MLXIPL gene-based SNP marker for auxiliary diagnosis of esophageal cancer in alcohol-consuming population and application thereof

By using the SNP marker rs1051921 based on the MLXIPL gene, the m6A modification site of the MLXIPL gene in alcohol-consuming individuals was detected by real-time PCR, solving the problem of early screening and diagnosis of esophageal cancer in alcohol-consuming individuals and achieving early risk assessment and efficient screening of alcohol-consuming individuals.

CN118109586BActive Publication Date: 2026-02-10HUAZHONG UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410065523.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-17
Publication Date
2026-02-10
Estimated Expiration
2044-01-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the effective screening and early diagnosis of esophageal cancer, especially among people who drink alcohol. Endoscopic examinations are complex, expensive, and have low patient acceptance.

Method used

Using the MLXIPL gene-based SNP marker rs1051921, the m6A modification site rs1051921 of the MLXIPL gene in alcohol-consuming individuals was detected by real-time PCR. Specific amplification primers and probes were designed to assist in the early screening and diagnosis of esophageal cancer.

Benefits of technology

It provides a convenient and reliable method that can be promoted in medical units at all levels to help assess the risk of esophageal cancer in people who drink alcohol, achieve early screening and diagnosis, and reduce economic burden and medical pressure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118109586B_ABST
    Figure CN118109586B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of SNP marker based on MLXI PL gene for the auxiliary diagnosis of drinking population esophageal cancer and its application, the present application provides the technical method for screening the high-risk population of esophageal cancer in drinking population.This method is based on the previous research results, i.e.rs1051921 site is related to the susceptibility of Chinese population to esophageal cancer.Compared with non-drinking population, the susceptibility of the site to esophageal cancer is more significantly related in drinking population.Through the ingenious design of primer and probe for rs1051921 site, the detection of rs1051921 variation in Chinese population can be carried out by fluorescence quantitative PCR, so as to identify the high-risk population of esophageal cancer, assist the diagnosis of esophageal cancer patients.The method is ingenious, easy to operate, and the result is reliable, can be popularized in medical units at all levels, provides technical support for evaluating the risk of esophageal cancer, and helps early screening and intervention of esophageal cancer for this population in clinic.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of auxiliary diagnosis of esophageal cancer, specifically to a SNP biomarker for auxiliary diagnosis of esophageal cancer in alcohol-consuming individuals based on the MLXIPL gene and its application. Background Technology

[0002] Esophageal cancer is a common malignant digestive tract tumor in my country, ranking among the top malignant tumors in terms of both incidence and mortality, making it a major killer of Chinese residents. The cause of esophageal cancer is unknown, and it progresses rapidly, often being diagnosed at an advanced stage. It is prone to recurrence and metastasis, and its high incidence and poor prognosis impose a significant disease burden on my country. Genetic and environmental factors jointly participate in the occurrence and development of esophageal cancer. In recent years, alcohol consumption, smoking, and insufficient intake of fruits and vegetables have been found to increase the risk of esophageal cancer; alcohol consumption may significantly increase an individual's risk of developing esophageal cancer. Currently, the most effective screening method for esophageal cancer is endoscopy. However, this method also has drawbacks such as high technical requirements, high cost, and low patient acceptance. If individualized screening and early diagnosis could be implemented for high-risk groups (such as those who drink alcohol), it would not only increase patient acceptance but also alleviate some of the economic burden and medical pressure on the country and society.

[0003] N6-methyladenine (m6A) is a dynamic and reversible post-transcriptional regulatory mechanism that has attracted widespread attention from researchers in recent years. m6A is present not only in mRNA but also in other types of RNA such as lncRNA, making it the most abundant RNA modification type in eukaryotic cells. m6A methyltransferases and m6A demethyltransferases dynamically regulate the level of m6A modification on RNA, and the modified RNA is recognized by m6A-binding proteins, thus determining its fate. At the molecular level, m6A participates in almost the entire process of RNA metabolism regulation, including precursor mRNA splicing, mRNA stabilization, and translational regulation, playing a crucial regulatory role in gene expression. Current research indicates that m6A modification can regulate the proliferation and invasion of tumor cells, participating in the development and progression of various cancers such as leukemia, liver cancer, breast cancer, and esophageal squamous cell carcinoma. Furthermore, as a common genetic variant, SNPs can affect the level of m6A modification by altering the RNA sequence of target or key nucleotides; that is, m6A-SNPs may influence tumor development and progression by affecting gene expression. Therefore, m6A-SNPs can serve as a novel molecular marker to aid in tumor screening and diagnosis. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a SNP marker for the auxiliary diagnosis of esophageal cancer in alcohol-consuming individuals based on the MLXIPL gene and its application.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0006] A genetic marker for the auxiliary diagnosis of esophageal cancer in alcohol-consuming individuals, identified as rs1051921.

