Plant expression vector for expressing recombinant red algae lectin, rice and application thereof

Abstract

The present invention discloses a method for expressing recombinant red algae lectin in genetically engineered rice, including plant expression vector construction, extraction and detection scheme of recombinant red algae lectin. The vector contains a red algae lectin gene optimized by rice codons, and an upstream signal peptide sequence optimized by rice codons. The red algae lectin gene contains DNA molecules of SEQ ID NO.1 and SEQ ID NO.3, or a DNA molecule that can hybridize with the SEQ ID NO.1 sequence and encodes red algae lectin. The present invention constructs a recombinant red algae lectin expression vector expressed in rice endosperm cells, successfully expresses the recombinant red algae lectin in rice, and establishes a method for systematically identifying the expression distribution of recombinant protein and extracting the red algae lectin in one step. The method of the present invention has high safety, is easy to scale up, and has extremely low cost. The obtained recombinant red algae lectin has significant antiviral activity and can be applied in multiple fields.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a plant expression vector, rice and application thereof, for expressing recombinant red algae lectin by genetically engineered rice. Background Art

[0002] Red algae lectin protein (GRFT) is a 12.7 kilodalton lectin isolated from red algae (Griffithsia sp.). It can inhibit the spread of various viruses by selectively binding to mannose-rich sugars on viral envelope glycoproteins, playing a role in the prevention and treatment of viral diseases. Existing studies have shown that GRFT exhibits broad-spectrum antiviral activity against a variety of viruses, including human immunodeficiency virus (HIV-1), severe acute respiratory syndrome-associated coronavirus (SARS-CoV) and other coronaviruses, hepatitis B virus (HBV), Japanese encephalitis virus (JEV) and herpes simplex virus (HSV). Therefore, GRFT can block the initial infection and cell-to-cell transmission of a variety of viruses, and has the advantages of high solubility, low immunogenicity, and no hemagglutination. It can be used as a new type of antiviral drug with broad market prospects.

[0003] Since the content of GRFT in natural algae is low and large-scale production cannot be achieved, it must be expressed heterologously to meet its application needs in the prevention and treatment of viral diseases in humans and animals. In Escherichia coli, the yield of recombinant GRFT is 819 mg per liter of culture medium, but 33% of the protein is deposited as inclusion bodies, and its biological activity is low due to misfolding. Although GRFT can be expressed transiently in N. benthamiana, and the expression level can reach one thousandth of the fresh weight, the exogenous protein expressed in tobacco leaves is poorly stable, and contains a large amount of secondary metabolites and endotoxins in Agrobacterium used during infection, which increases its purification cost and use risk.

[0004] In contrast, the rice endosperm expression system has the advantages of large expression, high activity, high stability, low cost, no endotoxins and secondary metabolites, etc. It has been successfully used for heterologous expression of pharmaceutical proteins, vaccines, vitamins, flavonoids and carotenoids. There have been no reports on the large-scale production of recombinant GRFT using rice endosperm in domestic scientific research and production units, which mainly involve the selection of expression elements, construction of expression vectors, genetic transformation, purification and detection of expression products, etc. Summary of the invention

[0005] In view of the above problems, the present invention aims to provide a transgenic vector and engineered rice for efficiently expressing recombinant red algae lectin, which can provide raw materials for large-scale production of red algae lectin using rice endosperm bioreactors.

[0006] In order to achieve the purposes of transgenic vector construction, genetic transformation, transgenic material identification, expression product extraction and antiviral activity detection, the technical scheme adopted by the present invention is as follows:

[0007] A plant expression vector for expressing recombinant red algae lectin (OsGRFT) is constructed, characterized in that the vector contains a red algae lectin gene optimized by rice codons and contains an upstream signal peptide sequence optimized by rice codons.

[0008] Furthermore, the red algae lectin gene comprises a sequence of SEQ ID NO.1 or SEQ ID NO.3, and a DNA molecule that can hybridize with the sequence and encodes the red algae lectin.

[0009] Furthermore, the rice endosperm-specific promoter SEQ ID NO.4 sequence is used to drive the red algae lectin gene.

