A genetically engineered bacterium capable of highly producing indole-3-lactic acid, and a construction method and application thereof

Abstract

The present invention belongs to the field of bioengineering technology, and specifically relates to a genetically engineered bacterium capable of highly producing indole-3-lactic acid, and a construction method and application thereof. By means of genetic engineering, the present invention uses the pRSFDuet-1 plasmid as a vector to construct a genetically engineered bacterium expressing D-lactate dehydrogenase in Escherichia coli BL21; the genetically engineered bacterium can be used for metabolizing tryptophan to prepare ILA; the present invention effectively improves the conversion efficiency of ILA through induction with isopropyl-D-thiogalactoside, and has good application prospects. The present invention applies the obtained genetically engineered bacterium to an ovarian premature failure model and finds that it has the effect of protecting ovarian function, and the genetically engineered bacterium has the effect of promoting tumor immunotherapy in vivo.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a genetic engineering bacterium capable of producing high amounts of indole-3-lactic acid, a construction method and an application thereof. Background Art

[0002] There are three main pathways for the decomposition of tryptophan: kynurenine, 5-hydroxytryptamine, and indole. The indole metabolic pathway only exists in microorganisms. Indole and its derivatives are currently a hot topic of research. They are involved in the regulation of the functions of various systems in the body and maintain the health of the body. Indole-3-lactic acid (ILA) is a part of the tryptophan indole metabolic pathway and has been found to have anti-inflammatory, anti-cancer, and intestinal homeostasis-maintaining effects.

[0003] Pure D-lactate dehydrogenase can only catalyze the conversion of ILA precursors into ILA, but cannot be prepared using tryptophan as a raw material, which is costly. The method of using pure enzymes to chemically catalyze tryptophan to prepare ILA in vitro requires the participation of multiple metabolic enzymes. In addition, pure enzymes have the disadvantages of being easily inactivated, unstable, and having a cumbersome purification process. Although the stability and reusability of the enzymes can be enhanced by immobilizing them, this undoubtedly increases the production cost.

[0004] The whole-cell catalytic method directly utilizes resting cells containing enzymes to catalyze the synthesis of substrates to prepare the target product. This method makes the enzyme more stable and the preparation method is simpler. Therefore, using resting cells as catalysts is more in line with the needs of industrial development.

[0005] The present invention constructs a new genetically engineered bacterium with high ILA production, which can be induced by isopropyl-D-thiogalactoside to efficiently express lactate dehydrogenase, and directly metabolize tryptophan into ILA using tryptophan as a substrate, thereby greatly improving the production efficiency of ILA. The present invention can prepare ILA by a whole-cell catalytic method, providing a new method for preparing ILA.

[0006] In addition, indole can interact with the intestinal microbiota to affect human health. ILA has been reported to alleviate DSS-induced colitis by inhibiting the expression of CCL2 / 7 in intestinal epithelial cells and reducing the accumulation of pro-inflammatory macrophages during colitis. In addition, ILA can accelerate the production of interleukin-12 by dendritic cells and activate CD8 + T cells, while reducing CD8 + Cholesterol levels in T cells enhance tumor-infiltrating CD8 + T cell function, thereby inhibiting tumor growth.

[0007] The present application also provides two in vivo applications of the above-mentioned genetically engineered bacteria with high ILA production, thereby regulating the health of the body by supplementing the engineered bacteria. Summary of the Invention

[0008] Aiming at the deficiencies existing in the prior art, the present invention provides a genetically engineered bacterium capable of highly producing ILA, its construction method and application. Using this genetically engineered bacterium can efficiently produce ILA with tryptophan as a substrate, providing a new approach.

[0009] The genetically engineered bacterium is Escherichia coli capable of expressing D-lactate dehydrogenase, and the D-lactate dehydrogenase is expressed intracellularly;

[0010] Preferably, the gene of the D-lactate dehydrogenase is derived from Lactobacillus johnsonii;

[0011] Furthermore, the D-lactate dehydrogenase can be induced to highly express by isopropyl-D-thiogalactoside, and the induction concentration range of isopropyl-D-thiogalactoside is 0-1.0 mmol / L, and the preferred concentration is 0.5 mmol / L.

