Recombinant escherichia coli capable of enhancing nadph supply and construction method and application thereof

By overexpressing the relevant gene in E. coli to enhance NADPH supply, the problem of insufficient endogenous NADPH was solved, thereby improving the production efficiency of coumaric acid and reducing production costs.

CN118109379BActive Publication Date: 2026-06-19YANGZHOU UNIV +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2024-03-04
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

The existing technology has insufficient endogenous NADPH supply in Escherichia coli, which cannot meet the demand for efficient synthesis of coumaric acid, and the cost of adding exogenous cofactor NADPH is high.

Method used

Recombinant Escherichia coli was constructed, and NADPH supply was enhanced by overexpressing genes such as NAD kinase (ppnk), NADH kinase (pos5), 6-phosphogluconate dehydrogenase (gnd), soluble pyridine nucleotide transhydrogenase (udhA), or glucose-6-phosphate dehydrogenase (zwf). C4H and ATR2 were co-expressed in the recombinant strain to improve electron transport efficiency.

Benefits of technology

It significantly increased the intracellular NADPH concentration, enhanced the production efficiency of coumaric acid, and achieved low cost and high conversion efficiency, increasing the yield of coumaric acid by 29.1%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118109379B_ABST
    Figure CN118109379B_ABST
Patent Text Reader

Abstract

This invention discloses a recombinant bacterial strain that enhances NADPH supply, its construction method, and its applications. This invention also discloses a method for producing coumaric acid. This invention establishes a strategy to enhance the supply of the intracellular cofactor NADPH and uses it to improve the production of coumaric acid by overexpressing NAD kinase (NADPH) in *E. coli*. ppnk The intracellular NADPH level increased by 13.93-fold, and the yield of p-coumaric acid increased from 36.23 mg / L to 58.41 mg / L. This cofactor engineering, through overexpression of the ppnk gene, increased the yield of p-coumaric acid by 29.1%. This strategy features high transformation efficiency, low production cost, and broad prospects for industrial application, demonstrating that increasing the NADPH supply in *E. coli* can significantly improve the synthesis efficiency of NADPH-dependent natural products such as p-coumaric acid, and has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a recombinant Escherichia coli that can enhance NADPH supply, its construction method, and its application. Background Technology

[0002] p-Coumaric acid (p-CA) is a phenylpropionic acid derived from aromatic amino acids. It is widely distributed in many plants and the human diet, possessing various medicinal values. p-Coumaric acid can also be converted into different phenolic acids, thus giving it significant market value. Plant extraction and chemical synthesis of p-Coumaric acid are costly and inefficient, while microbial fermentation offers low cost and high efficiency. Therefore, the production of p-Coumaric acid through microbial fermentation is attracting increasing attention.

[0003] There are two pathways for the synthesis of p-coumaric acid: one is the deamination of tyrosine by tyrosine ammonia-lyase to produce p-coumaric acid, and the second is the generation of p-CA from L-phenylalanine by the action of tyrosine ammonia-lyase and cinnamate-4-hydroxylase. In the p-coumaric acid biosynthetic pathway, NADPH / NADP... + Redox cofactors play crucial roles in biochemical reactions and physiological functions. C4H enzymes, members of the CYP73A subfamily of cytochrome P450 enzymes, are mainly distributed in plants and exhibit high specificity for trans-cinnamic acid. Their catalytic reactions require redox chaperones (CPRs, such as ATR2 from Arabidopsis thaliana) to donate electrons for hydroxylation, with NADPH acting as a key electron donor.

[0004] Based on previous research, different strategies can be used to increase intracellular NADPH levels. These strategies include: overexpression of endogenous NADPH-related synthases or knockout of competitive pathway enzymes; introduction of exogenous metabolic pathways to enhance NADPH synthesis; use of protein engineering to alter substrate specificity or coenzyme preference; construction of multi-enzyme complexes; and the use of photochemical, electrochemical, or metal oxide-mediated NADPH regeneration.

[0005] Cofactor engineering involves the metabolic processes of various compounds, and it has been found that the amount of NADPH has a significant impact on p-CA production. Since the synthesis of natural products such as coumaric acid requires the participation of the cofactor NADPH, the inherent cofactor levels in *E. coli* are insufficient to meet the needs of efficient coumaric acid synthesis, while the exogenous addition of the cofactor NADPH is very expensive. The inventors studied the effect of increasing NADPH supply on p-CA production, but obtaining the key genes that can improve NADPH supply remains a significant challenge. Summary of the Invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a strain that can enhance NADPH supply.

