A method for constructing a mouse model of atherosclerosis induced by a high-fat diet-free

By introducing wild mouse chromosomes into the mouse model through whole genome sequencing and gene editing technology, a mouse model of atherosclerosis that is immune to high-fat diet induction was constructed, which solved the problems of unstable genetic background and phenotypic presentation of the existing model and achieved a simulation that is closer to human atherosclerosis for drug research and screening.

CN118120704BActive Publication Date: 2025-10-24GEMPHARMATECH CO LTD

Patent Information

Application Number
CN202410130083.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-30
Publication Date
2025-10-24
Estimated Expiration
2044-01-30

AI Technical Summary

Technical Problem

The existing ApoE gene knockout mouse models and LDL receptor gene knockout mouse models are affected by genetic background when simulating atherosclerosis, and the phenotypic presentation takes a long time and is unstable, making it difficult to fully simulate the characteristics of atherosclerosis in different populations.

Method used

By screening wild mice through whole genome sequencing, constructing in vitro assisted reproduction and gene editing technologies, introducing chromosomes of mice from different strains and regions to form wild mice, and knocking out atherosclerosis-related genes in them, increasing genetic diversity, simulating the genetic background of different populations, and constructing a mouse model of atherosclerosis that is immune to high-fat diet-induced atherosclerosis.

Benefits of technology

A mouse model has been developed that can spontaneously develop symptoms of atherosclerosis without the need for a high-fat diet. The blood lipid profile is closer to that of humans, which can more realistically simulate atherosclerosis and be used for studying pathogenesis and drug screening, thereby improving the stability and universality of the model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118120704B_ABST
    Figure CN118120704B_ABST
Patent Text Reader

Abstract

The application discloses a method for constructing a mouse model of atherosclerosis induced without high-fat diet, and relates to the technical field of disease model construction.The mouse model construction method provided by the application obtains a mouse model that spontaneously exhibits atherosclerosis symptoms without high-fat diet induction.The mouse model of atherosclerosis induced without high-fat diet can be used for researching the pathogenesis of atherosclerosis and screening and evaluating drugs for atherosclerosis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of disease model construction, in particular to a method for constructing a high-fat-diet-induced atherosclerosis mouse model. BACKGROUND

[0002] Atherosclerosis or coronary artery disease (CAD) is the most common cardiovascular disease (CVD), the main component of which is lipid accumulation and inflammation in large arteries, which can eventually lead to its clinical complications, myocardial infarction (MI) and stroke. As a slow-progressing disease, clinically significant atherosclerosis mainly occurs in the elderly, although the incidence has decreased in some countries, it is still the leading cause of death worldwide. The characteristic of atherosclerotic lesions is the long-term accumulation and transformation of lipids, inflammatory cells, smooth muscle cells and necrotic cell debris in the intimal space under the monolayer of endothelial cells in the inner wall of blood vessels.

[0003] The main drugs for treating atherosclerosis at present are statins, ezetimibe, PCSK9 inhibitors, etc. These drugs mainly achieve therapeutic effect by reducing the blood lipid level of patients, inhibiting inflammation, etc. However, the current treatment drugs are difficult to achieve plaque reversal, even if the cholesterol level is reduced by drugs, the formed atherosclerotic plaques are difficult to completely reverse. At the same time, there are individual differences among patients, some patients may develop tolerance to certain drugs, resulting in a decline in treatment effect. At the same time, some drugs may cause adverse side effects, limiting their long-term use. Therefore, it is of great significance to develop treatment drugs that can target more atherosclerosis patients.