[0012] The present invention also provides a construction method of the above-mentioned genetically engineered bacterium capable of highly producing ILA, which specifically includes the following steps:

[0013] Using the coding gene ldhA of D-lactate dehydrogenase as a template for PCR amplification, using the pRSFDuet-1 plasmid as a vector to construct a recombinant plasmid pRSFDuet-1-ldhA with the ldhA fragment; then transforming the recombinant plasmid pRSFDuet-1-ldhA into Escherichia coli BL21 competent cells, screening positive clones and sequencing to successfully obtain the engineered bacterium BL21 / pRSFDuet-1-ldhA expressing D-lactate dehydrogenase.

[0014] The nucleotide sequence of the coding gene ldhA of the D-lactate dehydrogenase is shown in SEQ ID NO.1; the amino acid sequence of the D-lactate dehydrogenase is shown in SEQ ID NO.2;

[0015] Preferably, the nucleotide sequence of the primer pair used for the PCR amplification is:

[0016] ldhA-F: GCTGAGCCATGGGCATGACAAAGATTTTTGCTTACG (SEQ ID NO.3);

[0017] ldhA-R: GGACGTGGATCCTTAGAACTTGTTCTTGTCCA (SEQ ID NO.4);

[0018] Preferably, the PCR reaction program is as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 15 s; annealing at 65°C for 30 s; extension at 72°C for 1 min; final extension at 72°C for 5 min, with 35 cycles;

[0019] Preferably, the construction scheme of the pRSFDuet-1-ldhA recombinant plasmid is as follows: Use NcoI (Thermo, FD0578) and BamHI (Thermo, FD0054) restriction endonucleases to cut the ldhA gene and the pRSFDuet-1 plasmid to obtain sticky ends, and then use T4 DNA ligase (Thermo, EL0011) for ligation to obtain the pRSFDuet-1-ldhA recombinant plasmid.

[0020] The present invention also provides the application of the above-mentioned genetically engineered bacterium capable of highly producing ILA in the preparation of ILA by metabolizing tryptophan, and provides a new method for producing indole-3-lactic acid, including: preparing the above-mentioned genetically engineered bacterium into pure enzyme or resting cells, using tryptophan as a substrate, and chemically catalyzing tryptophan with the pure enzyme or catalyzing tryptophan to synthesize indole-3-lactic acid with the resting cells.

[0021] Preferably, the steps of preparing the genetically engineered bacterium with high ILA production into resting cells and using it for metabolizing tryptophan to prepare ILA include:

[0022] (1) Preparation of resting cells;

[0023] Inoculate the above-mentioned genetically engineered bacterium (BL21 / pRSFDuet-1-ldhA) into LB medium for culture to obtain resting cells of Escherichia coli engineered bacteria producing ILA;

[0024] (2) High-efficiency expression of D-lactate dehydrogenase;

[0025] Inoculate the resting cells of the above-mentioned Escherichia coli engineered bacteria producing ILA into LB medium containing 0.5 mmol / L isopropyl-D-thiogalactoside and culture for 4 hours, then centrifuge and collect to obtain resting cells of Escherichia coli engineered bacteria with high ILA production;

[0026] (3) Preparation of ILA;

[0027] Inoculate the genetically engineered bacterium (BL21 / pRSFDuet-1-ldhA) with high ILA production obtained in step (2) into LB medium containing tryptophan, and metabolically convert it to generate ILA.

[0028] The present invention also provides the application of the above-mentioned genetically engineered bacterium in the preparation of drugs for improving ovarian function. Especially in the preparation of drugs for anti-ovarian premature failure.

[0029] The drug described above includes a drug carrier and / or a pharmaceutically acceptable excipient; the dosage forms of the drug include pills, tablets, powders, capsules, granules, suspensions, injections, oral liquids, enemas or tube feeding preparations.