[0007] Another technical problem that this invention aims to solve is to provide a method for constructing recombinant strains that can enhance NADPH supply.

[0008] Another technical problem that this invention aims to solve is to provide the application of a recombinant strain that can enhance NADPH supply in the production of p-coumaric acid.

[0009] Another technical problem that this invention aims to solve is to provide a method for producing coumaric acid.

[0010] Technical solution: To solve the above-mentioned technical problems, the present invention provides a recombinant strain that can enhance NADPH supply. The recombinant strain carries any one or more of the following target genes that can enhance NADPH supply: a gene encoding NAD kinase (ppnk), a gene encoding NADH kinase (pos5), a gene encoding 6-phosphoglucose dehydrogenase (gnd), a gene encoding soluble pyridine nucleotide transhydrogenase (udhA), or a gene encoding glucose-6-phosphate dehydrogenase (zwf).

[0011] The recombinant Escherichia coli is obtained by amplifying the gene fragment of the target gene that enhances NADPH supply through PCR, ligating it into a vector through homologous recombination, and then transforming it into a host bacterium.

[0012] The present invention also includes a method for constructing the recombinant strain that enhances NADPH supply, comprising the following steps:

[0013] 1) Gene fragments of pos5, gnd, udhA, zwf, ppnk, pntAB and gdh were obtained by PCR amplification;

[0014] 2) The vectors are ligated to each other via homologous recombination, and then transformed into the host bacteria to obtain the final product.

[0015] The primer pairs for PCR amplification in step 1) are as follows: primer pairs for gene pos5 are shown in SEQ ID NO.1 and SEQ ID NO.2; primer pairs for gene gnd are shown in SEQ ID NO.3 and SEQ ID NO.4; primer pairs for gene udhA are shown in SEQ ID NO.5 and SEQ ID NO.6; primer pairs for gene zwf are shown in SEQ ID NO.7 and SEQ ID NO.8; primer pairs for gene ppnk are shown in SEQ ID NO.9 and SEQ ID NO.10; primer pairs for gene pntAB are shown in SEQ ID NO.11 and SEQ ID NO.12; and primer pairs for gene gdh are shown in SEQ ID NO.13 and SEQ ID NO.14.

[0016] SEQ ID NO.1:

[0017] POS5-F:

[0018]

[0019] SEQ ID NO.2:

[0020] POS5-R:

[0021]

[0022] SEQ ID NO.3:

[0023] GND-F:GATATACATATGGCAGATCTATGTCCAAGCAACAGATCGGCGT

[0024] SEQ ID NO.4:

[0025] GND-R:GTTTCTTTACCAGACTCGAGTTAATCCAGCCATTCGGTATGGAACACA

[0026] SEQ ID NO.5:

[0027] UDHA-F:GATATACATATGGCAGATCTATGCCACATTCCTACGATTACGATGC

[0028] SEQ ID NO.6:

[0029] UDHA-R:

[0030]

[0031] SEQ ID NO.7:

[0032] ZWF-F:GATATACATATGGCAGATCTATGGCGGTAACGCAAACAGCCCAG

[0033] SEQ ID NO.8:

[0034] ZWF-R:GTTTCTTTACCAGACTCGAGTTACTCAAACTCATTCCAGGAACGACCSEQ ID NO.9:

[0035] PPNK-F:GATATACATATGGCAGATCTATGACTGCACCCACGAACGCTG

[0036] SEQ ID NO.10:

[0037] PPNK-R:GTTTCTTTACCAGACTCGAGTTACCCCGCTGACCTGGGATCTTT

[0038] SEQ ID NO.11:

[0039] PNTAB-F:GATATACATATGGCAGATCTATGCGAATTGGCATACCAAGAGAAC

[0040] SEQ ID NO.12:

[0041] PNTAB-R:

[0042]

[0043] SEQ ID NO.13:

[0044] GDH-F:

[0045]

[0046] SEQ ID NO.14:

[0047] GDH-R:GTTTCTTTACCAGACTCGAGTTATCCGCGTCCTGCTTGGAATGA

[0048] In step 2), the host bacterium is recombinant bacterium PHCA03, which is a heterologous expression of AtPAL and AtC4H in Escherichia coli JNY021. L373T / G211HAnd strains of AtATR2. This invention clones the AtATR2 encoding gene in a recombinant expression vector and co-expresses it with the P450 enzyme AtC4H encoding gene, acting as a redox chaperone to transfer electrons required for the hydroxylation reaction involving AtC4H.

