A method for quantitatively detecting purity of rice variety Longdao 208 based on molecular biology and a detection kit thereof

By designing specific primers and probes, utilizing SNP markers on chromosome 5 of the rice genome, and combining quantitative real-time PCR and HRM detection, the problem of quantitative detection of the Longdao 208 rice variety was solved, achieving rapid and accurate variety identification.

CN118147338BActive Publication Date: 2026-07-03WILMAR SHANGHAI BIOTECH RES & DEV CENT

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WILMAR SHANGHAI BIOTECH RES & DEV CENT
Filing Date
2022-12-05
Publication Date
2026-07-03

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a rice SNP marker of Longdao 208 rice and application thereof. Wherein, the SNP marker site is the deletion of TATAAATCTTG before the 6372872th position of the 5th chromosome of a rice genome. The SNP marker of the application is closely related to a rice variety, and can be effectively used for qualitative or quantitative detection of the Longdao 208 rice variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to SNP markers and their applications, and more particularly to a molecular biology-based method for quantitatively detecting the purity of the Longdao 208 rice variety and its detection kit. Background Technology

[0002] Longdao 208 is a japonica conventional rice variety bred by the Cultivation Research Institute of the Heilongjiang Academy of Agricultural Sciences. It is a fragrant rice variety suitable for planting in areas of Heilongjiang Province with an accumulated temperature of ≥10℃ and an accumulated temperature of 2800℃. This variety meets the national rice variety approval standards and was approved in Heilongjiang Province in 2020, with the approval number: Heishendao 20200051. This variety has 14 leaves on the main stem, is long-grained, with a plant height of approximately 100.3 cm, a panicle length of approximately 20.8 cm, approximately 130 grains per panicle, and a thousand-grain weight of approximately 26.5 grams.

[0003] This variety was bred using Wuyoudao 4 as the female parent and Suijing 4 as the male parent through pedigree selection. Its grain shape is identical to Wuyoudao 4, making it difficult to distinguish from it sensorily. Wuyoudao 4, also known as Daohuaxiang 2, is of high quality and highly favored by consumers, with increasing demand. However, its low yield and high price have led some to adulterate it with rice varieties like Longdao 208, which have similar grain shapes, for sale. Therefore, finding a simple, accurate, and quick way to identify Longdao 208 within Wuyoudao 4 remains a challenge.

[0004] The main methods for identifying Longdao 208 rice are through taste tests and chewing evaluations. However, these methods are highly subjective, have poor accuracy, and are difficult to use for quantitative detection of Longdao 208 purity. Rice variety identification can be performed using the SSR marker method (NY / T 1433-2014) or the SNP marker method (NY / T 2745-2015), but these methods are cumbersome, time-consuming, and only allow for qualitative purity testing, not quantitative detection of adulteration. Rice companies have a specific need for variety identification when purchasing paddy rice, hoping for a simple, easy-to-operate, and quick method to identify rice varieties to ensure the purity of the purchased paddy rice. Summary of the Invention

[0005] This invention proposes a SNP marker related to the Longdao 208 rice variety that can be effectively used for rice variety detection. Using this SNP marker, highly efficient and sensitive Longdao 208 rice-specific primers and probes are designed to detect sample DNA, thereby achieving quantitative determination of the purity of the Longdao 208 rice variety and effectively solving the problem of quantitative identification of other rice varieties mixed in with the Longdao 208 rice variety.

[0006] Specifically, the present invention provides an isolated nucleic acid molecule from rice containing an SNP marker at the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome.

[0007] In one or more embodiments, the nucleic acid molecule is a fragment with a length of at least 5 bp. In one or more embodiments, the nucleic acid molecule has a length of at least 10 bp, 15 bp, 20 bp, 30 bp, 40 bp, 50 bp, 64 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 640 bp, 700 bp, 800 bp, 900 bp, or 1 kb. In one or more embodiments, the nucleic acid molecule has a length of 10 bp-640 bp, 50-500 bp, 100-400 bp, 150-300 bp, or 200-250 bp.