[0004] Mouse models are widely used in the mechanism research and drug development of atherosclerosis as an important tool for drug development. The most commonly used mouse models are ApoE knockout mouse model and LDL receptor knockout mouse model. These mice have abnormal cholesterol metabolism due to the lack of ApoE gene or LDL receptor gene, and are prone to atherosclerosis. They form plaques under the stimulation of high cholesterol diet, simulating some characteristics of human atherosclerosis. However, there are still some problems in the ApoE knockout mouse model and LDL receptor knockout mouse model, which limit the mechanism research and drug development of atherosclerosis. First, C57BL / 6 mice are often used as the genetic background of ApoE and LDL receptor knockout mice, and the genetic background may affect the phenotype of atherosclerosis, and a single genetic background can only simulate part of the clinical patients. Second, under normal diet conditions, ApoE and LDL receptor knockout mice develop atherosclerosis and cholesterol elevation phenotype very late, and need to be induced by high-fat diet for about 16 weeks to form obvious atherosclerotic plaques, which consumes a long time period and is unstable.

[0005] Therefore, the present application is proposed. SUMMARY

[0006] The present application aims to provide a method for constructing a high-fat diet-free atherosclerosis mouse model, thereby constructing a high-fat diet-free atherosclerosis mouse model, which can effectively increase the genetic diversity of mice and simulate the genetic background of different populations.

[0007] The present application is implemented as follows:

[0008] In a first aspect, the present application provides a method for constructing a high-fat diet-free atherosclerosis mouse model, comprising the following steps:

[0009] S1: Whole genome sequencing is performed on a plurality of wild male mice to obtain 100-200 differential SNPs sites different from C57BL / 6 mice;

[0010] S2: Sperm of the plurality of wild male mice and oocytes of a plurality of C57BL / 6 mice are respectively fertilized in vitro to obtain a plurality of F1 generation mice; SNPs detection is performed on the plurality of F1 generation mice; a F1 generation mouse with the closest differential SNPs site information on a specific chromosome compared with the donor wild mouse is selected as a mating mouse;

[0011] S3: The breeding mice are mated with C57BL / 6 mice, and the SNPs site information is detected in each generation, and the mice with specific chromosomes closest to the wild mice are selected according to the SNPs site information results, and the mice with SNPs information on the remaining chromosomes close to the C57BL / 6 mice continue to be mated;

[0012] S4: After mating, the wild mice with SNPs site information on specific chromosomes consistent with wild house mice and SNPs information on other chromosomes consistent with C57BL / 6 mice are obtained.

[0013] S5: The wild mice are genetically edited to obtain an atherosclerosis mouse model; the genetic editing refers to knocking out the atherosclerosis-related genes of the target wild mice, and the atherosclerosis-related genes are selected from at least one of the Apoe gene, the LDL receptor gene and the Slfn4 gene.

[0014] The present application introduces different (strain and / or region) wild mouse chromosomes into C57BL / 6 mice through in vitro assisted reproduction and gene editing technology to construct a chromosome replacement line (hereinafter referred to as "wild mouse") derived from wild mice, which can effectively increase the genetic diversity of mice and further simulate the genetic background of different populations. Further knocking out the atherosclerosis-related genes on the wild mice can increase the susceptibility of the wild mice to atherosclerosis, and a mouse model that can spontaneously develop atherosclerosis symptoms without high-fat diet induction is obtained. The construction of the atherosclerosis mouse model without high-fat diet induction in the present application can be used for studying the pathogenesis of atherosclerosis and for screening and evaluating drugs for atherosclerosis. In addition, the mouse model constructed by the method provided in the present application has a blood lipid distribution closer to that of human atherosclerosis patients, which can more truly simulate human atherosclerosis, which helps people to study the pathogenesis of atherosclerosis, screen and evaluate drugs for atherosclerosis.

[0015] In an alternative embodiment, in step S1, a plurality of wild male mice can be selected from wild mice (such as wild house mice) in different regions for whole genome sequencing. Selecting a plurality of mice in different regions for whole genome sequencing helps to obtain more different SNPs.

[0016] The number of strains or species of the plurality of wild male mice is at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 15.

[0017] In step S2, the F1 generation mouse closest to the difference SNP site information on the specific chromosome compared with the donor wild mouse is screened out as the breeding mouse. Such screening principle helps to obtain the mouse closest to the wild mouse on the specific chromosome, thereby obtaining the breeding material with higher wild mouse background on the specific chromosome.

[0018] The specific chromosome includes, but is not limited to, any one of the first pair of chromosomes to the 20th pair of chromosomes of the mouse.