[0049] In step 2), the recombinant bacterium PHCA03 is constructed as follows: AtPAL and AtC4H-AtATR2 genes are introduced into the chassis strain *Escherichia coli* JNY021 to obtain the mutant strain PHCA02; saturation mutation of AtC4H is performed to obtain the optimal mutant combination AtC4H. L373T / G211H Then the plasmid pEM-AtPAL-AtC4H L373T / G2111H -AtATR2 was introduced into the chassis strain Escherichia coli JNY021 to generate strain PHCA03.

[0050] The present invention also includes detecting the intracellular NADPH / NADP+ content of the above-mentioned recombinant Escherichia coli.

[0051] The present invention also includes evaluating the ability of Escherichia coli expressing the above-mentioned gene to produce coumaric acid.

[0052] The present invention also includes the application of the recombinant strain that enhances NADPH supply in the production of p-coumaric acid.

[0053] The present invention also includes a method for producing p-coumaric acid, comprising the following steps: culturing the recombinant strain in a seed culture medium and then fermenting it in a fermentation culture medium, and adding IPTG to induce fermentation; once fermentation is complete, p-coumaric acid is obtained.

[0054] The seed culture medium comprises: 5 g / L NaCl, 32 g / L tryptone, 20 g / L yeast extract, 5.2 g / L glycerol, and 0.05 g / L kanamycin, sterilized by autoclaving at 121°C for 20 min; the fermentation culture medium comprises: 10 g / L glucose, 3 g / L yeast extract, 3 g / L (NH4)2SO4, 7 g / L K2PO4, 1 g / L MgSO4·7H2O, 2 g / L citric acid, 1.2 g / L tyrosine, 1 ml / L vitamin mixture, 1 ml / L trace elements, 0.05 g / L kanamycin, and 0.008 g / L phenol red, sterilized by autoclaving at 115°C for 15 min.

[0055] The results showed that the p-CA titer increased proportionally with increasing NADPH concentration. Compared with the unmodified bacterial strains, the modified bacterial strains all showed increased NADPH content, and the modified strains also produced more coumaric acid.

[0056] In a specific embodiment of the present invention, an increase in NADPH was achieved by overexpressing the NAD kinase-related gene (ppnk). The present invention provides a group of genetically engineered bacteria expressing the optimized ppnk gene, characterized in that: the genetically engineered bacteria are the aforementioned recombinant bacteria PHCA03 that overexpresses the ppnk gene. Preferably, the genetically engineered bacteria are *Escherichia coli*.

[0057] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention establishes a strategy to enhance the supply of the intracellular cofactor NADPH and uses it to improve the production of p-coumaric acid. By overexpressing NAD kinase (ppnk) in *E. coli*, intracellular NADPH is increased by 13.93 times, and the yield of p-coumaric acid increases from 36.23 mg / L to 58.41 mg / L. This cofactor engineering, through overexpression of the ppnk gene, increases the yield of p-coumaric acid by 29.1%. This strategy features high conversion efficiency, low production cost, and broad prospects for industrial application, demonstrating that increasing the supply of NADPH in *E. coli* can significantly improve the synthesis efficiency of NADPH-dependent natural products such as p-coumaric acid, and has important application value. Attached Figure Description

[0058] Figure 1 pEM-AtPAL-AtC4H-AtATR2 spectrum;

[0059] Figure 2 The effect of different concentrations of NADPH on coumaric acid production;

[0060] Figure 3 pCDR-ppnk map;

[0061] Figure 4 Changes in NADPH levels due to overexpression of different NADPH targets;

[0062] Figure 5 The effect of overexpression of different NADPH supply targets on p-CA production. Detailed Implementation

[0063] The pEM plasmid used in this embodiment (derived from Qiu Chong. Construction of Escherichia coli strain producing p-coumaric acid based on phenylalanine ammonia-lyase pathway [D]. Yangzhou University, 2024.) and pCDR plasmid were preserved by Jiangnan University and originated from the construction and application of an engineered Escherichia coli strain that fixes CO2 and produces malic acid, with patent publication number CN110951660A.