[0010] A method for preparing recombinant red algae lectin by expressing it in rice endosperm by genetic engineering, characterized by comprising the following steps:

[0011] S1. Construction of a plant expression vector for expressing recombinant red algae lectin in rice seeds;

[0012] S2, genetically transforming the vector and cultivating rice seeds;

[0013] S3, identifying the expression amount and location of the recombinant protein in the rice seeds;

[0014] S4, drying, shelling and crushing the prepared rice seeds to obtain crushed materials;

[0015] S5. The crushed product is extracted with a buffer solution, and then a crude extract is obtained by affinity purification.

[0016] A method for detecting antiviral activity of red algae lectin in rice seeds prepared as above, characterized in that it comprises the following steps:

[0017] S6. The obtained crude extract is tested for anti-BVDV virus activity.

[0018] Further, in step S5, the buffer comprises 50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, pH 8.

[0019] A carrier containing the red algae lectin and rice seeds for use in anti-virus.

[0020] The beneficial effects of the present invention are as follows: the present invention constructs an expression vector for expressing recombinant red algae lectin in rice endosperm cells, successfully expresses the recombinant red algae lectin in rice, and establishes a method for systematically identifying the expression distribution of the recombinant protein and extracting the red algae lectin in one step. The present invention has high safety, is easy to scale up, and has extremely low cost. The obtained recombinant red algae lectin has significant antiviral activity and can be applied in multiple fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the pLF1 vector structure.

[0022] Figure 2 Schematic diagram of the pOsGRFT vector structure.

[0023] Figure 3 PCR detection of genetically engineered rice T0 plants expressing OsGRFT-His. In the figure, M is a DNA standard molecular weight marker, T0-1 to T0-63 are 63 independent T0 plants, of which plants 2, 5, 6, 8, 11, 14, 15, 16, 18, 19, 20, 22, 23, 24, 27, 30, 32, 35, 36, 37, 38, 39, 40, 43, 45, 47, 48, 49, 51, 52, 54, 55, 56, 60 and 63 are transgenic positive plants carrying the OsGRFT fragment.

[0024] Figure 4 Immunofluorescence detection of OsGRFT-His in the endosperm of genetically engineered rice expressing OsGRFT-His. In the figure, the negative plant produced by transgenic was on the left, which served as a negative control. As shown in the figure, the recombinant protein was highly expressed in the endosperm aleurone layer, subaleurone layer and outer endosperm cells.

[0025] Figure 5 Immunocolloidal gold detection of OsGRFT-His in the endosperm of genetically engineered rice expressing OsGRFT-His. As shown in the figure, the recombinant protein is highly expressed in irregularly shaped type II protein bodies, and the diameter of the gold particles is 10 nm.

[0026] Figure 6 The Western Blot results of OsGRFT-His recombinant protein in the protein extract obtained by one-step affinity purification. In the figure, M is the prestained protein standard (Thermo Fisher, LC5925), where 8 # , 16 # , 36 # and 51 # For transgenic positive individual plants, 7 #It is a transgenic negative single plant (as a negative control), and the theoretical size of the recombinant protein is 13.6 kDa.

[0027] Figure 7 This is the antiviral effect detection of the one-step affinity purified OsGRFT-His protein on BVDV (BVDV was detected by immunofluorescence in MDBK cells). In the figure, A is the MDBK cells inoculated with BVDV only, as a blank control; B is inoculated with BVDV + 0.02ug / mL conventional rice extract, as a negative control; C is inoculated with BVDV + 0.02ug / mL recombinant OsGRFT-His extract; D is inoculated with BVDV + 0.005ug / mL recombinant OsGRFT-His extract. The results show that recombinant OsGRFT-His has significant antiviral activity, while conventional rice extract does not have antiviral activity.

