were washed once with PBS, and 10 mL of fresh complete culture medium was added for culture.

[0074] (3) Virus harvesting and purification refer to the existing technical methods, as follows:

[0075] 1) 60 hours after transfection, scrape the cells with a cell scraper and collect them into a centrifuge tube.

[0076] 2) The collected cells were centrifuged at 4°C for 5 min, and the cell lysate pellet was resuspended in 7 mL of 10 mM Tris-HCl buffer.

[0077] 3) The cell lysate was stored in a dry ice / ethanol bath and a 37°C water bath and repeatedly frozen and thawed eight times.

[0078] 4) Use 10 mM Tris-HCl to adjust the volume of the cell lysate to 21 mL.

[0079] 5) Ultrasound for 7 minutes.

[0080] 6) Add 2 mL of DNase I (3 mg / mL) to the cell lysate after sonication and incubate at 37°C for 30 min.

[0081] 7) Ultrasonicate again for 7 minutes.

[0082] 8) Add 2.5 mL of 10% sodium deoxycholate and 2.1 mL of 0.25% trypsin-EDTA, mix well, incubate at 37°C for 30 min, and place on ice for 20 min.

[0083] 9) Add 16.9 g CsCl, mix well, and incubate at 37°C for 20 min. Shake continuously during incubation at 37°C until CsCl is completely dissolved.

[0084] 10) Centrifuge the treated cell lysate at 3000 g for 30 min at 4°C and carefully transfer the cell lysate to an ultracentrifuge tube (5 mL / tube).

[0085] 11) Centrifuge at 53,000 rpm for 30 h at 4°C.

[0086] 12) Collect the virus layer.

[0087] 13) Dialyze at 4°C in PBS + 10% glycerol for 1-2 hours; after the first dialysis, replace the buffer with freshly prepared PBS + 10% glycerol and dialyze overnight.

[0088] Example 4 Recombinant adenovirus modified cells

[0089] Rat primary neural stem cells 5×10 5 / rnL, inoculated in DMEM medium. Take 1 μL of the supernatant of the recombinant adenovirus AVV-bFGF-1 purified in Example 3 and dilute it 20 times with DMEM medium, take 2 μL of the diluent and add it to the primary neural stem cells of rats, and after culturing for 18 hours, the modified cells AVV-bFGF-1-Nev are prepared, and are evenly divided into two groups, one of which is cultured in a normoxic (O2 concentration of 21%) incubator for 24 hours, and the other group is cultured in a hypoxic (O2 concentration of less than 1%) incubator for 24 hours.

[0090] AVV-bFGF-2 was used as a control to prepare the modified cells AVV-bFGF-2-Nev.

[0091] Immunoblotting was used to detect the expression of bFGF-1 or bFGF-2 gene.

[0092] result( Figure 2 ) showed that the expression of AVV-bFGF-1 was better than that of AVV-bFGF-2.

[0093] Example 5 Treatment of spinal cord injury by recombinant adenovirus-modified cells

[0094] This test was divided into a blank control group, a model group, an experimental group (AVV-bFGF-1-Nev), and a control group (AVV-bFGF-2-Nev). All of them were 10-week-old SD male rats weighing 300±20g. Each group had 7 rats, which were randomly assigned. The blank group rats did not undergo surgery. The T9-11 segment spinal cord of the model group rats was exposed, and the spinal cord was compressed by an arterial vascular clamp (30g, 2min) to induce acute spinal cord injury in SD rats. On the basis of the surgical operation of the model group rats, the experimental group rats were subcutaneously injected with 1.5×10 6 The rats in the control group were injected with bFGF gene recombinant cells AVV-bFGF-1-Nev, and the rats in the control group were continuously injected with bFGF gene recombinant cells AVV-bFGF-2-Nev subcutaneously based on the surgical operation of the rats in the model group.