[0064] The following non-limiting embodiments are intended to enable those skilled in the art to more fully understand the present invention, but do not limit the invention in any way. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials and reagents used can be purchased from biological or chemical companies. PrimeStar DNA polymerase and double digestion enzymes were purchased from TaKaRa, p-CA from Sigma-Aldrich (USA), digestive enzymes from Yisheng Biotechnology, and small plasmid extraction kits, DNA gel purification kits, and one-step homologous (C112) recombinase were purchased from Vazyme NADP. + The NADPH assay kit (WST-8 method) was purchased from Beyotime International Co., Ltd., β-NADPH was purchased from Aladdin, and chromatographic grade methanol and pure acetonitrile were purchased from Aladdin ThermoFisher Scientific.

[0065] Example 1 Construction of PHCA03 strain

[0066] The AtPAL gene (NCBI database Gene ID: 824493) was synthesized by Tianlin Biotechnology Co., Ltd. The 5' and 3' ends of the AtPAL gene fragment contain homologous sequences of the pEM plasmid (TGCGAGCTCGGTACC and ctcgagtctggtaaa, respectively).

[0067] The AtC4H-AtATR2 gene (NCBI database Gene ID: 817599 for AtC4H and Gene ID: 829144 for AtATR2) was synthesized by Tianlin Biotechnology Co., Ltd. A KKK (5'AAGAAGAAG-3') modification was added to the N-terminus of the AtC4H gene. AtC4H and AtATR2 (with the linker peptide attached to the N-terminus of ATR2) were linked using a linker peptide containing "GSTSSGSG" (5'GGTTCTACCTCTTCTGGTTCTGGT-3'). The nucleotide sequence of the target gene AtC4H-AtATR2 is shown in SEQ ID NO. 15.

[0068] The expression vector pEM plasmid was double-digested with KpnI and XhoI, and then the plasmid pEM-AtPAL-AtC4H-AtATR2 was constructed using a one-step homologous recombination method (plasmid map shown). Figure 1 The constructed plasmid pEM-AtPAL-AtC4H-AtATR2 was introduced into the chassis strain E. coli JNY021 (E. coli JNY021 is derived from the invention patent CN116656581A A high-yielding Escherichia coli and its construction method and application) to obtain strain PHCA02.

[0069] Using pEM-AtPAL-AtC4H-AtATR2 as a template, full-plasmid PCR was performed using L373T primers in the following PCR amplification system. The PCR product was column recovered and then digested with DpnI enzyme at 37℃ for 40 min and 65℃ for 10 min. The digested product was then introduced into E. coli JNY021. After antibiotic selection and sequencing, pEM-AtPAL-AtC4H expression was obtained. L373T -AtATR2 E. coli. pEM-AtPAL-AtC4H was extracted. L373T -AtATR2 plasmid, then pEM-AtPAL-AtC4H L373T Using the AtATR2 plasmid as a template, full plasmid PCR and digestion were performed using the G211H primer pair in the same manner to finally obtain the double mutant pEM-AtPAL-AtC4H. L373T / G2111H -AtATR2, its double mutant was introduced into E. coli JNY021 to obtain the final recombinant strain PHCA03.

[0070] L373T-F:TCCCACTGactGTACCACACATGAACCTGCATGA

[0071] L373T-R:TGGTACagtCAGTGGGATGGCCATACGTAAGC

[0072] G211H-F:CTTTTCTGcaTGAGCGCAGTCGTTTAGCGCAG

[0073] G211H-R:GCGCTCAtgCAGAAAAAGGGGGTCGTCCTCACT

[0074] PCR amplification reaction system (200μL): 5×buffer 40μL, dNTP 16μL, forward / reverse primers 4μL each, template 4μL, PrimeSTAR polymerase 2μL, dd H2O 130μL.

[0075] PCR amplification conditions: pre-denaturation 94℃, 3 min, denaturation 98℃, 10 s, annealing 55℃, 30 s, extension 72℃ (1000 bp / min), 29 cycles.

