Application and method of overexpressing PtoCRY2 gene in delaying terminal bud dormancy and promoting wood development in Populus tomentosa

By overexpressing the PtoCRY2 gene in Populus tomentosa, the problems of early terminal bud dormancy and inhibited wood development in poplars under short photoperiods were solved, achieving the effects of extending the growth period and increasing biomass.

CN118147199BActive Publication Date: 2025-09-23SOUTHWEST UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410157902.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-02-04
Publication Date
2025-09-23
Estimated Expiration
2044-02-04

AI Technical Summary

Technical Problem

Existing technologies have not shown that CRY2 gene expression can delay the time when the terminal buds of poplars enter dormancy under short photoperiod conditions, resulting in a shortened tree growth period and inhibited wood development.

Method used

By overexpressing the PtoCRY2 gene and introducing it into Populus tomentosa using Agrobacterium-mediated method, a 35S:FLAG-PtoCRY2 vector was constructed, which promoted the delay of terminal bud dormancy and increased biomass accumulation of Populus tomentosa under short-day conditions.

Benefits of technology

It extends the growth period of poplar, increases biomass, promotes wood development, and enhances the growth and secondary development ability of poplar under short photoperiod.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118147199B_ABST
    Figure CN118147199B_ABST
Patent Text Reader

Abstract

The present invention discloses the application and method of overexpressing the PtoCRY2 gene in delaying the dormancy of the terminal bud of Populus tomentosa and promoting wood development. By transferring the PtoCRY2 gene into wild-type (WT) plants of Populus tomentosa, the plant height and biomass of the PtoCRY2-OE overexpressing plants of Populus tomentosa are significantly increased under short photoperiod conditions compared with the WT plants. Compared with WT, the PtoCRY2-OE overexpressing plants of Populus tomentosa have a longer growth period, which is manifested by the delay in the time of cessation of terminal bud growth and entry into dormancy. This shows that the blue light receptor PtoCRY2 is an important regulatory factor that promotes poplar growth and wood development. The present invention provides ideas and references for promoting poplar wood yield and ecological adaptability using the PtoCRY2 gene, and has important application value in the field of forest genetic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of an overexpressed PtoCRY2 gene in delaying the dormancy of a poplar terminal bud and promoting wood development under short-day conditions, and also to a method for delaying the dormancy of a poplar terminal bud and promoting wood development. Background Art

[0002] Perennial trees in northern and temperate regions exhibit a remarkable cycle of growth and dormancy with the changing seasons, also known as tree phenology, which is meticulously regulated by photoperiod and temperature. Before the onset of winter, the terminal buds of trees undergo a continuous adaptive response, including growth cessation, bud arrest, and dormancy. After the terminal buds enter dormancy, the apical meristem is encased in bud scales to protect against the harsh winter weather. The persistent low temperatures of winter promote the breaking of dormancy, allowing the terminal buds to break green and resume growth upon sensing long-day conditions. Therefore, for trees with pronounced seasonal growth, short photoperiods can shorten the growing season, leading to leaf senescence and shedding. Short photoperiods and low temperatures also inhibit the activity of the vascular cambium and secondary growth in the stems, resulting in distinct seasonal patterns in wood development (growth ring formation), with earlywood forming in spring and summer and latewood in autumn and winter.

[0003] Cryptochrome (CRY) is a major blue light receptor that controls plant growth and development. It mediates the regulation of blue light and photoperiod on plant developmental processes such as growth and flowering. However, there are currently no reports that CRY2 gene expression can delay the onset of dormancy in the terminal bud of poplar trees under short photoperiod conditions (12 hours light / 12 hours dark). Summary of the Invention

[0004] In view of this, one of the purposes of the present invention is to provide an application of overexpressing the PtoCRY2 gene in delaying the dormancy of the terminal bud of Populus tomentosa under short daylight conditions. Increasing the expression of the PtoCRY2 gene of Populus tomentosa by transgenic means can delay the time when the terminal bud of poplar enters dormancy under short photoperiod conditions (12h light / 12h dark), thereby extending the growth period of the tree; at the same time, overexpressing PtoCRY2 promotes wood development and increases the biomass of the plant under short photoperiod conditions; the second purpose of the present invention is to provide an application of overexpressing the PtoCRY2 gene in promoting the accumulation of biomass of Populus tomentosa under short daylight conditions; the third purpose of the present invention is to provide a method for delaying the dormancy of the terminal bud of Populus tomentosa and promoting wood biomass.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] 1. Application of overexpressing the PtoCRY2 gene to delay terminal bud dormancy of Populus tomentosa under short-day conditions. The sequence of the Populus tomentosa PtoCRY2 gene is shown in SEQ ID No. 3.