[0019] In a preferred embodiment of the application, the atherosclerosis phenotype is selected from at least one of the following: increased fat, increased low-density lipoprotein cholesterol (LDL-C), increased triglyceride (TG), increased total cholesterol (TC), increased body weight, increased liver fat accumulation, plaque in arteries, thickening of arterial wall, hardening of arterial wall and stenosis of arterial lumen.

[0020] In a preferred embodiment of the application, the specific chromosome is determined according to the following method: by whole genome sequencing of a plurality of wild mice, determining the SNPs of the wild mice and the experimental mouse C57BL / 6 mouse on each chromosome, and performing GO and KEGG enrichment analysis on the genes where the SNPs are located, to determine the chromosome with the most metabolic-related gene enrichment.

[0021] In a preferred embodiment of the application, the specific chromosome is chromosome 1.

[0022] Step S5 further comprises, before gene editing: selecting a wild mouse meeting the atherosclerosis phenotype as a gene editing object from the wild mice.

[0023] The gene editing technology is selected from at least one of the following: CRISPR / Cas9 technology, CRISPR / Cas12a technology, CRISPR / Cas13a technology, artificial nuclease-mediated zinc finger nuclease technology, transcription activator-like effector nuclease technology and Cre-loxp gene knockout technology. However, in other embodiments, after the knockout gene is determined, it is easy to achieve the purpose of gene knockout by using the conventional gene editing technology in the art.

[0024] In a preferred embodiment of the application, in step S2, the fertilized egg is transplanted into the oviduct of the surrogate mouse for development.

[0025] In a preferred embodiment of the application, the fertilized egg at the pronucleus stage or the two-cell stage is transplanted into the oviduct of the surrogate mouse for development.

[0026] In the above step S4, the breeding generation is 5-6 generations.

[0027] In a second aspect, the present application further provides a method for constructing a mouse model of atherosclerosis induced without high-fat diet, and application of the mouse model of atherosclerosis constructed by the method in screening drugs for preventing or treating cardiovascular diseases.

[0028] The mouse model of atherosclerosis provided by the present application does not need to be induced by high-fat diet, and has a good atherosclerosis phenotype. Compared with C57BL / 6 mice with ApoE gene knocked out, the period of occurrence of arterial plaque symptoms is shortened, and the atherosclerosis phenotype is more significant.

[0029] In a preferred embodiment of the application, the cardiovascular disease includes, but is not limited to, at least one of aortic atherosclerosis, coronary atherosclerosis, coronary atherosclerotic heart disease, carotid atherosclerosis, cerebral atherosclerosis, renal atherosclerosis and atherosclerosis of extremities.

[0030] In a third aspect, the present application further provides a method for constructing a mouse model of atherosclerosis induced without high-fat diet, and application of the mouse model of atherosclerosis constructed by the method in evaluating drugs for preventing or treating cardiovascular diseases.

[0031] In a preferred embodiment of the application, the cardiovascular disease is selected from at least one of aortic atherosclerosis, coronary atherosclerosis, coronary atherosclerotic heart disease, carotid atherosclerosis, cerebral atherosclerosis, renal atherosclerosis and atherosclerosis of extremities.

[0032] In a preferred embodiment of the application, the cardiovascular disease is atherosclerosis.

[0033] The present application has the following beneficial effects:

[0034] The present application introduces different (strain and / or region) wild mouse chromosomes into C57BL / 6 mice by in vitro assisted reproduction and gene editing technology to construct a wild mouse-derived chromosome replacement line (hereinafter referred to as "wild mouse"), which can effectively increase the genetic diversity of mice and further simulate the genetic background of different populations. Further knocking out atherosclerosis-related genes in the wild mouse can increase the susceptibility of the wild mouse to atherosclerosis, and a mouse model that can spontaneously develop atherosclerosis symptoms without high-fat diet is obtained. The construction of the mouse model of atherosclerosis induced without high-fat diet of the present application can be used for studying the pathogenesis of atherosclerosis, and for screening and evaluating drugs for atherosclerosis. In addition, the mouse model constructed by the method provided by the present application has a blood lipid distribution closer to that of human atherosclerosis patients, and can more truly simulate human atherosclerosis, which helps people to study the pathogenesis of atherosclerosis, screen and evaluate drugs for atherosclerosis. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some of the embodiments of the present application, and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0036] Figure 1 Flow chart for construction of atherosclerotic mouse model;