[0095] The Basso-Beattie-Bresnahan (BBB) ​​scoring method (Takeda M, Kawaguchi M, Kumatoriya T, et al. Effects of minocycline on hind-limb motor function and gray and white matter injury after spinal cord ischemia in rats[J]. Spine (Phila Pa 1976), 2011, 36(23): 1919-1924) was used to evaluate the walking and limb activities of the hind limbs of rats in each group. The spinal cord function was evaluated on the 1st, 3rd, 7th and 14th day after surgery.

[0096] The results showed that AVV-bFGF-1-Nev had better therapeutic effect. The scoring results were as follows:

[0097]

[0098] According to the above data, it can be seen that the scores of the model group rats decreased significantly compared with the blank group, indicating that the model was successfully constructed. The spinal cord function of the model group rats that were not treated was still at a lower level after 14 days compared with the blank group. The bFGF gene recombinant cells AVV-bFGF-1-Nev (experimental group) prepared by the present invention achieved the best therapeutic effect, which was very close to the blank group at 14 days, and was significantly improved compared with AVV-bFGF-2-Nev (control group) prepared by the bFGF coding sequence before optimization, indicating that the optimization of the bFGF coding sequence has a positive effect.

[0099] Comparative Example

[0100] The comparative example was prepared by referring to the method of Examples 1-4 to obtain recombinant adenovirus modified cells AVV-bFGF-3-Nev, except that SEQ ID NO.1 was replaced by SEQ ID NO.5, and the therapeutic effect on spinal cord injury was verified by referring to the method of Example 5. In the actual experiment, the comparative example and the method of the example were carried out simultaneously.

[0101] SEQ ID NO.5 sequence is:

[0102] atggcagccg ggagcatcac cacgctgccc gccttgcccg aggatggcgg cagcggcgccttcccgcccg gccacttcaa ggaccccaag cggctgtact gcaaaaacgg gggcttcttt ctgcgcatccaccccgacgg ccgagttgac ggggtccggg agaagagcga ccctcacatc aagctacaac ttcaagcagaagagagagga gttgtgtcta tcaaaggagt gtgtgctaac cgttatttgg caatgaaaga agatggaagattattagctt ctaagtgtgt tacggatgag tgtttcttct tcgaacgatt ggaatctaat aactacaatacttaccggtc aaggaaatac accagttggt atgtggcact gaaacgaact gggcagtata aacttggatccaaaacagga cctgggcaga aagctatact ttttcttcca atgtctgcta agagctga.

[0103] The BBB score results of AVV-bFGF-3-Nev in rat experiments are as follows:

[0104]

[0105] From the data comparison, it can be seen that the effect of the comparative example AVV-bFGF-3-Nev is even lower than that of the control group (AVV-bFGF-2-Nev, before optimization), which is obviously inferior to the technical solution of SEQ ID NO.1 of the present invention.

[0106] The specific embodiments of the present invention are described in detail above, but the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the present invention also fall within the scope of the present invention.

Claims

1. A modified bFGF coding sequence, characterized in that, As shown in SEQ ID NO.

1.

2. A vector comprising the bFGF coding sequence of claim 1.

3. The carrier according to claim 2, characterized in that It also includes a PGK promoter; the vector is an adeno-associated virus vector.

4. The carrier according to claim 3, characterized in that The SEQ ID NO.1 is connected to the PGK promoter and then inserted into a vector, the insertion site of the vector is selected from any one or two of ClaI, EcoRI, BamHI, SalI, HindIII, XhoI, and BglII, and the vector is a pAVV vector; the PGK promoter is SEQ ID NO.

3.

5. A cell comprising the vector according to any one of claims 2 to 4.

6. The cell according to claim 5, characterized in that AAV-293 cells.

7. The recombinant adenovirus produced by the cell according to any one of claims 5 to 6.

8. The modified cell prepared by the recombinant adenovirus according to claim 7, characterized in that: The modified cells are neural stem cells.

9. Use of the bFGF coding sequence according to claim 1, the vector according to any one of claims 2 to 4, the cell according to any one of claims 5 to 6, the recombinant adenovirus according to claim 7, or the modified cell according to claim 8 in the preparation of a drug for treating spinal cord injury.

Images