[0007] Preferably, the method for overexpressing the PtoCRY2 gene is to connect the sequence shown in SEQ ID No. 3 into the XcmI restriction site of the pCXSN-FLAG vector to construct a vector containing the PtoCRY2 gene, referred to as the 35S:FLAG-PtoCRY2 vector; and transform the 35S:FLAG-PtoCRY2 vector into Populus tomentosa through Agrobacterium-mediated transformation to obtain Populus tomentosa overexpressing the PtoCRY2 gene.

[0008] 2. Application of overexpression of the PtoCRY2 gene in promoting biomass accumulation of Populus tomentosa under short-day conditions. The sequence of the Populus tomentosa PtoCRY2 gene is shown in SEQ ID No. 3.

[0009] Preferably, in the present invention, the promoting of Populus tomentosa biomass accumulation is to increase the stem diameter of Populus tomentosa.

[0010] Preferably, the promoting of wood development is to increase the width of the xylem.

[0011] 3. A method for delaying terminal bud dormancy of Populus tomentosa and promoting wood biomass, comprising the following method: transforming Populus tomentosa with a vector overexpressing the PtoCRY2 gene through Agrobacterium-mediated transformation to obtain a transgenic Populus tomentosa that delays terminal bud dormancy and promotes wood biomass; the sequence of the Populus tomentosa PtoCRY2 gene is shown in SEQ ID No. 3.

[0012] Preferably, the vector for overexpressing the PtoCRY2 gene is constructed by ligating the sequence shown in SEQ ID No. 3 into the XcmI restriction site of the pCXSN-FLAG vector to construct a vector containing the PtoCRY2 gene, referred to as 35S:FLAG-PtoCRY2 vector.

[0013] The beneficial effects of the present invention are as follows: by transferring the PtoCRY2 gene into wild-type (WT) plants of Populus tomentosa, the present invention shows no significant difference between the PtoCRY2-OE overexpressing plants and the wild type under normal long photoperiod (LD, 16h light / 8h dark) conditions, while under short photoperiod (SD, 12h light / 12h dark) conditions, the PtoCRY2-OE overexpressing plants show a significant increase in plant height and biomass compared to the WT plants. Compared with the WT, the PtoCRY2-OE overexpressing plants of Populus tomentosa have a longer growth period, which is manifested in a delayed cessation of terminal bud growth and a delayed entry into dormancy. Importantly, overexpression of PtoCRY2 increases the stem thickness of the poplar and forms more xylem under both LD and SD conditions. The above results indicate that the blue light receptor PtoCRY2 is an important regulatory factor in promoting poplar growth and wood development. Plants overexpressing PtoCRY2-OE can reduce the inhibitory effects of short photoperiods on poplar growth and secondary development, making them suitable for growth in regions with earlier onset of short photoperiods, such as high latitudes. This study provides insights and insights into using the PtoCRY2 gene to enhance poplar wood yield and ecological adaptability, and has important applications in forest genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:

[0015] Figure 1 qPCR expression level analysis of PtoCRY2 gene in different Populus tomentosa PtoCRY2-OE overexpression lines.

[0016] Figure 2 Figure 3 Plant phenotypes (A) and fresh weight of aboveground tissue after leaf removal (B) of wild-type (WT) and CRY2-OE overexpressing lines (L1, L2) of Populus tomentosa under long photoperiod conditions (16 h light / 8 h dark) and short photoperiod conditions (12 h light / 12 h dark), respectively.

[0017] Figure 3 Phenotypic diagram (A) and apical bud growth status scoring statistics (B) of wild-type (WT) and CRY2-OE overexpressing lines (L1, L2) of Populus tomentosa when the apical buds stopped growing and entered dormancy after short photoperiod (SD) treatment.

[0018] Figure 4 These are the sections and microscopic observation images of the stems of the wild type (WT) and CRY2-OE overexpressing lines (L1, L2) of Populus tomentosa under long photoperiod conditions (16h light / 8h dark) and short photoperiod conditions (12h light / 12h dark), respectively.

[0019] (A) Transverse sections of the middle (M) and base (B) of the stem of wild-type and transgenic materials; (B) Measurement and statistical analysis of stem diameter; (C) Toluidine blue staining images of transverse sections of the middle (M) of the stem of wild-type and transgenic materials. DETAILED DESCRIPTION

[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0021] Example 1: Construction of an overexpression vector for the PtoCRY2 gene

[0022] The genome sequence of the poplar CRY2 gene was downloaded from the Phytozome database, and the PtoCRY2 gene-specific CDS amplification primers were designed using SnapGene Viewer software.