[0008] In one or more embodiments, the nucleotide sequence of the nucleic acid molecule includes at least the nucleotide sequence shown in SEQ ID NO:5 or 6.

[0009] In one or more embodiments, the nucleotide sequence of the nucleic acid molecule includes a sequence extending from one or both ends of SEQ ID NO:6, the sequence preferably having 103 bp, and the sequence may, for example, include the sequence shown in SEQ ID NO:7.

[0010] TTTAAATTAAACCGGTACATATAGGTTTGTCCCGTAGTGGCCGAATGAACTATAGATGCCTCTTTTTTTGTTAATAACCAGAACCTAAAGTATTGGTGCCGGTTTTGTCCTAACCCGCACTTAATAATTGATAA TAGGGTGCCAGTTTTGCTTTAAACCTGTATCTTTAGGCTGGTACCTATTTAGAATTCCGTAGTAGCGGTGGTTACCGCGATAACTACGCGGTTATCGCGAGATATATCATGGTTTTTAAAAACTGAAAAGGTTACCAC ACGTGATAACCGCGATAACCACACGGTCTGTTTCTGCGATCTTGTAAAATATAACCATGACAAACAATAGATCAATCCGGAGTTTCAACCTAATCGACCTAGCGGCCAACATCGCGAATGGGCTAGAATTGAAGT TTTCAACCGCACCAGCCTTTCCTAACCAAATCACAATGAATTTATGGGCATGTAATTTATACCCTTTTCATATAATATCATTGTTTTCCTTTTTTCTAAAAAAAAGCTCATACTACTATGCTTATATACTTATCTC TATAAATGTACACACATGTATCATACATTATAATTACCTCTGAAGATTAGA

[0011] The present invention also provides primers for detecting SNP markers in the rice genome, wherein the SNP marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome.

[0012] In one or more embodiments, the SNP is defined as the deletion of 11 bases TATAAATCTTG before the 42nd nucleotide from the 5' end in the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO: 1 and 2 as primers.

[0013] In one or more embodiments, the primers are selected from: (1) the sequences shown in SEQ ID NO:1 and 2 or sequences that hybridize with SEQ ID NO:5 or 6 under stringent conditions or sequences that have at least 90% identity with them; (2) mixtures of the sequences shown in SEQ ID NO:1 and SEQ ID NO:2.

[0014] The present invention also provides a probe for detecting SNP markers in the rice genome, wherein the SNP marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome.

[0015] In one or more embodiments, the SNP is defined as the deletion of 11 bases TATAAATCTTG before the 42nd nucleotide from the 5' end in the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO: 1 and 2 as primers.

[0016] In one or more embodiments, the probe includes (1) a non-Longdao 208 rice probe that identifies SEQ ID NO:5 or a fragment thereof, the fragment containing the first 11 bases TATAAATCTTG from the 42nd position of SEQ ID NO:5 starting from the 5' end.

[0017] In one or more embodiments, the probe further includes (2) a Longdao 208 rice probe that identifies SEQ ID NO:6 or a fragment thereof, the fragment being missing the first 11 bases TATAAATCTTG from the 42nd position from the 5' end of SEQ ID NO:5.

[0018] In one or more embodiments, the probe recognizes SEQ ID NO:5 or 6 or a fragment thereof, the fragment containing or lacking the first 11 bases TATAAATCTTG from position 42 of SEQ ID NO:5 at the 5' end. Exemplarily, the probe comprises one or more of the following: (1) a probe recognizing SEQ ID NO:5 or a fragment thereof, the fragment containing the first 11 bases TATAAATCTTG from position 42 of SEQ ID NO:5 at the 5' end; (2) a probe recognizing SEQ ID NO:6 or a fragment thereof, the fragment lacking the first 11 bases TATAAATCTTG from position 42 of SEQ ID NO:5 at the 5' end; (3) a complementary sequence to (1) or (2). Preferably, the probe has the nucleotide sequence shown in (1) SEQ ID NO:3 or 4, or a sequence that hybridizes to any of SEQ ID NO:5-6 under highly stringent conditions, or a mutant having 70% sequence identity with it, or the complementary sequence to (2) (1).