[0007] Furthermore, the specific amplification primer sequences for rs1051921 are SEQ ID NO: 1 and SEQ ID NO: 2.

[0008] Furthermore, the specific probe sequences of rs1051921 are SEQ ID NO: 3 and SEQ ID NO: 4.

[0009] Furthermore, the detection reagent for the SNP genetic marker rs1051921, which is associated with the auxiliary diagnosis of esophageal cancer in alcohol-drinking individuals, is used in the preparation of an auxiliary diagnostic kit for esophageal cancer in alcohol-drinking individuals.

[0010] Furthermore, the esophageal cancer auxiliary diagnostic kit for alcohol-consuming individuals includes specific amplification primers and specific probes for the aforementioned SNP markers.

[0011] Furthermore, the drinking population refers to people who have been drinking for more than ten years and drink at least twice a week on average.

[0012] The beneficial effects of this invention are as follows:

[0013] Our previous research indicated that a genetic variant, rs1051921, exists in the 3'UTR of the MLXIPL gene, which can influence susceptibility to esophageal cancer by affecting m6A modification of MLXIPL. Individuals carrying the rs1051921 risk genotype have a significantly higher risk of developing esophageal cancer than normal individuals and can be considered a high-risk group for esophageal cancer. Furthermore, compared to non-drinkers, rs1051921 is significantly associated with esophageal cancer susceptibility in drinkers, suggesting that this locus and alcohol consumption may play an important interactive role in increasing the risk of esophageal cancer. Therefore, detection of MLXIPL gene m6A modification-related SNPs in drinkers can aid in the early screening and diagnosis of esophageal cancer, and is of great significance for the early detection of esophageal cancer patients.

[0014] This invention provides a technical method for screening high-risk individuals for esophageal cancer among alcohol drinkers, from the perspectives of molecular biology and gene diagnostics. This method is based on our previous research, which indicates that the rs1051921 locus is associated with esophageal cancer susceptibility in the Chinese population. Furthermore, compared to non-drinkers, this locus is more significantly associated with esophageal cancer susceptibility in drinkers. Through ingenious primer and probe design targeting the rs1051921 locus, quantitative real-time PCR can be used to detect rs1051921 variants in the Chinese population, thereby identifying high-risk individuals for esophageal cancer and aiding in the diagnosis of esophageal cancer patients. This method is ingeniously designed, easy to operate, and provides reliable results. It can be promoted in medical institutions at all levels, providing technical support for assessing the risk of esophageal cancer and contributing to early screening and intervention for esophageal cancer in this population in clinical practice. Attached Figure Description

[0015] Figure 1 AUC curve of MLXIPL-based risk prediction model for esophageal cancer in alcohol-consuming populations. Detailed Implementation

[0016] The principles and features of the present invention are described below. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0017] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0018] We performed genotyping on 6939 esophageal cancer patients with complete medical records and clearly defined esophageal cancer types, and 8757 healthy controls with no history of cancer. Both esophageal cancer patients and healthy controls were Han Chinese. Patients were diagnosed histopathologically and there were no age restrictions; healthy controls had no history of cancer and showed no signs of cancer upon physical examination. Information on age, sex, smoking, and alcohol consumption was collected from the participants. Basic demographic characteristics of all participants are shown in Table 1. Each participant provided informed consent to participate in this study and donated 2 ml of peripheral venous blood for the isolation and preparation of lymphocyte genomic DNA.

[0019] Table 1. Basic demographic characteristics of esophageal cancer patients and normal controls used in the study.

[0020]

[0021] We used an unconditional logistic regression additive model to calculate the association between the m6A modification site rs1051921 of the MLXIPL gene and susceptibility to esophageal cancer, after adjusting for sex, age, smoking, and alcohol consumption. The results showed that, after adjusting for sex, age, smoking, and alcohol consumption, individuals carrying the rs1051921 risk genotype had a 31% increased risk of esophageal cancer compared to healthy individuals (OR = 1.31, 95% CI: 1.23–1.41, P = 4.66 × 10⁻⁶). -15 Furthermore, stratified analysis of the case and control groups based on alcohol consumption information, after adjusting for sex, age, and smoking status, showed that the rs1051921 risk genotype was significantly associated with susceptibility to esophageal squamous cell carcinoma in the alcohol-drinking population compared to the non-drinking population (alcohol-drinking population: OR = 1.69, 95% CI: 1.50–1.91, P = 7.32 × 10⁻⁶). -18 Non-drinkers: OR = 1.15, 95% CI: 1.04–1.26, P = 3.94 × 10⁻⁶ -3 The above analysis results suggest that rs1051921 and alcohol consumption may play an important interactive role in increasing the risk of esophageal squamous cell carcinoma. This site can serve as a SNP marker for the auxiliary diagnosis of esophageal cancer in alcohol-consuming individuals.