[0023] Upstream primer: AATGGATAGAAGTAAGACCAT (SEQ ID No. 1);

[0024] Downstream primer: CTAGACAATAAAGTGCAATT (SEQ ID No. 2).

[0025] Using cDNA from mature, three-month-old white poplar leaves as a template, amplification conditions included 98°C pre-denaturation for 2 minutes, 35 cycles of denaturation at 98°C for 10 seconds, annealing at 55°C for 5 seconds, and extension at 72°C for 30 seconds. Finally, a final extension at 72°C for 5 minutes was performed, followed by storage at 4°C. The amplified product was recovered and sequenced to obtain the P. tomentosa PtoCRY2 gene sequence, as shown in SEQ ID No. 3, and the protein sequence as shown in SEQ ID No. 4.

[0026] The overexpression vector pCXSN-FLAG was digested with the restriction endonuclease XcmI in a metal bath at 37°C for approximately 6 hours to recover the pCXSN-FLAG fragment. The PtoCRY2 fragment was mixed with the pCXSN-FLAG backbone and ligated with Solution I ligase. After completion of the ligation reaction at 16°C, competent E. coli cells were transformed and screened to obtain a recombinant expression vector containing the PtoCRY2 sequence (35S:FLAG-PtoCRY2).

[0027] Example 2: Genetic transformation and genotype identification of Populus tomentosa

[0028] Populus tomentosa Carrière was used as the recipient material. The constructed 35S:FLAG-PtoCRY2 overexpression vector was introduced into poplar leaves via the Agrobacterium-mediated leaf disc method. Poplar tissue culture was then performed to screen for positive transgenic plants with corresponding resistance. The specific steps are as follows:

[0029] First, the successfully constructed 35S:FLAG-PtoCRY2 overexpression vector was transformed into Agrobacterium and cultured in a 28°C incubator for 2 days. Single colonies were then picked and cultured in kanamycin-resistant YEP medium at a 1:100 ratio on a shaking incubator at 28°C. The overnight Agrobacterium culture was added to kanamycin-resistant YEP medium at a 1:100 ratio and cultured in a shaking incubator at 28°C until the OD value reached 0.4-0.6. The cells were then centrifuged at 4000 rpm for 10 minutes at 4°C. The cells were harvested, resuspended in a suspension solution, and then added to 30 mL of the suspension solution. The cells were then cultured in a shaking incubator at 28°C for 45 minutes. Poplar leaves were then cut into 4-6 mm leaf discs and inoculated with the Agrobacterium solution for 10 minutes, shaking every 3-5 minutes. After 10 minutes, the surface of the leaf discs was blotted dry with sterile paper and placed on co-cultivation medium. The cells were incubated in the dark for 2 days before being transferred to hygromycin-resistant medium for further culture.

[0030] After obtaining the whole plant, the leaves of the plant were taken, and RNA was extracted from the overexpressing material using a polysaccharide and polyphenol plant total RNA extraction kit and reverse transcribed into cDNA. Quantitative qPCR experiments were performed using specific quantitative primers for PtoCRY2 to detect the expression level of PtoCRY2 in the WT and PtoCRY2-OE transgenic lines of Populus tomentosa. The expression level of PtoCRY2-OE transgenic plants was as follows Figure 1 shown.

[0031] Example 3: Phenotypic Observation of Populus tomentosa Plants

[0032] After culturing wild-type and PtoCRY2-OE-overexpressing Populus tomentosa plants under long-day conditions (16 hours light / 8 hours dark) for two months, some were transferred to short-day conditions (10 hours light / 14 hours dark), while others (the control group) continued to be cultured under long-day conditions. Based on previous studies evaluating terminal bud growth, changes in terminal bud growth in poplars of different genetic backgrounds after short-day treatment were observed, recorded, and evaluated.

[0033] The results are as follows Figure 2As shown in the figure, the plant height of the PtoCRY2-OE material did not change significantly compared with the wild type under long-day conditions. Under short-day conditions, the plant height of the wild type was significantly lower than that of the PtoCRY2-OE, indicating that the PtoCRY2-OE overexpressing material still maintained a good growth state under short-day conditions. At the same time, the fresh weight of the whole plant stem was measured after removing the leaves. It was found that under normal light conditions, the fresh weight of the PtoCRY2-OE overexpressing material was significantly higher than that of the wild type; under short-day conditions, the fresh weight of the wild type was significantly reduced, while the fresh weight of the PtoCRY2-OE overexpressing material was significantly higher than that of the wild type, indicating that the PtoCRY2-OE overexpressing material still has good biomass accumulation under short-day conditions.