[0019] The present invention also provides a kit containing reagents for detecting SNP markers in the rice genome, wherein the SNP marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome.

[0020] In one or more embodiments, the SNP is defined as the deletion of the first 11 bases TATAAATCTTG from the 42nd position (starting from the 5' end) in the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO: 1 and 2 as primers.

[0021] In one or more embodiments, the kit comprises primers for detecting SNP markers and optionally probes for detecting SNP markers and optionally nucleic acid molecules with SNP markers.

[0022] In one or more embodiments, the kit comprises: primers as described in any embodiment herein, optionally probes as described in any embodiment herein, and optionally nucleic acid molecules as described in any embodiment herein.

[0023] In one or more embodiments, the kit comprises: the sequence shown in SEQ ID NO:1 and 2 or the sequence hybridizing with SEQ ID NO:5 or 6 under stringent conditions or the sequence having at least 90% identity with it or the complementary sequence thereof, and optionally a nucleic acid molecule whose nucleotide sequence includes at least the nucleotide sequence shown in SEQ ID NO:5 or 6 or the complementary sequence thereof.

[0024] In one or more embodiments, the kit further comprises: the sequence shown in SEQ ID NO:1 and 2 or a sequence hybridizing with SEQ ID NO:5 or 6 under stringent conditions or a sequence having at least 90% identity with it or a complementary sequence thereof, and optionally the nucleotide sequence shown in SEQ ID NO:3 or 4 or a sequence hybridizing with any of SEQ ID NO:5-6 under stringent conditions or a mutant having 70% sequence identity with it or a complementary sequence thereof.

[0025] The present invention also provides a method for identifying rice varieties, comprising (1) detecting a SNP marker in the rice genome, the site being a deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome, and (2) identifying the rice variety based on the SNP, wherein if the SNP is a deletion of TATAAATCTTG, it is identified as Longdao 208 rice, otherwise it is identified as non-Longdao 208 rice.

[0026] In one or more embodiments, the SNP is defined as the deletion of the first 11 bases TATAAATCTTG from the 42nd position (starting from the 5' end) in the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO: 1 and 2 as primers.

[0027] In one or more embodiments, the method further includes identifying rice varieties based on detected SNPs, wherein the SNP of Longdao 208 rice is the deletion of TATAAATCTTG, and the SNP of non-Longdao 208 rice is the non-deletion of TATAAATCTTG.

[0028] In one or more embodiments, the detection comprises PCR, more preferably, the detection is quantitative real-time PCR or HRM detection.

[0029] The present invention also provides a method for detecting the content or purity of Longdao 208 rice in a sample, the method comprising the step of amplifying the sequence of SNP markers in the rice genome, wherein the SNP site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome.

[0030] In one or more embodiments, the SNP is defined as the deletion of the first 11 bases TATAAATCTTG from the 42nd position (starting from the 5' end) in the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO: 1 and 2 as primers.

[0031] In one or more embodiments, the method further includes determining the content or purity of Longdao 208 rice based on the amplification results of SNP markers. Wherein, amplification results for SNPs lacking TATAAATCTTG indicate the content or purity of Longdao 208 rice; amplification results for SNPs containing TATAAATCTTG indicate the content or proportion of non-Longdao 208 rice.

[0032] In one or more embodiments, the amplification is quantitative real-time PCR, and the method further includes using 2... -ΔΔCT The method was used to determine the content or purity of Longdao 208 rice.

[0033] More preferably, the 2- ΔΔCT The method includes: comparing the CT value of the probe that identifies the SNP marker in the sample with the CT value of the endogenous reference probe, and comparing the comparison result with the ΔCT of the control, and using the obtained ΔCT to determine the content or purity of Longdao 208 rice.