[0028] Figure 8 The effect of one-step affinity-purified OsGRFT-His on the infection load of BVDV (RT-qPCR was used to detect the relative content of BVDV RNA in MDBK cells). In the figure, "Mock" is MDBK inoculated with only BVDV strains, as a blank control; "Control" is inoculated with BVDV + 0.02ug / mL conventional rice extract, as a negative control; "0.02ug" is inoculated with BVDV + 0.02ug / mL recombinant OsGRFT-His extract; "0.005ug" is inoculated with BVDV + 0.005ug / mL recombinant OsGRFT-His extract. Each experimental group was set up with 3 biological replicates and 3 technical replicates, P < 0.05. The results showed that recombinant OsGRFT-His has significant antiviral activity, while conventional rice extract does not have antiviral activity. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0030] The present invention provides a plant expression vector for expressing a recombinant red algae lectin, wherein the vector contains a red algae lectin gene optimized by rice codons and an upstream signal peptide sequence optimized by rice codons. The optimized red algae lectin gene comprises a DNA molecule of SEQ ID NO.1, SEQ ID NO.3, or a DNA molecule that can hybridize with the SEQ ID NO.1 sequence and encodes red algae lectin. The red algae lectin gene is driven by a rice endosperm-specific promoter pGluC (SEQ ID NO.4) sequence to ensure a high expression level.

[0031] The present invention also provides a genetically engineered rice, which comprises the above-mentioned DNA fragment and vector, and can use enzyme-linked immunosorbent assay to identify the content of recombinant red algae lectin in the above-mentioned recombinant red algae lectin genetically engineered rice seeds, and in high-expression strains, semi-thin section-immunofluorescence and ultra-thin section-immunocolloidal gold methods can be used to detect the distribution and specific storage of the recombinant protein in endosperm cells under light microscopy and electron microscopy levels, respectively.

[0032] The present invention also provides a method for preparing recombinant red algae lectin by expressing it in rice endosperm in a genetic engineering manner, comprising the following steps:

[0033] S1. Construction of plant expression vector for expressing recombinant red algae lectin in rice seeds

[0034] The vector contains a red algae lectin gene optimized by rice codons and an upstream signal peptide sequence optimized by rice codons;

[0035] S2. Genetically transforming the vector and cultivating rice seeds

[0036] Genetically transforming rice with the expression vector described in step S1 to obtain genetically engineered rice, and cultivating genetically engineered rice seeds containing recombinant red algae lectin;

[0037] S3. Identifying the expression level and location of the recombinant protein in the rice seeds

[0038] Using the recombinant red algae lectin genetically engineered rice seeds described in step S2 to identify the expression amount of the recombinant red algae lectin protein therein, and using immunofluorescence and immunocolloidal gold methods to confirm the presence location of the recombinant red algae lectin in endosperm cells;

[0039] S4, drying, shelling and crushing the prepared rice seeds to obtain crushed materials;

[0040] S5. The crushed material was extracted with a buffer solution (50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, pH 8), and then a crude extract was obtained by a one-step affinity purification method.

[0041] The present invention also provides a method for detecting antiviral activity of the red algae lectin in the rice seeds prepared above, comprising the following steps:

[0042] S6. Detecting the antiviral activity of the crude extract obtained in S5. The antiviral activity of the crude extract can be detected by, but is not limited to, using a method of using BVDV to infect MDBK cells.

[0043] The present invention also provides a carrier containing the red algae lectin and use of rice seeds in antiviral activity detection.

[0044] [Example 1] Construction of a binary vector for endosperm-specific high expression of recombinant red algae lectin

[0045] 1. Obtaining the codon-optimized sequence of recombinant red algae lectin

[0046] Based on the published gene sequence of Griffithsin [Aspergillus lentulus] (GeneID: 54321200), the gene was optimized according to the codon preference in rice and then commissioned to GenScript Biotech Co., Ltd. for gene synthesis. The specific DNA sequence is shown in SEQ ID NO.1.