[0076] Homologous recombination reaction system: 1 μL linearized vector, 1 μL insert, 4 μL 5×CEⅡBuffer, 2 μL ExnaseⅡ, 12 μL dd H2O. Reaction conditions: 37℃, 30 min; then cooled to 4℃.

[0077] Double enzyme digestion reaction system: KpnI enzyme 10 μL, XhoI enzyme 10 μL, 10× buffer 20 μL, DNA 80 μL, dd H2O 80 μL. Reaction conditions: 37℃, 30 min; then cooled to 4℃.

[0078] Digestion system: 1 μL DpnI enzyme, 1 μL 10× buffer, 8 μL column-recovered product. Reaction conditions: 37℃, 40 min; 65℃, 10 min digestion.

[0079] Example 2: Effect of exogenous NADPH addition on p-coumaric acid production

[0080] In the coumaric acid biosynthesis pathway, NADPH / NADP + Redox cofactors play a crucial role in biochemical reactions and physiological functions. NADPH acts as an electron donor in C4H enzyme-catalyzed reactions, thus significantly impacting p-CA production. This was investigated by adding different concentrations of NADPH (1 mM, 1.5 mM, 2 mM, 2.5 mM, and 3 mM) to 1 mL of the reaction system.

[0081] The PHCA03 strain constructed in Example 1 was activated by inoculating each well of a 96-well plate with 600 μL of LB medium from an agar plate using a sterile toothpick, and then incubating at 37°C for 8 hours. Afterward, 100 μL of seed culture was transferred to TBA medium supplemented with 100 mg / L ampicillin. Initially, the culture was carried out at 37°C and 220 rpm for 2 hours, then the temperature was lowered to 16°C and cultured continuously for 15 hours. Cinnamyl-4-hydroxylase bacterial cells were harvested by centrifugation.

[0082] A 1 mL reaction system contained 20 g / L cinnamic acid-4-hydroxylase wet cells, 0.34 mM trans-cinnamic acid, 50 mM Tris-HCl buffer (pH 7.5), and different concentrations of NADPH. After reacting at 25 °C for 3 hours, the supernatant was collected by centrifugation at 12000 rpm for 10 min, and the content of p-coumaric acid in the product was determined.

[0083] Figure 1 The effect of different concentrations of NADPH on p-CA production was shown. Whole-cell reaction results indicated that p-CA production increased proportionally with increasing NADPH concentration. When the NADPH concentration was 3 mM, the p-coumaric acid production reached 32.8 mg / L, an increase of 72.4% compared to the control group. This demonstrates that NADPH provides a favorable environment for p-coumaric acid production.

[0084] Example 2: Detection of coumaric acid yield

[0085] The concentration of coumaric acid was determined by high performance liquid chromatography (HPLC). After centrifugation of the fermentation broth, the supernatant was filtered through a 0.22 μm filter before content determination. An Altima C18 analytical column (250 mm x 4.6 mm, 5 μm) was used; mobile phase A was pure acetonitrile; mobile phase B was an aqueous solution containing 3% acetic acid; UV detection was performed at a wavelength of 308 nm; the flow rate was 1 mL / min; and the column temperature was 35 °C. Gradient elution was performed for 40.1 min, and the elution program is shown in Table 1.

[0086] Table 1 Elution procedure for coumaric acid sample detection.

[0087]

[0088] Example 3: Expression of NADPH transformation-related genes in chassis strain E. coli PHCA03

[0089] This embodiment constructs a recombinant strain E. coli PHCA03 based on the experimentally constructed strain, and selects target genes to be expressed in plasmid form to enhance NADPH supply, including membrane-bound transhydrogenase (pntAB), glucose dehydrogenase (gdh), NADH kinase (pos5), 6-phosphate gluconate dehydrogenase (gnd), soluble pyridine nucleotide transhydrogenase (udhA), glucose-6-phosphate dehydrogenase (zwf), and NAD kinase (ppnk).