[0034] Specifically, the method for detecting the content or purity of Longdao 208 rice in a sample includes: detecting the CT value of the probe recognizing the SNP marker and the CT value of the probe recognizing the endogenous reference using quantitative real-time PCR; subtracting the two values ​​to obtain the sample ΔCT; subtracting the sample ΔCT from the control ΔCT to obtain ΔΔCT, where the control is a 100% Longdao 208 rice sample or a 100% non-Longdao 208 rice sample; and raising the negative number of ΔΔCT to the square to obtain a relative content value, which is used for quantitative determination of Longdao 208 rice and non-Longdao 208 rice in the sample. In one or more embodiments, the probe recognizing the SNP marker has the nucleotide sequence shown in SEQ ID NO:3 or 4. In one or more embodiments, the probe recognizing the endogenous reference has the nucleotide sequence shown in SEQ ID NO:10.

[0035] The present invention also provides the use of reagents for detecting SNP markers in the rice genome in identifying rice varieties or detecting the content or purity of Longdao 208 rice in rice, or in preparing kits for identifying rice varieties or detecting the content or purity of Longdao 208 rice in rice, wherein the SNP marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome.

[0036] In one or more embodiments, the SNP is defined as the deletion of the first 11 bases TATAAATCTTG from the 42nd position (starting from the 5' end) in the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO: 1 and 2 as primers.

[0037] In one or more embodiments, the reagent comprises primers as described in any embodiment herein and optionally probes as described in any embodiment herein and optionally nucleic acid molecules as described in any embodiment herein.

[0038] In one or more embodiments, rice varieties are identified based on detected SNPs, wherein the SNP of Longdao 208 rice is the deletion of TATAAATCTTG, and the SNP of non-Longdao 208 rice is the non-deletion of TATAAATCTTG. Attached Figure Description

[0039] Figure 1 : Primer and probe positions for HRM detection and fluorescence probe method in Longdao 208 rice and non-Longdao 208 rice.

[0040] Figure 2 HRM classification diagram of Longdao 208 rice and other non-Longdao 208 rice varieties.

[0041] Figure 3Graphs showing quantitative data of different content standards in Longdao 208 rice and non-Longdao 208 rice. Graph A, from left to right: 0% Longdao 208 rice standard, 5% Longdao 208 rice standard, 50% Longdao 208 rice standard, 95% Longdao 208 rice standard, 100% Longdao 208 rice standard. Graph B, from left to right: 100% non-Longdao 208 rice standard, 95% non-Longdao 208 rice standard, 50% non-Longdao 208 rice standard, 5% non-Longdao 208 rice standard, 0% non-Longdao 208 rice standard.

[0042] Figure 4 Purity test of Longdao 208 rice blind samples. From left to right: 0% Longdao 208 standard sample, 5% Longdao 208 standard sample, 50% Longdao 208 standard sample, 95% Longdao 208 standard sample, 100% Longdao 208 standard sample, and sample 1. Detailed Implementation

[0043] The inventors used SSR high-throughput sequencing of the Longdao 208 rice variety to identify specific sequences that distinguish Longdao 208 rice from other rice varieties. By specifically detecting the nucleic acid sequences of specific sites in Longdao 208 rice compared with those of other rice varieties, they determined whether other rice varieties had been adulterated in Longdao 208 rice. They also introduced endogenous reference genes and reference samples to conduct quantitative analysis of adulteration in Longdao 208 rice.

[0044] Specifically, the present invention relates to SNP markers related to rice varieties, primers and kits for detecting the SNP markers, the use of the SNP markers, primers and kits in rice variety detection, and methods for detecting rice varieties.

[0045] The inventors discovered that the deletion or absence of the SNP TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome is associated with rice varieties. Specifically, the SNP is the deletion of the first 11 bases from position 42 on the 5' end of the nucleotide sequence shown below.

[0046] Specifically, it can be represented by the following sequence:

[0047] CACGTGATAACCGCGATAACCACACGGTCT###########GTTTCTGCGA TCTTGTAAAATATAACCATGACAAACAATAGATCAATCCGGAGTTTCAACC TAATCGACCTAG, where "###########" represents whether "TATAAATCTTG" is missing or not.