[0022] We further used this SNP locus to establish a risk prediction model for esophageal cancer in alcohol-consuming individuals. We constructed a formula that comprehensively considers the three SNP genotypes, sex, age, and smoking status. Specifically, for SNP genotyping, wild-type homozygous = "0", heterozygous = "1", and mutant homozygous = "2"; for sex, male = "1", female = "2"; for age, 60 years or older = "1", younger than 60 years = "0"; for smoking status, non-smokers = "0", smokers = "1". The analysis used the multivariate logistic regression coefficient β as the weight, resulting in the following formula based on the rs1051921 genotyping risk score:

[0023] Risk score = (-3.145 × gender score) + (-0.291 × age score) + (0.929 × smoking status score) + (0.527 × rs1051921 subtype score).

[0024] By plotting the ROC curve, the area under the curve for this model is 0.779, and the critical value is 0.559. See details... Figure 1 .

[0025] Experimental methods:

[0026] 1. Peripheral blood DNA extraction:

[0027] We extracted DNA using the conventional phenol-chloroform method, and the specific steps are as follows:

[0028] 1) Take about 3 ml of anticoagulated blood, centrifuge at 5,000 × g for 15 min at room temperature, discard the supernatant, and keep about 0.3 ml of blood cells. Add 0.5 ml of freshly prepared extraction buffer with a final concentration of 20 μg / ml RNase, mix well, and incubate at 37°C for 1 h.

[0029] 2) Add proteinase K to a final concentration of 100 μg / ml, mix well, and incubate at 37°C overnight.

[0030] 3) Add 0.7 ml of phenol (pH = 7.0) equilibrated with Tris buffer to each tube, mix thoroughly, and centrifuge at 8,000 × g for 15 min at room temperature.

[0031] 4) Transfer the supernatant to another 1.5ml centrifuge tube, add an equal volume of 0.7ml phenol-chloroform (1:1), mix thoroughly for 15min; centrifuge at 8,000×g for 15min at room temperature.

[0032] 5) Transfer the supernatant to another clean 1.5ml centrifuge tube, add 10% volume of 10M ammonium acetate solution, add 2 volumes of pre-cooled anhydrous ethanol, and let stand at -20℃ for 2 hours to precipitate DNA.

[0033] 6) Wash the precipitated DNA with 75% ethanol, centrifuge at 12,000×g for 15 min and discard the supernatant; wash again with 75% ethanol, centrifuge at 12,000×g for 15 min and discard the supernatant.

[0034] Invert the tubes onto absorbent paper and wait for the ethanol to evaporate completely. Add an appropriate amount of TE buffer to each tube, incubate at 4°C for one week, and then store at -20°C for later use.

[0035] 2. Genotyping

[0036] The genotyping platform used was TaqMan genotyping technology (ABI 7900HT Real-Time PCR system, Applied Biosystems). The 5 μl PCR reaction system is shown in Table 2 below:

[0037] Table 2

[0038]

[0039] The reaction conditions were: 95℃ pre-denaturation for 10 min, followed by 40 cycles of 95℃ for 15 sec and 60℃ for 1 min.

[0040] The primers and probes used in the reaction are as follows:

[0041] rs1051921 primer:

[0042] Forward primer: CATCCCCATTTTGCAGATTGA (SEQ ID NO: 1)

[0043] Reverse primer: CACCGTGACCTTGGGTGACT (SEQ ID NO: 2)

[0044] rs1051921 probe:

[0045] Forward probe: FAM-ACACAGCGGTCCAA-MGB (SEQ ID NO: 3)

[0046] Reverse probe: VIC-ACACAGCAGTCCAA-MGB (SEQ ID NO: 4)

[0047] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of the detection reagent for rs1051921, a SNP genetic marker associated with the auxiliary diagnosis of esophageal cancer in alcohol-drinking populations, in the preparation of an auxiliary diagnostic kit for esophageal cancer in alcohol-drinking populations.

2. The application according to claim 1, characterized in that, The esophageal cancer auxiliary diagnostic kit for alcohol-consuming individuals includes specific amplification primers and specific probes for rs1051921.

3. The application according to claim 1, characterized in that, The drinking population refers to people who have been drinking for more than ten years and drink at least twice a week on average.