[0047] 2. Construction of binary expression vector of recombinant red algae lectin gene

[0048] A signal peptide sequence optimized for rice codons was introduced upstream of the above sequence SEQ ID NO.1 by PCR, and its DNA sequence is specifically shown as SEQ ID NO.2, and its encoding product is the 1-35 amino acids of Sporamin A precurs or [Ipomoea batatas] (GenBank: AAA33391.1), and a histidine (His) affinity tag sequence was introduced downstream to obtain the recombinant red algae lectin sequence SEQ ID NO.3 for expression in rice. In this embodiment, the rice-specific pGluC promoter was used to drive the expression of the recombinant red algae lectin gene in rice endosperm cells. The pGluC promoter (SEQ ID NO.4) was first cloned into the binary expression vector pLF1 ( Figure 1 ) between XbaI and SalI, and then clone the above recombinant red algae lectin sequence (SEQ ID NO.3) between SmaI and SacI, and name the constructed binary vector pOsGRFT ( Figure 2 ).

[0049] 3. Transfection of Agrobacterium tumefaciens for the creation of genetically engineered rice expressing recombinant red algae lectin

[0050] The pOsGRFT plasmid was transformed into Agrobacterium tumefaciens EHA105 (Invitrogen, USA) by freeze-thaw method. After sequencing, the glycerol bacteria were frozen in a -70°C refrigerator.

[0051] [Example 2] Preparation of genetically engineered rice with high expression of recombinant red algae lectin specifically in endosperm

[0052] 1. Genetic transformation of genetically engineered rice

[0053] (1) Seed disinfection: Take mature rice seeds, hull them manually or remove them, select plump, smooth and free of sterile spots, and disinfect them according to the following steps: Place the seeds in a 100mL sterile beaker and pour in 70% alcohol for 1 minute; Pour out the alcohol, add 100mL 30% sodium hypochlorite (NaClO) solution, and soak for 30 minutes; Pour out the sodium hypochlorite solution, wash the seeds with sterile distilled water 4-5 times, and soak for the last time for 30 minutes. Shake the seeds frequently during disinfection to ensure that they are fully disinfected.

[0054] (2) Induction and subculture: (The following steps require sterile operation) Place the seeds on sterile filter paper to blot dry, and place them in the induction culture medium, 12-14 seeds per dish; after the operation, seal the culture dish with sealing film and culture it in a 30℃ light incubator for 4 weeks; open the culture dish in the clean bench, pick up the naturally scattered embryonic callus tissue (light yellow, dense and spherical, with a certain hardness) with tweezers, and subculture it in a 30℃ light incubator for 1 week, and culture it in the dark for one week.

[0055] (3) Co-cultivation: Take 1 mL of the cultured pOsGRFT bacterial solution and place it in a 1.5 mL centrifuge tube. Centrifuge at 4°C, 5000 rpm for 1 min and remove the supernatant. Resuspend Agrobacterium in 30 mL AAM containing 200 μmol / L As; Pick out rice callus that has grown to a certain size and infect it with Agrobacterium suspension for 5 min; Take out the callus and place it on sterile filter paper to drain for 30-40 min; Place the callus on the co-culture medium, place a layer of 9 cm sterile filter paper on the co-culture medium, and culture it in the dark at 28°C for 3 days.

[0056] (4) Antibiotic screening of callus tissue: The callus tissue was removed and washed 6 times with sterile water with continuous shaking, then soaked in sterile water containing 500 mg / L carbenicillin (Car) for 30 min-1 h, and finally placed on sterile filter paper to drain for 2 h.

[0057] The drained callus was transferred to a selection medium containing 250 mg / L carbenicillin (Car) and 50 mg / L hygromycin for the first round of screening and cultured in a light incubator (30°C, 24 h light) for 14 days.

[0058] The obtained resistant calli were transferred to a medium containing 250 mg / L carbenicillin (Car) and 80 mg / L hygromycin for a second round of screening, cultured at 30°C under light for 10 days, and then transferred to a tissue culture room for 4 days.

[0059] The obtained resistant calli were transferred to a medium containing 250 mg / L carbenicillin (Car) and 80 mg / L hygromycin for the third round of screening and cultured in a light incubator (30°C, 24 h light) for 7 days.

[0060] (5) Induction of differentiation and rooting of resistant callus

[0061] Pick the bright yellow resistant callus and transfer it to a culture dish or differentiation tank filled with differentiation medium, seal it with sealing film, and place it in a constant temperature culture room to wait for differentiation into seedlings (30-60 days). When the seedlings grow to 7-8 cm, cut off the roots and callus grown during differentiation with scissors and place them in rooting medium to strengthen the seedlings for one to two weeks.