[0030] The present invention also provides the use of the above-mentioned genetically engineered bacteria in the preparation of drugs for promoting tumor immunotherapy.

[0031] Preferably, the immunotherapy includes, but is not limited to, anti-PD-1 antibody therapy;

[0032] Preferably, the tumors include, but are not limited to, colorectal cancer, breast cancer and melanoma.

[0033] The present invention has at least the following advantages and beneficial effects:

[0034] By means of genetic engineering, Escherichia coli EL21 is used as an expression system for the biological preparation of ILA in this technology, and the gene operation becomes relatively reliable with simple culture conditions. The promoter of the plasmid pRSFDuet-1 used in the present invention is the T7 inducible promoter of traditional Escherichia coli, which can effectively improve the expression of D-lactate dehydrogenase by adding isopropyl-D-thiogalactoside as an inducer, realizing the production of ILA using tryptophan as a substrate and increasing the production efficiency of ILA. The genetically engineered bacteria prepared in the present invention are applied to the premature ovarian failure model, effectively protecting ovarian function, and the provided genetically engineered bacteria also have the effect of promoting tumor immunotherapy in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 PCR amplification of the D-lactate dehydrogenase encoding gene ldhA in Example 1; the figure shows the DNA nucleic acid electrophoresis results of the PCR product of the D-lactate dehydrogenase encoding gene ldhA.

[0036] Figure 2 Construction of the pRSFDuet-1-ldhA recombinant plasmid in Example 2; among them, Figure A shows the nucleic acid electrophoresis results of the pRSFDuet-1-ldhA recombinant plasmid; Figure B shows the sequencing results of the target gene ldhA of the pRSFDuet-1-ldhA recombinant plasmid.

[0037] Figure 3 Isopropyl-D-thiogalactoside induces the high expression of D-lactate dehydrogenase in Example 3, and the figure shows the SDS-PAGE results of the lysate of the BL21 / pRSFDuet-1-ldhA engineering bacteria;

[0038] Figure 4For the metabolic conversion of tryptophan to ILA by the genetically engineered bacterium (BL21 / pRSFDuet-1-ldhA) in Example 4, the figure shows the ILA levels in the media of BL21 / pRSFDuet-1-ldhA and wild-type BL21 detected by mass spectrometry.

[0039] Figure 5 For the protective effect of the genetically engineered bacterium (BL21 / pRSFDuet-1-ldhA) on ovarian function in Example 5, where Figure A is a schematic diagram of the intervention mode; Figure B is the ovarian index of three groups of mice; Figure C is the change in estradiol levels in three groups of mice; Figure D is the change in follicle-stimulating hormone levels in three groups of mice; Figure E is the change in anti-Müllerian hormone levels in three groups of mice; Figure F is the HE staining of ovaries in three groups of mice; Figure G is the statistical chart of primordial follicles in three groups of mice; Figure H is the statistical chart of preantral follicles in three groups of mice; Figure I is the statistical chart of antral follicles in three groups of mice; Figure J is the statistical chart of atretic follicles in three groups of mice.

[0040] Figure 6 For the sensitization of colorectal cancer immunotherapy by the genetically engineered bacterium (BL21 / pRSFDuet-1-ldhA) in Example 6, the figure shows the growth curve of subcutaneous tumors in mice. Detailed implementation manners

[0041] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The given embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention.

[0042] Example 1: PCR amplification of the D-lactate dehydrogenase-encoding gene ldhA

[0043] Using a bacterial genomic DNA extraction kit (Tiangen kit - DP302), extract the genomic DNA of Lactobacillus johnsonii according to the protocol described in the instruction manual. Using the genomic DNA of Lactobacillus johnsonii as a template, amplify the ldhA gene by ordinary PCR using the ldhA-related primers ldhA-F and ldhA-R, and make it carry the restriction endonuclease cleavage sites of NcoI and BamHI. Electrophorese the obtained PCR product by DNA electrophoresis, and then cut and recover the electrophoresis band at the corresponding molecular weight position. Use a gel recovery kit (Tiangen kit - DP214) to separate and purify the PCR product to obtain a large amount of ldhA gene containing the cleavage sites.