[0090] Genes zwf, pntAB, gnd, and udhA were amplified by PCR from the genomic DNA of *Escherichia coli* MG1655, gene ppnk was amplified by PCR from the genomic DNA of *Corynebacterium glutamicum*, gene pos5 was amplified by PCR from the genomic DNA of *Saccharomyces cerevisiae*, and gene gdh was amplified by PCR from the genomic DNA of *Bacillus*. The corresponding primers are shown in SEQ ID NO. 1–14. The linear fragment of the pCDR vector was obtained by reverse PCR, and the ligation products were obtained by one-step homologous recombination: pCDR-pntAB, pCDR-gdh, pCDR-pos5, pCDR-gnd, pCDR-udhA, pCDR-zwf, and pCDR-ppnk. Taking pCDR-ppnk as an example, the plasmid map is shown below. Figure 2 .

[0091] Prepare E. coli PHCA03 competent cells. After incubating on ice for 30 min, centrifuge at 5000 rpm for 5 min and discard the supernatant. Wash and resuspend the bacterial culture with 10% glycerol, centrifuge and discard the supernatant. Repeat the above washing steps. Take 200 μL of 10% glycerol for resuspending, aliquot and store at -80℃. Sonicate and air-dry the electroporation cuvette in 100% ethanol and pre-cool on ice. Take out the competent E. coli PHCA03 cells and add the recombinant fragments pCDR-pntAB, pCDR-gdh, pCDR-pos5, pCDR-gnd, pCDR-udhA, pCDR-zwf, and pCDR-ppnk to the competent cells. Pre-cool for 15 min. Transfer the mixture to an electroporation cuvette and electroporate at 2100V. Then quickly add 1 ml of LB and incubate for 1 h. 100 μL of bacterial culture was spread onto LB agar and incubated overnight to obtain Escherichia coli strains PHCA04 (pCDR-pntAB), PHCA05 (pCDR-gdh), PHCA06 (pCDR-pos5), PHCA07 (pCDR-gnd), PHCA08 (pCDR-udhA), PHCA09 (pCDR-zwf), and PHCA10 (pCDR-ppnk).

[0092] Example 4 Intracellular NADPH / NAPD + Content detection

[0093] Intracellular NADPH / NADP + The method for determining the content can be based on NADP. + The NADPH assay was performed using the WST-8 assay kit (kit from Shanghai Beyotime Biotechnology Co., Ltd.), with three replicates for each sample.

[0094] Activate strains PHCA03–PHCA10 by picking single cells and activating them in 30 ml of medium at 37°C and 220 rpm. Inoculate the culture medium with an initial OD of 0.6 into LB broth and ferment at 25°C for 24 h. After aspirating the culture medium, add 200 μl of pre-chilled NADP solution (from an ice bath) using a pipette. + Extract the NADPH solution and gently pipette to promote cell lysis; lysis can be performed at room temperature or on ice. Then centrifuge at 12,000 rpm, 4°C for 5-10 minutes, and collect the supernatant as the sample to be tested.

[0095] NADP in the sample + Determination of total NADPH: Pipette 50 μL of the sample to be tested into a 96-well plate. The amount of NADP in the sample... +Determination of NADPH content: Pipette 100 μL of the sample to be tested into a centrifuge tube and heat in a 60℃ water bath or on a PCR instrument for 30 minutes to separate NADPH. + Centrifuge at 10,000 rpm for 5 minutes at room temperature or 4°C, and transfer 50 μL of the supernatant to a 96-well plate as the sample. Add 100 μL of G6PDH working solution to the 96-well plate and incubate at 37°C in the dark for 10 minutes. Then add 10 μL of chromogenic solution to each well, mix well, and incubate at 37°C in the dark for 10–20 minutes. At this point, an orange-yellow formazan will form. Measure the absorbance at 450 nm. Calculate the NADP in the sample. + The amount and NADPH / NADP + The ratio of .

[0096] Figure 3 The results showed that strains PHCA06–PHCA10 had higher NADPH levels than strain PHCA03. The increase in NADPH was most significant when exogenous NAD kinase was introduced, with PHCA10 showing a nearly 13.93-fold increase in NADPH compared to the unmodified strain PHCA03. + The amount also increased by 6.75 times, NADPH / NADP + The value also increased by 2.06 times.

[0097] Example 5: Synthesis of p-coumaric acid by recombinant Escherichia coli strain

[0098] (1) Culture medium

[0099] Seed culture medium: 5 g / L NaCl, 32 g / L tryptone, 20 g / L yeast extract, 5.2 g / L glycerol, 0.05 g / L kanamycin, autoclaved at 121°C for 20 min.