[0062] (6) Training and transplanting of transgenic seedlings

[0063] Pick out the seedlings with relatively complete differentiation of roots, stems and leaves from the differentiation bottle (when the seedlings grow to the top of the test tube, open the lid in time), open the sealing film, add appropriate amount of sterile water (to prevent bacteria from growing in the culture medium), harden the seedlings for 3 days, then wash off the agar, put them in tap water for three days, and screen with hygromycin at the same time. Divide the positive seedlings individually, mark them, and transplant them into soil pots in the greenhouse for growth.

[0064] 2. Molecular identification of genetically engineered rice

[0065] (1) Rice genomic DNA extraction

[0066] Take about 2 cm of leaves of T0 generation hygromycin-positive regenerated seedlings, put them into centrifuge tubes respectively, and number them; add 600 μL C CTAB extraction buffer (2% CTAB, 1.38M NaCl, 0.1M Tris-HCl, 20mM EDTA, pH8.0), add zirconium oxide particles and then crush them in a homogenizer, keep them at 65°C for 15 minutes, and shake them from time to time; add an equal volume of chloroform / isopropanol, gently invert the centrifuge tube to mix, and centrifuge at 12000rpm for 10 minutes at room temperature; transfer the supernatant to another new 1.5mL centrifuge tube, add an equal volume of pre-cooled ethanol, slowly invert the centrifuge tube to mix, and place it at room temperature for 20 minutes; centrifuge at 12000rpm for 10 minutes, remove the supernatant, rinse with 70% ethanol, and air-dry the precipitate; add 80 μL TE buffer to dissolve the air-dried DNA, and store it at -20°C for later use.

[0067] (2) PCR amplification of target gene

[0068] Take 1μL rice genomic DNA as template, use recombinant red algae lectin forward primer GF (SED ID NO.5) and reverse primer GR (SED ID NO.6) for PCR amplification, the theoretical size of the product is 475bp. PCR amplification reaction system (25μL): 2.5μL 10×Buffer, 0.15μL rTaq enzyme 5U / μL), 4μL dNT P (2.5mM), 0.5μL of each primer, add ddH2O to 25μL. PCR amplification conditions: 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 45s, 35 cycles, and finally 72℃ extension for 10min. The amplified product was subjected to 1% agarose gel electrophoresis, 200mA electrophoresis for 15min, Gel-Red staining, and the results were observed in a gel imager.

[0069] The results showed that 35 positive transgenic rice strains of recombinant red algae lectin were obtained through Agrobacterium tumefaciens-mediated transformation. The PCR identification results of some genetically engineered rice target genes were as follows: Figure 3 shown.

[0070] [Example 3] Identification of recombinant red algae lectin protein products in genetically engineered rice

[0071] 1. Identification of the expression level of recombinant red algae lectin protein product

[0072] The recombinant red algae lectin positive seedlings obtained above were transplanted into a growth chamber and grown to maturity, and the seeds of the single plants that could bear fruit normally were collected. The His Tag ELISA Detection Kit (His Tag ELISA Detection Kit, L00436, GenScript) was used for quantitative detection of the recombinant protein. 50 μL of His tag standard and rice grain crude protein extracted according to the method described in Example 4 were added to each well of the His tag plate, and 50 μL of Anti-His monoclonal antibody was added to all wells, and incubated at room temperature (20-25°C) for 30 minutes.

[0073] Wash the plate four times with 1x washing solution, adding 260 μL each time. Add 100 μL of antibody tracer to all wells, incubate at room temperature for 30 min, wash the plate four times with 1x washing solution, adding 260 μL each time. Add 100 μL of TMB substrate to all wells, incubate at room temperature for 10-15 min, add 50 μL of stop solution to all wells to stop the enzyme reaction, and read the absorbance at 450 nm using a microplate reader. Draw a standard curve with absorbance as the vertical axis and His tag standard concentration as the horizontal axis, and substituting the sample OD value into the standard curve to calculate the content of His tag recombinant protein in the sample.