[0044] The results are as Figure 1 shown. The size of the ldhA gene is approximately 1 kbp, and the size of the amplified band can be seen by DNA electrophoresis of the ordinary PCR product, which is consistent with the size of the ldhA gene.

[0045] Example 2: Construction of the pRSFDuet-1-ldhA recombinant plasmid

[0046] Using the restriction endonucleases NcoI (Thermo, FD0578) and BamHI (Thermo, FD0054), the ldhA gene and the pRSFDuet-1 plasmid were digested according to the instructions. The digested ldhA gene and pRSFDuet-1 plasmid were separated and purified using the above DNA nucleic acid electrophoresis and gel extraction and recovery techniques. Then, the two fragments were ligated according to the instructions of T4 DNA ligase (Thermo, EL0011). The ligation product was transformed into DH5α and cultured with shaking in LB medium at 37°C for 1 hour to activate the DH5α / pRSFDuet-1-ldhA bacteria, which were then spread on an LB plate with kanamycin resistance. After 24 hours, 6 monoclonal colonies were randomly selected, inoculated into LB liquid medium for expansion culture, the plasmid was extracted using a plasmid mini-prep kit (Tiangen), and the obtained plasmid was digested with NcoI (Thermo, FD0578) and BamHI (Thermo, FD0054), followed by DNA nucleic acid electrophoresis to observe whether a ldhA gene band of about 1 kbp appeared. Finally, the plasmid was sequenced and compared with the ldhA gene sequence to verify whether the pRSFDuet-1-ldhA recombinant plasmid was successfully constructed.

[0047] The results are as Figure 2 shown. The size of the ldhA gene is approximately 1 kbp, and the size of the plasmid vector is approximately 3.8 kbp. Figure A shows the DNA nucleic acid electrophoresis results of pRSFDuet-1-ldhA digested with NcoI and BamHI. It can be seen that the sizes of the plasmid bands of No. 1, 2, 3, 5, and 6 after digestion are consistent with the sizes of the ldhA gene and the plasmid vector, while the No. 4 plasmid does not meet the expectations. Therefore, the plasmids of No. 1, 2, 3, 5, and 6 were sequenced and compared. Figure B shows the sequencing and comparison results of No. 1, 2, 3, 5, and 6, indicating that there is a nucleotide point mutation in the comparison of the sequences of No. 1 and 2 plasmids with the ldhA gene, and the sequences of No. 3, 5, and 6 plasmids are identical to the ldhA gene. Therefore, the plasmids of No. 3, 5, and 6 were selected for subsequent experiments.

[0048] Example 3: High-level expression of D-lactate dehydrogenase induced by isopropyl-D-thiogalactoside

[0049] The plasmid obtained above was transformed into BL21 competent cells by heat shock method, shaken and cultured in LB medium at 37 °C for 1 hour to activate BL21 / pRSFDuet-1-ldhA bacteria, and then spread on an LB plate with kanamycin resistance. After 24 hours, single colonies were selected and cultured in liquid LB medium for expansion. When the culture density reached 0.6 OD / mL, isopropyl-D-thiogalactoside with concentrations of 0, 0.25 mmol / L, 0.5 mmol / L, 0.75 mmol / L, and 1.0 mmol / L was added respectively. After co-culturing for 4 hours, the bacteria were collected by centrifugation, and a bacterial lysate suspension was obtained by ultrasonic lysis. Then, it was resuspended and mixed with 5×loading buffer and boiled in a boiling water bath for 10 minutes. The obtained protein samples were subjected to protein gel electrophoresis, and then stained with Coomassie Brilliant Blue to show the overall protein level in the bacteria.