[0037] Figure 2 Statistical results of blood lipid levels of Apoe knockout mice in C57BL / 6 background and Apoe knockout mice in wild mouse background at 8 weeks of age;

[0038] Figure 3 Statistical results of blood lipid levels of Apoe knockout mice in C57BL / 6 background and Apoe knockout mice in wild mouse background at 12 weeks of age;

[0039] Figure 4 Actual pictures of aortic plaques of Apoe knockout mice in C57BL / 6 background and Apoe knockout mice in wild mouse background at 16 weeks of age;

[0040] Figure 5 Statistical results of aortic plaque area of Apoe knockout mice in C57BL / 6 background and Apoe knockout mice in wild mouse background at 16 weeks of age. DETAILED DESCRIPTION

[0041] The embodiments of the present application will now be described in detail with reference to the drawings, one or more examples of which are illustrated in the accompanying drawings. Each example is provided as an explanation and not a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present application without departing from the scope or spirit of the present application. For example, features described or illustrated as part of one embodiment can be used in another embodiment to produce a further embodiment.

[0042] The practice of the present application will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Animal Cell Culture (R. I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); and Current Protocols in Immunology (J. E. Coligan et al., eds., 1991), each of which is incorporated herein by reference in its entirety.

[0043] In order to make the purposes, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. If no specific conditions are indicated in the embodiments, the conventional conditions or the conditions suggested by the manufacturers are adopted. If no manufacturers of the reagents or instruments are indicated, the reagents or instruments are all conventional products that can be purchased in the market.

[0044] The features and performances of the present application are further described in detail below in combination with the embodiments.

[0045] Embodiment 1

[0046] This embodiment provides a method for constructing a mouse model of atherosclerosis induced by a high-fat diet. The flow chart is shown inFigure 1 The specific steps are as follows:

[0047] (1) Capture wild Mus musculus from different regions in China to obtain 11 wild mouse strains shown in Table 1 below, perform whole genome sequencing on wild male Mus musculus, obtain multiple SNPs sites different from C57BL / 6 mice, and obtain sperm from the epididymis of the male Mus musculus and freeze it in liquid nitrogen; the screening method of the multiple SNPs sites is as follows:

[0048] By performing whole genome sequencing on multiple wild mice, the SNPs of the wild mice different from the experimental mice C57BL / 6 mice on each chromosome are determined, and GO and KEGG enrichment analysis is performed on the genes where the SNPs are located to determine the chromosome with the most metabolic related gene enrichment.

[0049] (2), using in vitro assisted reproductive technology, using sperm of wild Mus musculus and superovulated oocytes of female C57BL / 6 mice for in vitro fertilization, transferring the zygotes at the pronucleus stage or two-cell stage to the oviduct of surrogate mice for development, and then obtaining F1 generation mice;

[0050] (3), SNPs detection is performed on the F1 generation mice, and a specific chromosome (in this embodiment, chromosome 1 is taken as an example) is selected which is closest to the SNPs of the wild Mus musculus, and is then mated with C57BL / 6 mice, and SNPs detection is performed on each generation and a mouse with chromosome 1 closest to the wild Mus musculus and other chromosomes closest to C57BL / 6 mice is selected as a mating mouse for mating;

[0051] (4), after mating for 5-6 generations, a wild mouse derived chromosome replacement line mouse is obtained, in which the SNPs of chromosome 1 are completely consistent with those of the wild Mus musculus, and the SNPs of other chromosomes are consistent with those of C57BL / 6 mice, i.e., the wild mouse in the present application (the SNPs information of the 11 wild mice different from C57BL / 6 mice is shown in Table 1); select the D000750 strain among them for subsequent model construction. Table 1 is the difference SNPs information of the wild mice and C57BL / 6 mice referred to in steps (1)-(4).