[0074] The test results showed that all the recombinant red algae lectin-positive transgenic rice plants identified as positive by PCR successfully expressed the red algae lectin protein, and the expression level of recombinant red algae lectin in their seeds ranged from 189.6μg / g to 332.6μg / g.

[0075] 2. Detection of the distribution of recombinant red algae lectin protein products in endosperm

[0076] (1) Semi-thin sections and immunofluorescence labeling of recombinant red algae lectin

[0077] Rice endosperm was placed in fixative at 4°C overnight, rinsed three times with phosphate buffer, dehydrated with 30%, 50%, and 70% ethanol solutions (2h each), and then replaced with 70% ethanol:LR White (2:1) and 70% ethanol:LR White (1:2) for 6h each, replaced with 100% LR White resin at 4°C overnight, polymerized under UV irradiation at -20°C for 4d, sliced ​​with a Leica UC7 microtome (thickness 1μm), transferred to new slides with a slicing ring, and baked at 40°C for 30min.

[0078] A small amount of TBST was added with a pipette to wet the sections for 10 min, and then blocking solution (3% BSA in TBST) was added to block for 1 h. The blocking solution was removed, and His fluorescent antibody (abcam, ab3554) (1:100) diluted with 1% BSA in TBST was added, and the sections were incubated in a 37°C constant temperature incubator for 2 h. The sections were washed 6 times with TBST on a shaker, each time for 5 min, and observed and photographed using a Zeiss LSM710 laser confocal microscope ( Figure 4 ).

[0079] (2) Transmission electron microscopy observation and immuno-colloidal gold labeling of recombinant red algae lectin

[0080] The rice endosperm was placed in the fixative at 4°C overnight, rinsed with phosphate buffer for 3 times, dehydrated with 50%, 70%, 80%, and 90% acetone in a gradient manner (2 h each), replaced with resin: acetone (3:1), resin: acetone (1:1), and resin: acetone (1:3), respectively, treated with 100% Epon812 resin for more than 10 h, polymerized at 37°C for 24 h, 45°C for 24 h, and 60°C for 72 h, cut into 70 nm slices with an ultrathin slicer, and the slices were scooped out onto a grid.

[0081] The nickel mesh was first blocked with PBS containing 1% BSA for 1 h, then 30 μL of His antibody (abcam, ab18184) (1:100) diluted with PBS containing 1% BSA was added to the paraffin sealing film and incubated for 2 h, then washed 3 times with PBS containing 1% BSA, 30 μL of gold-labeled secondary antibody (1:100) diluted with PBS containing 1% BSA was added to the paraffin sealing film and incubated for 1 h, then washed 3 times with PBS containing 1% BSA, and the sections were stained with uranyl acetate and lead citrate, and observed and photographed using a Hitachi H7650 transmission electron microscope ( Figure 5 ).

[0082] [Example 4] Extraction of crude recombinant red algae lectin from genetically engineered rice

[0083] Mature rice seeds were ground into fine powder and extracted in five volumes of solubilization buffer (50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, pH 8) at 4°C overnight. Insoluble impurities were removed by centrifugation twice at 8000 g for 30 min each at 4°C.

[0084] Each sample was loaded onto an affinity chromatography column (filler: Profinity TM IMAC Resin, Ni-charged, 10 ml #1560131 Bio-Rad). The column was washed with washing buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8), and then eluted with elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8) to obtain recombinant protein.

[0085] The eluted protein was subjected to SDS-PAGE gel electrophoresis using a small electrophoresis tank from Bio-Rad, with a gel concentration of 15%. After the electrophoresis, the membrane was transferred using a transfer device from Bio-Rad. After the transfer, the PVDF membrane was rinsed with PBS and placed in a blocking solution (5% skim milk powder dissolved in PBS), blocked on a shaker for 1 hour, rinsed with PBST, and then placed in a primary antibody (abcam, ab18184) solution diluted with blocking solution, incubated on a shaker for 2 hours, then rinsed the PVDF membrane 3 times with PBST, each time for 5 minutes, placed in an HRP-labeled secondary antibody solution diluted with blocking solution, incubated on a shaker for 1 hour, then rinsed the PVDF membrane 6 times with PBST, and used an ECL chemiluminescence kit (Tanon) to detect the recombinant red algae agglutinin protein in the crude extract ( Figure 6 ).