[0100] Fermentation medium: 10 g / L glucose, 3 g / L yeast extract, 3 g / L (NH4)2SO4, 7 g / L K2PO4, 1 g / L MgSO4·7H2O, 2 g / L citric acid, 1.2 g / L tyrosine, 1 ml / L vitamin mixture (V B1 5×10 -4 V B3 5×10 -4 V H 1×10 -3 ), 1 ml / L trace elements, 0.05 g / L kanamycin, 0.008 g / L phenol red (added during shake-flask experiments), and autoclave at 115°C for 15 min.

[0101] (2) Experimental Procedure and Conditions

[0102] Slant culture activation: Strains PHCA03-PHCA10 were inoculated into test tube slant culture medium and cultured at 37℃ for 12h.

[0103] Seed culture: The strain was picked up from the tilted medium with an inoculation loop and cultured in 50 mL of primary seed culture medium at 33.5 °C and 200 rpm for 12 h. Then, 5 mL of the primary seed culture was transferred to 50 mL of secondary seed culture medium. The seeds were cultured using a reciprocating shaker at 200 rpm and incubated at 33.5 °C until the OD610 reached 15.

[0104] Shaking flask fermentation: A 1% (v / v) secondary seed culture was transferred to 100 mL of fermentation medium in a 250 mL shaking flask. Initially, the culture was incubated at 33.5 °C and 180 rpm. When the OD610 reached 0.4, 0.1 mM IPTG was added, and the fermentation temperature was subsequently lowered to 25 °C. During the subsequent 48 h fed-batch shaking flask fermentation, 0.1 mM IPTG was added every 12 h. Ammonia solution was manually added to maintain the pH of the medium at approximately 7.0, using 8 mg / L phenolphthalein as an acid-base indicator. If the remaining glucose in the medium was less than 2 g / L, glucose was added to a final concentration of approximately 5 g / L, and fermentation continued until completion. The method for determining the yield of coumaric acid is as described in Example 2.

[0105] The results of shake-flask fermentation are as follows Figure 4 As shown, expression of glucose-6-phosphate dehydrogenase (zwf), 6-phosphate gluconate dehydrogenase (gnd), NAD kinase (ppnk), soluble pyridine nucleotide transhydrogenase (udhA), and NADH kinase (pos5) in E. coli PHCA03 increased p-coumaric acid (p-CA) production. However, expression of membrane-bound transhydrogenase (pntAB) and glucose dehydrogenase (gdh) in E. coli PHCA03 not only failed to increase p-CA production but actually decreased it. Compared to other strains, PHCA10 (overexpressing ppnk) increased p-CA production to 58.41 mg / L, with a productivity of 1.22 mg / L / h, representing increases of 29.1% and 29.7% respectively compared to strain PHCA03.

Claims

1. A recombinant strain capable of enhanced NADPH supply, characterized in that, The recombinant strain contains a target gene that enhances NADPH supply: the ppnk gene encoding NAD kinase. The method for constructing the recombinant strain that enhances NADPH supply includes the following steps: 1) The NAD kinase gene fragment ppnk was obtained by PCR amplification; 2) It is obtained by ligating homologous recombination to a vector and then transforming it into a host bacterium; Step 1) comprises PCR amplifying the gene from the genome DNA of Corynebacterium glutamicum ppnk, The primer pair for PCR amplification is as follows: ppnk The primer pair of the gene is shown as SEQ ID NO. 9 and SEQ ID NO. 10; The host bacterium in step 2) is the recombinant bacterium PHCA03. The construction method of the recombinant bacterium PHCA03 strain is as follows: At PAL gene, At C4H- At The ATR2 gene and expression vector pEM plasmid were constructed using a one-step homologous recombination method to obtain plasmid pEM- At PAL- At C4H- At ATR2, with pEM- At PAL- At C4H- At Using ATR2 as a template, full-plasmid PCR was performed using the L373T primer pair. The PCR product was then column recovered, and the original plasmid was digested with DpnI enzyme before being introduced into the culture medium. E. coli pEM- was expressed in JNY021 At PAL- At C4H L373T - At pEM- was extracted from E. coli ATR2. At PAL- At C4H L373T - At ATR2 plasmid, then pEM- At PAL- At C4H L373T - At Using ATR2 plasmid as a template, full plasmid PCR and digestion were performed using the G211H primer pair to finally obtain the double mutant pEM- At PAL- At C4H L373T / G2111H - At ATR2, its dual mutation introduced E. coli The final recombinant strain PHCA03 was obtained from JNY021. At The PAL gene has the following Gene ID: 824493. At C4H- At The nucleotide sequence of the ATR2 gene is shown in SEQ ID NO.