[0052] Table 1 is a difference SNPs information statistical table of chromosome 1 of 11 wild mouse strains (difference SNPs abbreviation table).

[0053]

[0054]

[0055]

[0056] (5) Phenotype screening of wild mice in metabolic, immune and nervous system directions to determine the phenotype difference between wild mice and C57BL / 6 mice;

[0057] (6) Wild mice with increased fat, elevated LDL-C, elevated TG, increased body weight and increased liver fat accumulation were selected as background mice. Among the above wild mice, wild mouse 1 had a significant atherosclerotic phenotype, so wild mice of wild mouse 1 strain were selected for gene editing using CRISPR-Cas9 technology. The specific steps are as follows: CRISPR / Cas9 and gRNA carrying vector (SEQ ID NO. 1: GTAATCCCAGAAGCGGTTCA, SEQ ID NO. 2: CTTCTGGGATTACCTGCGCT) were microinjected into mouse zygotes to cause frameshift mutation of mouse Apoe gene, thereby knocking out Apoe gene and obtaining Apoe knockout mice in wild mouse background.

[0058] Example 2

[0059] This example compares the phenotypes of Apoe knockout mice in C57BL / 6 background (B6-APOE - / - , a widely used atherosclerotic mouse model in the industry, from Jiangsu Jicui Yekang Biotechnology Co., Ltd.) and Apoe knockout mice in wild mouse background (B6-Chr1 YP1 APOE - / - ) constructed in Example 1 under normal feed, including blood lipids and aortic arch plaques (as shown in Figures 2-3 ). Figure 2 Chwo diet is normal diet.

[0060] The triglyceride (TG), total cholesterol (CHOL) and low density lipoprotein cholesterol (LDL-C) of Apoe knockout mice in wild mouse background were significantly increased at 8 weeks and 12 weeks of age (compared with Apoe non-knockout mice in wild mouse background, TG of wild mice at 8 weeks and 12 weeks of age increased by 194.22% and 322.76%, respectively, CHOL increased by 259.88% and 335.48%, respectively, and LDL-C increased by 1033.83% and 1348.68%, respectively).

[0061] The triglyceride (TG), total cholesterol (CHOL) and low density lipoprotein cholesterol (LDL-C) of Apoe knockout mice in wild mouse background were significantly higher than those of Apoe knockout mice in C57BL / 6 background at the same age (8 weeks and 12 weeks of B6-Chr1 YP1 APOE - / - than B6-APOE- / - TG was increased by 76.96% and 59.92%, CHOL was increased by 52.99% and 22.18%, and LDL-C was increased by 50.65% and 21.04%, which is more consistent with the blood lipid changes of atherosclerosis patients.

[0062] The aorta samples of Apoe knockout mice with a wild mouse background and Apoe knockout mice with a C57BL / 6 background were taken to observe whether there were aortic plaques, and the results were compared with those in Figure 4 and Figure 5 As shown in the figures, the Apoe knockout mice with a wild mouse background had obvious aortic plaques at 16 weeks, and the plaque area was significantly higher than that of the Apoe knockout mice with a C57BL / 6 background (B6-APOE - / - ).

[0063] In summary, the method for constructing the atherosclerosis mouse model provided by the present application can obtain a mouse model that can spontaneously develop atherosclerosis symptoms without the need for high-fat diet induction.