[0050] The results are as Figure 3 shown. The D-lactate dehydrogenase encoded by the ldhA gene is about 38 kDa in size. It was detected by SDS-PAGE that the D-lactate dehydrogenase encoded by the ldhA gene was also expressed at a certain level without the addition of isopropyl-D-thiogalactoside, while the expression level of the D-lactate dehydrogenase encoded by the ldhA gene increased significantly after the addition of isopropyl-D-thiogalactoside. Since the changes at 0.25 mmol / L and 0.5 mmol / L were not obvious, we chose to use 0.5 mmol / L of isopropyl-D-thiogalactoside to induce the high-level expression of D-lactate dehydrogenase.

[0051] Example 4: Metabolic conversion of tryptophan to ILA by genetically engineered bacteria (BL21 / pRSFDuet-1-ldhA)

[0052] The genetically engineered bacteria BL21 / pRSFDuet-1-ldhA after high-level expression of D-lactate dehydrogenase induced by isopropyl-D-thiogalactoside obtained above were inoculated into tryptophan broth and cultured for 24 hours. Then, the culture supernatant was obtained by centrifugation and extracted with methanol. The level of ILA in the culture supernatant was detected by a mass spectrometry instrument.

[0053] The results are as Figure 4 shown. The genetically engineered bacteria (BL21 / pRSFDuet-1-ldhA, E.c-ldhA) showed significantly enhanced metabolic conversion of tryptophan to ILA compared with the control engineered bacteria (BL21 / pRSFDuet, E.c) transfected with the wild-type plasmid.

[0054] Example 5: Protective effect of genetically engineered bacteria (BL21 / pRSFDuet-1-ldhA) on ovarian function

[0055] 1. After weighing the mice at 6 - 8 weeks of age, they were intraperitoneally injected with cyclophosphamide (75 mg / kg) once, or an equal volume of normal saline was injected as a control.

[0056] 2. The above - mentioned mice were pre - treated with a combination of antibiotics (freely drinking water containing four antibiotics, namely drinking water containing 0.2 mg / mL ampicillin, 0.2 mg / mL metronidazole, 0.2 mg / mL neomycin, and 0.1 mg / mL vancomycin) for 1 week to preliminarily eliminate the resident intestinal flora.

[0057] 3. After 1 week, the mice were divided into three groups, namely the Con group (normal control group, n = 8), the E.c+Pof group (ovarian premature aging mice group intervened with empty engineered bacteria, n = 8), and the E.c - ldhA+Pof group (ovarian premature aging mice group intervened with the genetically engineered bacteria of the present invention, n = 8). The dose was 1×10 9 CFU / mouse or an equal volume of PBS solution, and the gavage volume was 200 μL, and gavage was performed every day.

[0058] 4. After 1 - month intervention, mouse serum and ovarian samples were collected for the evaluation of ovarian function.

[0059] 5. Ovarian index = ovarian weight (mg) / mouse body weight (g)×100%.

[0060] 6. Observation of ovarian tissue morphology and follicle counting

[0061] The left ovarian tissue of the mice was isolated, fixed with 4% paraformaldehyde at room temperature, then embedded in paraffin for sectioning. Then, the serial sections of the mouse ovarian tissue were dewaxed in xylene and hydrated with a series of graded alcohols and then stained with H&E.

[0062] a. Primordial follicle (Pmo): The intact oocyte is surrounded by a single layer of flattened granulosa cells.

[0063] b. Pre - antral follicle (Pre): The intact oocyte is surrounded by a single layer of cubic granulosa cells or the number of granulosa cell layers is 2 or more (including 2 layers) and less than 7 layers, and there is no obvious antrum.

[0064] c. Antral follicle (Ant): There is an obvious oocyte, and the number of granulosa cell layers is 7 or more (including 7 layers), and an antrum can be seen.

[0065] d. Atretic follicle (Are): The oocyte shrinks and the granulosa cells are disorderly arranged.

[0066] 7. Estradiol (E2, E - OSEL - M0008), follicle - stimulating hormone (FSH, E - EL - M0511), and anti - Müllerian hormone (AMH, E - EL - M3015) were detected by the Elisa kit from Elabscience.