[0034] like Figure 3 As shown in the data, after about 20 days of short-day treatment, it was found that the growth cessation and dormancy time of the apical buds of PtoCRY2 materials were delayed compared with those of WT poplars, that is, the apical buds of overexpressing plants still maintained a high growth activity under short-day conditions.

[0035] Example 4: Phenotypic Observation of Populus tomentosa Stem Sections

[0036] The secondary development of Populus tomentosa was analyzed by measuring stem diameter and observing sections. Under long-day and short-day conditions, the stem diameter was measured at the middle and base of the Populus tomentosa stem. Figure 4 As shown in Figures A and B, under long-day conditions, the stem thickness of the PtoCRY2-OE overexpressing material was significantly better than that of the wild type, especially when viewed from the base; under short-day conditions, the stem thickness of the wild type was significantly reduced, and the stem of the PtoCRY2-OE overexpressing material was thicker than that of the wild type, indicating that increasing the expression of PtoCRY2 can weaken the negative regulatory effect of short photoperiod on the secondary development of poplar.

[0037] To further investigate the function of PtoCRY2 gene in mediating photoperiod regulation of xylem development, we used toluidine blue staining to slice and microscopically observe the stems of Populus tomentosa WT and PtoCRY2-OE materials grown under different photoperiod conditions. Figure 4 As shown in middle C, under long-day conditions, the xylem of the PtoCRY2-OE overexpression material is wider than that of the WT. After short-day treatment, the xylem development of the wild type is inhibited, while the xylem of the PtoCRY2-OE overexpression material is still wider than that of the wild type, indicating that the secondary development of the PtoCRY2-OE overexpression material is significantly better than that of the wild type, and better biomass accumulation can be achieved even under short-day conditions.

[0038] In summary, overexpressing the PtoCRY2 gene in Populus tomentosa not only delays the cessation of terminal bud growth and dormancy under short photoperiod conditions, but also maintains stem secondary development under short photoperiod conditions, promoting xylem formation and increasing biomass. The PtoCRY2 gene has great potential for creating new poplar germplasm suitable for cultivation at different latitudes and photoperiods.

[0039] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. Overexpression of PtoCRY2 gene delays the growth of Populus tomentosa under short-day conditions ( Populus tomentosa ) Application in terminal bud dormancy, characterized by: The sequence of the Populus tomentosa PtoCRY2 gene is shown in SEQ ID No.

3.

2. The use according to claim 1, characterized in that: The method for overexpressing the PtoCRY2 gene is to connect the sequence shown in SEQ ID No. 3 into the XcmI restriction site of the pCXSN-FLAG vector to construct a vector containing the PtoCRY2 gene, referred to as the 35S:FLAG-PtoCRY2 vector; and transform the 35S:FLAG-PtoCRY2 vector into Populus tomentosa through Agrobacterium-mediated transformation to obtain Populus tomentosa overexpressing the PtoCRY2 gene.

3. Application of overexpression of the PtoCRY2 gene in promoting biomass accumulation of Populus tomentosa under short-day conditions, characterized by: The sequence of the Populus tomentosa PtoCRY2 gene is shown in SEQ ID No.

3.

4. The use according to claim 3, characterized in that: The promoting of Populus tomentosa biomass accumulation is to increase the stem diameter of Populus tomentosa.

5. A method for delaying the dormancy of the terminal bud of Populus tomentosa and promoting the accumulation of wood biomass, characterized in that: The method comprises the following steps: transforming a vector for overexpressing the PtoCRY2 gene into Populus tomentosa through Agrobacterium-mediated transformation to obtain a transgenic Populus tomentosa having delayed terminal bud dormancy and promoted wood biomass accumulation; the sequence of the Populus tomentosa PtoCRY2 gene is shown in SEQ ID No.

3.

6. The method according to claim 5, characterized in that: The vector for overexpressing the PtoCRY2 gene is constructed by connecting the sequence shown in SEQ ID No. 3 into the XcmI restriction site of the pCXSN-FLAG vector to construct a vector containing the PtoCRY2 gene, referred to as the 35S:FLAG-PtoCRY2 vector.

Citation Information

Patent Citations

  • Application and method of knockout poplar LUX1 gene in maintaining bud growth and wood development under short day

    CN120272491A