[0086] [Example 5] Verification of the antiviral activity of crude rice recombinant red algae lectin

[0087] 1. Cultivation of MDBK cells and BVDV

[0088] MDBK cell passaging: MDBK cells with clear cell outlines, good condition, and about 90% fusion are passaged. Preheat PBS and 8% FBS DMEM medium in advance. In the biosafety cabinet, discard the medium in the culture bottle, add 5mL PBS to gently rinse the bottle wall, and repeat 3 times. Pour out the PBS, add 1mL trypsin digestion solution, incubate at 37℃ for about 30s, and observe the cell edges shrinking and rounding under an inverted microscope. At this time, pour out the trypsin and add 5mL 8% FBSDMEM medium to terminate digestion. Use a pipette to gently blow to completely disperse the cells, mix well, and divide into cell culture bottles, and culture in a 37℃ 5% CO2 incubator. After about 48h, the cells can be passaged again.

[0089] Proliferation of BVDV: BVDV virus solution was inoculated into 80% confluency monolayer MDBK, and after infection for 1 hour, DMEM medium containing 3.5% horse serum was added, and the virus was harvested after continued culture for 72 hours. The culture was repeatedly frozen and thawed 3 times, and the supernatant was collected by centrifugation at 4000 rpm for 15 minutes at 4°C, and stored at -80°C for later use after aliquoting.

[0090] 2. Cell infection and sample collection

[0091] MDBK cells were infected with BVDV virus solution at a multiplicity of infection of 1 MOI. The specific operation was as follows:

[0092] (1) MDBK cells in the logarithmic growth phase were placed in a 6-well plate and 1×10 6 The cells were cultured in a 37°C 5% CO2 incubator;

[0093] (2) When the cell confluence was about 70%, the old culture medium was discarded and the MDBK cells were inoculated with 1 MOI of BVDV virus solution. Four experimental groups were set up, namely: Group 1, BVDV; Group 2, BVDV + 0.02ug / mL conventional rice extract; Group 3, BVDV + 0.02ug / mL recombinant red algae lectin crude extract; Group 4, BVDV + 0.005ug / mL recombinant red algae lectin crude extract. The well plate was placed in a 37°C 5% CO2 incubator, and cell samples were collected for virus detection 36h after virus infection.

[0094] 3. Indirect immunofluorescence assay (IFA) for BVDV detection

[0095] Fix the cells with pre-cooled (4°C) 4% paraformaldehyde for 15 minutes, then discard the fixative and wash three times with sterile PBS. Add 0.5% Triton X-100 / PBS to permeabilize the cells for 8 minutes and wash three times with PBS. Add 5% skim milk powder to block at 37°C for 1 hour, discard the blocking solution, wash three times with PBS, add bovine viral diarrhea mucosal disease positive serum, and incubate at 37°C for 1 hour. Wash three times with PBS, add Goat Anti-Bovine IgG (H+L)-FITC and incubate at 37°C for 1 hour, wash three times with PBS, and observe under an inverted fluorescence microscope ( Figure 7 ).

[0096] 4. RT-qPCR test for BVDV

[0097] Total RNA in cells was extracted with TRIzon Reagent and reversed to form cDNA. Using cDNA as a template, qPCR was performed according to the following system: TB Green Premix Ex Taq II (Tl i RNaseH Plus) (2×), 12.5uL; front primer, rear primer, 1uL each; cDNA, 1uL; RNase Free dH2O, 9.5uL.