[0067] Results Figure 5 In A, it is a diagram of the intervention mode of the genetically engineered bacterium (BL21 / pRSFDuet - 1 - ldhA, E.c - ldhA) and the control engineered bacterium transfected with the wild - type plasmid (BL21 / pRSFDuet, E.c) on premature ovarian failure mice. The control group is mice with normal ovarian function; as Figure 5 shown in B, cyclophosphamide can cause a decrease in ovarian index compared to normal mice, and the genetically engineered bacterium of the present invention can rescue the decrease in ovarian index induced by cyclophosphamide; as Figure 5 shown in C - E, the genetically engineered bacterium of the present invention can increase the levels of AMH and E2 in premature ovarian failure mice and decrease the FSH level. The genetically engineered bacterium of the present invention can rescue the disorder of hormone level secretion induced by cyclophosphamide; as Figure 5 shown in F, it is a HE staining diagram of the ovaries of three groups of mice; as Figure 5 shown in G - J, cyclophosphamide can cause abnormal development of ovarian follicles in mice. The intervention of the genetically engineered bacterium of the present invention can rescue the number of primordial follicles, pre - antral follicles, and antral follicles in premature ovarian failure mice, and at the same time decrease the number of atretic follicles in premature ovarian failure mice. The above results indicate that the genetically engineered bacterium provided by the present invention has an obvious protective effect on ovarian function and can effectively resist premature ovarian failure.

[0068] Example 6: Sensitization of colorectal cancer immunotherapy by genetically engineered bacterium (BL21 / pRSFDuet - 1 - ldhA)

[0069] Six - week - old male C57BL / 6 mice were randomly divided into 2 groups, with 9 mice in each group. Before mouse modeling, the mice were allowed to freely drink water containing 2 mg / mL metronidazole, 2 mg / mL penicillin, 2 mg / mL streptomycin, and 1 mg / mL vancomycin for 1 week to preliminarily clear the intestinal flora, which is beneficial for the colonization of transplanted bacteria. After clearing the flora, PBS and the genetically engineered bacterium of the present invention (BL21 / pRSFDuet - 1 - ldhA, E.c - ldhA) were respectively given by gavage at a dose of 1×10 9 CFU / mouse, with a gavage volume of 200 μL once a day. After 7 days of gavage, 2×10 6MC38 cells were injected subcutaneously into mice (100 μL per mouse). Ten days after injection, each mouse was intraperitoneally injected with anti-PD-1 antibody (100 μg per mouse, purchased from BioXcell, Cat# BE0273; reactive species: Mouse; clone number: 29F.1A12; isotype: RatIgG2a; immunogen: Recombinant PD-1-Ig fusion protein), and the injection was given every two days. The tumor volume was monitored every two days, and the calculation formula was as follows: volume = 0.54 × L × W2, where L was the longest diameter and W was the shortest diameter. The experiment was terminated the day after the third injection of PD-1 treatment, and the tumor volume was recorded and statistically analyzed.

[0070] The results are as Figure 6 shown. Supplementing the genetically engineered bacteria of the present invention (BL21 / pRSFDuet-1-ldhA, E.c-ldhA) can significantly increase the efficacy of anti-PD-1 antibody in colorectal cancer, reduce the tumor burden, and slow down tumor growth.

[0071] The above specific embodiments are used to explain and illustrate the present invention. They are only the preferred embodiments of the present invention and do not limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and scope of the protection of the claims of the present invention fall within the protection scope of the present invention.

Claims

1. Use of a genetically engineered bacterium capable of producing high amounts of indole-3-lactic acid and an anti-PD-1 antibody in the preparation of a drug for promoting tumor immunotherapy, wherein the tumor is colon cancer, the immunotherapy is anti-PD-1 antibody therapy, the genetically engineered bacterium is Escherichia coli BL21 containing a gene encoding D-lactate dehydrogenase, the D-lactate dehydrogenase is expressed intracellularly, the gene encoding D-lactate dehydrogenase is derived from Lactobacillus johnsonii, and the nucleotide sequence of the gene encoding D-lactate dehydrogenase is shown in SEQ ID NO.1.

Images