[0048] The sequence of the common rice genome contains "TATAAATCTTG", as shown below:

[0049] CACGTGATAACCGCGATAACCACACGGTCTTATAAATCTTGGTTTCTGC GATCTTGTAAAATATAACCATGACAAACAATAGATCAATCCGGAGTTTCAA CCTAATCGACCTAG(SEQ ID NO:5)

[0050] The Longdao 208 rice genome contains the sequence deletion "TATAAATCTTG", as shown below:

[0051] CACGTGATAACCGCGATAACCACACGGTCTGTTTCTGCGATCTTGTAAA ATATAACCATGACAAACAATAGATCAATCCGGAGTTTCAACCTAATCGACC TAG(SEQ ID NO:6)

[0052] In this article, SNP (single nucleotide polymorphism) is a type of molecular genetic marker, mainly referring to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level. SNP polymorphism typically involves variations in only a single base, such as transitions, transversions, insertions, and deletions.

[0053] In this article, rice varieties refer to rice lines that have been bred to have different traits. The inventors discovered that the SNP of Longdao 208 rice is the deletion of TATAAATCTTG, while the SNP of non-Longdao 208 rice is not deleted. Therefore, by detecting the above SNPs in the sample, it is possible to effectively determine whether the rice variety is Longdao 208 or not.

[0054] The term "sample" as used herein refers to any type of polynucleotide-containing sample derived from the object. Preferably, the sample described herein is derived from or contains rice plant organs, tissues, cells, nucleic acids, or products containing rice plant organs, tissues, cells, nucleic acids, including but not limited to rice leaves, roots, stems, flowers, fruits, seeds, cells, DNA, RNA, rice, broken rice, rice bran, rice husks, and processed or unprocessed rice foods such as rice noodles or rice vermicelli. The DNA may be genomic DNA.

[0055] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleotides (DNA) or ribonucleotide polymers (RNA) in single-stranded or double-stranded form, and their complements. Nucleic acids contain synthetic, non-natural, or modified nucleotide bases. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms thereof. Examples of polynucleotides considered herein include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules having mixtures of single-stranded and double-stranded DNA and RNA. DNA can be a coding strand or a non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining and fragmenting genomic DNA are well known in the art.

[0056] The basic building blocks of DNA are deoxyribonucleotides, which are chain-like molecules formed by phosphodiester condensation. Each deoxyribonucleotide consists of a phosphate group, a deoxyribose sugar, and a base. The main bases (bp) of DNA are adenine (A), guanine (G), cytosine (C), and thymine (T). In the double helix structure of double-stranded DNA, A and T are paired by hydrogen bonds, and G and C are paired by hydrogen bonds. DNA can take the form of cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DNA can be of any length, for example, 50-500 bp, 100-400 bp, 150-300 bp, or 200-250 bp.

[0057] The term "primer" as used herein refers to a nucleic acid molecule with a specific nucleotide sequence that guides the synthesis of nucleotides at the initiation of nucleotide polymerization. Primer compositions contain one or more primers. Primers are typically two artificially synthesized oligonucleotide sequences; one primer is complementary to one DNA template strand at one end of the target region, and the other primer is complementary to another DNA template strand at the other end of the target region. Their function is to serve as the initiation point for nucleotide polymerization. Artificially designed primers are widely used in polymerase chain reaction (PCR), qPCR, sequencing, and probe synthesis. Primers can be of any length, such as 5-200 bp, 10-100 bp, 20-800 bp, or 25-50 bp.