[0098] According to the BVDV 5'-UTR sequence in Genbank, specific primers for amplifying BVDV 5'-UTR were designed using Primer Premier 5.0 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The viral primers were 5'UTR-F (SEQ ID NO.7) and 5'UTR-R (SEQ ID NO.8). The internal reference primers were GAPDH-F (SEQ ID NO.9) and GAPDH-R (SEQ ID NO.10). The reaction procedure was as follows: 95℃30s; 95℃5s, 58℃30s, and the reaction was carried out for 40 cycles. Figure 8 )

[0099] The sequences involved in this application are as follows:

[0100] SEQ ID NO.1

[0101] ATGTCCTTGACCCACAGAAAATTCGGAGGCTCTGGGGGTTCCCCTTTCTCTGGGCTCTCTTCCATTGCTGTTAGGTCCGGTAGCTACCTTGATGCCATTATCATTGATGGAGTGCATCACGGAGGCAGCGGGGGTAACTTGTCTCCCACATTCACTTTTGGATCCGGCGAATATATCAGCAATATGACCATTAGAAGCGGCGATTACATCGATAACATTTCTTTCGAGACAAATATGGGAAGAAGGTTTGGCCCTTATGGAGGCTCTGGGGGTTCTGCAAACACATTGTCTAACGTTAAGGTTATTCAAATTAACGGGTCTGCTGGAGATTACCTCGATTCCCTTGATATCTATTACGAGCAGTATTGA

[0102] SEQ ID NO.2

[0103] ATGAAGGCTTTCACTCTTGCCTTGTTTCTCGCACTTTCCTTGTATTTGCTCCCTAACCCAGCCCATAGCAGATTCAATCCCATCAGGCTTCCTACTACCCATGAA

[0104] SEQ ID NO.3

[0105] ATGAAGGCTTTCACTCTTGCCTTGTTTCTCGCACTTTCCTTGTATTTGCTCCCTAACCCAGCCCATAGCAGATTCAATCCCATCAGGCTTCCTACTACCCATGAATCCTTGACCCACAGAAAATTCGGAGGCTCTGGGGGTTCCCCTTTCTCTGGGCTCTCTTCCATTGCTGTTAGGTCCGGTAGCTACCTTGATGCCATTATCATTGATGGAGTGCATCACGGAGGCAGCGGGGGTAACTTGTCTCCCACATTCACTTTTGGATCCGGCGAATATATCAGCAATATGACCATTAGAAGCGGCGATTACATCGATAACATTTCTTTCGAGACAAATATGGGAAGAAGGTTTGGCCCTTATGGAGGCTCTGGGGGTTCTGCAAACACATTGTCTAACGTTAAGGTTATTCAAATTAACGGGTCTGCTGGAGATTACCTCGATTCCCTTGATATCTATTACGAGCAGTATCATCACCATCACCATCACTGA

[0106] SEQ ID NO.4

[0107]

[0108] SEQ ID NO.5

[0109] CACTCTTGCCTTGTTTCTCG

[0110] SEQ ID NO.6

[0111] GTGATGGTGATGGTGATGAT

[0112] SEQ ID NO.7

[0113] GTAGTCGTCAGTGGTTCGAC

[0114] SEQ ID NO.8

[0115] TCAACTCCATGTGCCATGTAC

[0116] SEQ ID NO.9

[0117] TTCAACGGCACAGTCAAGGCA

[0118] SEQ ID NO.10

[0119] CCACCACATACTCAGCACCAGC

[0120] The principle of the present invention is: the present invention utilizes rice endosperm cells to successfully and efficiently express recombinant OsGRFT protein. System detection shows that it has the advantages of high expression level, easy purification, high biological activity, etc. It is a green, safe and easy-to-scale red algae lectin expression and production solution.

[0121] The above shows and describes the basic principle, main features and advantages of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention claimed.

Claims

1. A binary expression vector for rice endosperm-specific high expression of recombinant red algae lectin, characterized in that: The vector contains a recombinant red algae lectin gene optimized by rice codons and a promoter for driving the recombinant red algae lectin gene. The sequence of the recombinant red algae lectin gene is shown in SEQ ID NO.3, and the sequence of the promoter is shown in SEQ ID NO.

4.

2. Use of the binary expression vector for rice endosperm-specific high expression of recombinant red algae lectin as claimed in claim 1 in antiviral treatment, characterized in that: The virus is BVDV virus.

Images