15. The L373T primer pair sequences are as follows: L373T-F: TCCCACTGactGTACCACACATGAACCTGCATGA, L373T-R: TGGTACagtCAGTGGGATGGCCATACGTAAGC; The G211H primer pair sequences are as follows: G211H-F: CTTTTTCTGcaTGAGCGCAGTCGTTTAGCGCAG, G211H-R: GCGCTCAtgCAGAAAAAGGGGGTCGTCCTCACT.

2. A method for constructing a recombinant strain capable of enhancing NADPH supply, characterized in that, Includes the following steps: 1) Obtained by PCR amplification ppnk Gene fragments; 2) The cells are ligated to the vector via homologous recombination and then transformed into the host bacteria to obtain the final product; Step 1) includes PCR amplification of genes from Corynebacterium glutamicum genomic DNA. ppnk, The primer pairs for PCR amplification are as follows: gene ppnk The primer pairs are shown in SEQ ID NO.9 and SEQ ID NO.10; The host bacterium in step 2) is the recombinant bacterium PHCA03. The construction method of the recombinant bacterium PHCA03 strain is as follows: At PAL gene, At C4H- At The ATR2 gene and the expression vector pEM plasmid were constructed using a one-step homologous recombination method to obtain plasmid pEM- At PAL- At C4H- At ATR2, with pEM- At PAL- At C4H- At Using ATR2 as a template, full-plasmid PCR was performed using the L373T primer pair. The PCR product was then column recovered, and the original plasmid was digested with DpnI enzyme before being introduced into the culture medium. E. coli pEM- was expressed in JNY021 At PAL- At C4H L373T - At pEM- was extracted from E. coli ATR2. At PAL- At C4H L373T - At ATR2 plasmid, then pEM- At PAL- At C4H L373T - At Using ATR2 plasmid as a template, full plasmid PCR and digestion were performed using the G211H primer pair to finally obtain the double mutant pEM- At PAL- At C4H L373T / G2111H - At ATR2, its dual mutation introduced E. coli The final recombinant strain PHCA03 was obtained from JNY021. At The PAL gene has a Gene ID of 824493. At C4H- At The nucleotide sequence of the ATR2 gene is shown in SEQ ID NO.

15. The L373T primer pair sequences are as follows: L373T-F: TCCCACTGactGTACCACACATGAACCTGCATGA, L373T-R: TGGTACagtCAGTGGGATGGCCATACGTAAGC; The G211H primer pair sequences are as follows: G211H-F: CTTTTTCTGcaTGAGCGCAGTCGTTTAGCGCAG, G211H-R: GCGCTCAtgCAGAAAAAGGGGGTCGTCCTCACT.

3. The use of the recombinant strain of claim 1 that enhances NADPH supply in the production of p-coumaric acid.

4. A method for producing p-coumaric acid, characterized in that, The process includes the following steps: culturing the recombinant strain described in claim 1 in a seed culture medium, followed by fermentation in a fermentation culture medium, and inducing fermentation with IPTG. Once fermentation is complete, p-coumaric acid is obtained.

5. The method for producing p-coumaric acid according to claim 4, characterized in that, The seed culture medium comprises: 5 g / L NaCl, 32 g / L tryptone, 20 g / L yeast extract, 5.2 g / L glycerol, and 0.05 g / L kanamycin, and is autoclaved at 121°C for 20 min.

6. The method for producing p-coumaric acid according to claim 5, characterized in that, The fermentation medium comprises: 10 g / L glucose, 3 g / L yeast extract, 3 g / L (NH4)2SO4, 7 g / L K2PO4, 1 g / L MgSO4·7H2O, 2 g / L citric acid, 1.2 g / L tyrosine, 1 ml / L vitamin mixture, 1 ml / L trace elements, 0.05 g / L kanamycin, and 0.008 g / L phenol red, and is autoclaved at 115°C for 15 min.