[0058] The primers of this invention are used for the detection of SNPs. The primers may be nucleic acid molecules that recognize any of SEQ ID NO:5-6. In some embodiments, the primers have (1) the nucleotide sequence shown in any of SEQ ID NO:1-2 or a mutant having at least 70% sequence identity with it, or (2) the complementary sequence of (1). In one or more embodiments, the primers are primer pairs having sequences shown in SEQ ID NO:1 and 2, respectively. When discussing primers, the “recognition” primers described herein hybridize with the template sequence under stringent or highly stringent conditions, and the fragment amplified by the paired primers covers or omits the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5. The stringent conditions for nucleic acid hybridization described herein are known to those skilled in the art. Preferably, the conditions are such that the sequences are at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% homologous to each other, and generally remain hybridized to each other. Non-limiting examples of stringent hybridization conditions include hybridization at 65°C in a high-salt buffer containing 6xSSC, 50 mM Tris-HCl (pH 7.5), 1 mM MEDTA, 0.02% PVP, 0.02% Ficolll, 0.02% BSA, and 500 mg / ml denatured salmon sperm DNA, followed by optional washing once or twice at 50°C in 0.2xSSC and 0.01% BSA.

[0059] This invention can also employ probes to detect the SNPs described herein. The term "probe" as used herein refers to a nucleic acid sequence (DNA or RNA) that recognizes a target sequence (complementary to the target sequence). The probe binds to the target gene through molecular hybridization, generating a hybridization signal that reveals the target gene. The probe may include the entire target sequence or a fragment of the target sequence. The probe may be DNA or RNA transcribed from it. Typically, the probe carries a detection label, such as a fluorescent label. Such fluorescent labels include, but are not limited to, FAM, CY5, and VIC. Fluorescent labels suitable for the probes described herein and methods for ligating them to the probes are known in the art.

[0060] In this document, the probe includes a non-Longdao 208 rice probe that identifies SEQ ID NO:5 or a fragment thereof, the fragment containing the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5. Optionally, the probe may also include a Longdao 208 rice probe that identifies SEQ ID NO:6 or a fragment thereof, the fragment lacking the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5.

[0061] In one or more embodiments, the probe includes (1) a non-Longdao 208 rice probe that identifies SEQ ID NO:5 or a fragment thereof, said fragment containing the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5. The probe may also include (2) a Longdao 208 rice probe that identifies SEQ ID NO:6 or a fragment thereof, said fragment lacking the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5.

[0062] Exemplarily, the probe includes one or more selected from: (1) a probe that recognizes SEQ ID NO:5 or a fragment thereof, the fragment containing the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5; (2) a probe that recognizes SEQ ID NO:6 or a fragment thereof, the fragment lacking the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5; and (3) a complementary sequence to (1) or (2). When discussing probes, “recognition” as used herein means that the probe hybridizes with the template sequence under stringent or highly stringent conditions, and that the hybridization covers or omits the base TATAAATCTTG preceding position 42 from the 5' end of SEQ ID NO:5.

[0063] The term "variant" or "mutant" in this document refers to a polynucleotide whose nucleic acid sequence is altered compared to a reference sequence by the insertion, deletion, or substitution of one or more nucleotides while retaining its ability to hybridize with other nucleic acids. Mutants described in any embodiment of this document include nucleotide sequences having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity with reference sequences (such as SEQ ID NO: 1-8 described herein) and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, NCBI's BLASTn. Mutants also include nucleotide sequences having one or more mutations (insertions, deletions, or substitutions) in the reference sequence and nucleotide sequences while still retaining the biological activity of the reference sequence. The multiple mutations typically refer to 1-10, for example 1-8, 1-5, or 1-3. Substitutions can be substitutions between purine nucleotides and pyrimidine nucleotides, or substitutions between purine nucleotides or between pyrimidine nucleotides. Substitutions are preferably conserved substitutions. For example, in the art, conservative substitution with nucleotides of similar or identical properties generally does not alter the stability and function of polynucleotides. Conservative substitutions include, for example, the interchange of purine nucleotides (A and G) and pyrimidine nucleotides (T or U and C). Therefore, replacing one or more sites in the polynucleotides of the present invention with residues from the same source will not substantially affect their activity. When referring to mutants having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% sequence identity with the primers (e.g., SEQ ID NO: 1-2) or probes (e.g., SEQ ID NO: 3-4) described in the present invention, preferably, these mutants can hybridize with the corresponding DNA sequence containing SEQ ID NO: 5 or 6 under highly stringent conditions. These highly stringent conditions may be hybridization and washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0064] Another aspect of the present invention provides a method for detecting rice varieties in a sample, comprising identifying or quantifying the rice variety by detecting the SNP markers described herein in the sample to be tested. The method further comprises: (1) extracting DNA from the sample to be tested; (2) identifying or quantifying the genotype of the SNP markers described herein in the DNA using the primers and / or probes described herein; and (3) identifying or quantifying the rice variety based on the result of (2). The rice variety with the SNP deletion TATAAATCTTG is Longdao 208 rice. Longdao 208 rice can be detected and identified using conventional SNP detection methods in the art, such as quantitative fluorescent probe assay or HRM high-resolution melting curve assay, the procedures and reagents of which are well known in the art.