[0064] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for constructing a mouse model of atherosclerosis induced by a high-fat diet, characterized by, It comprises the following steps: S1: Whole genome sequencing is performed on a plurality of wild male mice to obtain 100-200 differential SNPs sites different from C57BL / 6 mice; S2: Sperm of the plurality of wild male mice and oocytes of a plurality of C57BL / 6 mice are respectively taken for in vitro fertilization, and a plurality of F1 generation mice are obtained by development; SNPs of the F1 generation mice are detected, a specific chromosome is selected, and the F1 generation mouse closest to the donor wild mouse in the differential SNPs site information on the specific chromosome is selected as a breeding mouse; The specific chromosome is determined according to the following method: whole genome sequencing is performed on a plurality of wild mice to determine the SNPs of each chromosome different from the wild mice and the experimental mice C57BL / 6 mice, and enrichment analysis is performed on the genes of the differential SNPs to determine the chromosome with the most metabolic related gene enrichment; S3: The breeding mouse and the C57BL / 6 mouse are bred, the SNPs site information is detected every generation, and the mouse closest to the wild mouse in the specific chromosome and the C57BL / 6 mouse in the SNPs information on the remaining chromosomes is selected for further breeding; S4: After breeding, the wild mouse with the SNPs site information on the specific chromosome consistent with the wild house mouse and the SNPs information on the other chromosomes consistent with the C57BL / 6 mouse is obtained; S5: The wild mouse meeting the atherosclerosis phenotype is selected from the wild mouse as a gene editing object; the wild mouse is genetically edited to obtain an atherosclerotic mouse model; the genetic editing refers to knocking out the atherosclerosis related gene of the target wild mouse, and the atherosclerosis related gene is at least one selected from the group consisting of Apoe gene, LDL receptor gene and Slfn4 gene.

2. The construction method of claim 1, wherein, The enrichment analysis of the genes of the differential SNPs in the step S2 refers to GO and KEGG enrichment analysis of the genes of the differential SNPs.

3. The construction method of claim 2, wherein, The specific chromosome is chromosome 1.

4. The construction method of claim 1, wherein, The genetic editing technology is at least one selected from the group consisting of CRISPR / Cas9 technology, CRISPR / Cas12a technology, CRISPR / Cas13a technology, artificial nuclease mediated zinc finger nuclease technology, transcription activator-like effector nuclease technology and Cre-loxp gene knockout technology.

5. The construction method according to claim 4, characterized in that, The atherosclerosis phenotype meeting the atherosclerosis phenotype is at least one selected from the group consisting of fat increase, low density lipoprotein cholesterol increase, triglyceride increase, total cholesterol increase, body weight increase, liver fat accumulation increase, artery plaque, artery wall thickening, artery wall hardening and artery lumen stenosis.

6. The construction method of claim 1, wherein, In the step S2, the fertilized egg is transplanted into the oviduct of the surrogate mouse for development.

7. The construction method of claim 6, wherein, The fertilized egg in the prokaryotic stage or the two-cell stage is transplanted into the oviduct of the surrogate mouse for development.

8. The construction method of claim 1, wherein, In the step S4, the breeding generation number is 5-6 generations.

9. Use of the atherosclerotic mouse model constructed by the method for constructing atherosclerotic mouse model without high-fat diet of any one of claims 1-8 in screening drugs for preventing or treating cardiovascular diseases.

10. Use according to claim 9, characterized in that, The cardiovascular diseases are selected from at least one of aortic atherosclerosis, coronary atherosclerosis, coronary atherosclerotic heart disease, carotid atherosclerosis, cerebral atherosclerosis, renal atherosclerosis and atherosclerosis of extremities.

11. Use of the atherosclerotic mouse model constructed by the method for constructing atherosclerotic mouse model without high-fat diet of any one of claims 1-8 in evaluating drugs for preventing or treating cardiovascular diseases.

12. Use according to claim 11, characterized in that, The cardiovascular diseases are selected from at least one of aortic atherosclerosis, coronary atherosclerosis, coronary atherosclerotic heart disease, carotid atherosclerosis, cerebral atherosclerosis, renal atherosclerosis and atherosclerosis of extremities.

13. The use according to claim 11, characterized in that, The cardiovascular diseases are atherosclerosis.

Citation Information

Patent Citations

  • Application of Abcg4 gene in construction of cerebral atherosclerosis with pulmonary enlargement mouse model

    CN117210497A

  • Novel apolipoprotein gene involved in lipid metabolism

    US20030150003A1

Cited By

  • Application of 750 mouse in screening or evaluating medicine for preventing and treating metabolic heart syndrome

    CN122297729A