[0065] In one or more embodiments, the non-Longdao 208 rice group includes: Wuyoudao No. 4, Liaoxing No. 1, Longyang 16, Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao No. 1, Longqingdao 21, Qijing 10 and Nanjing 9108, etc.

[0066] In this paper, the method for extracting DNA from samples is not particularly limited, and DNA extraction methods known in the art and applicable to this paper are applicable.

[0067] The SNP marker detection methods known in the art and applicable to this paper include, but are not limited to: sequencing, single-strand conformation polymorphism polymerase chain reaction (PCR-SSCP), real-time quantitative PCR with high-resolution melting curve analysis (HRM), fluorescent probe-based quantitative PCR, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP), and time-of-flight mass spectrometry. Other reagents required for SNP marker detection methods, besides primers and / or probes, are also known in the art.

[0068] According to some specific examples of the present invention, a method for determining or quantifying rice varieties by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; performing quantitative real-time PCR on the DNA using primers SEQ ID NO:1 and 2 to obtain amplification products; performing HRM analysis on the amplification products to obtain the genotype of the SNP markers described herein in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP markers.

[0069] According to other specific examples of the present invention, a method for determining or quantifying rice varieties by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; performing quantitative real-time PCR on the DNA using primers SEQ ID NO:1 and 2, probes SEQ ID NO:3 and 4, and a reference probe SEQ ID NO:10; analyzing the PCR results to obtain the genotype of the SNP markers described herein in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP markers.

[0070] For example, a method for detecting the content or purity of Longdao 208 rice in a sample includes: detecting the CT value of a probe recognizing an SNP marker and the CT value of a probe recognizing an endogenous reference using quantitative real-time PCR; subtracting the two values ​​to obtain the sample ΔCT; subtracting the sample ΔCT from the control ΔCT to obtain ΔΔCT, where the control is a 100% Longdao 208 rice sample or a 100% non-Longdao 208 rice sample; and raising the negative of ΔΔCT to the square to obtain a relative content value, used for quantitative determination of Longdao 208 rice and non-Longdao 208 rice in the sample. In one or more embodiments, the probe recognizing the SNP marker has the nucleotide sequence shown in SEQ ID NO:3 or 4. In one or more embodiments, the probe recognizing the endogenous reference has the nucleotide sequence shown in SEQ ID NO:10.

[0071] The present invention also provides a kit containing reagents for detecting SNP markers in the rice genome of the present invention, wherein the rice genome SNP markers are: the amplification products obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:1 and 2 as primers, containing or deleting the base TATAAATCTTG before position 42 from the 5' end of SEQ ID NO:5. The reagents may be primers and / or probes as described in any embodiment herein. Optionally, the kit also includes the nucleic acid molecule (i.e., the amplification product) described in the present invention, which may be used as an internal standard or positive control. Preferably, the primers are selected from: (1) sequences shown in SEQ ID NO:1 and 2 or sequences having at least 90% identity with them; (2) mixtures of (1) the sequences or complementary sequences. The probes are selected from: (1) sequences shown in SEQ ID NO:3 and 4 or sequences having at least 90% identity with them; (2) complementary sequences of (1) the sequences. Preferably, the probes are fluorescently labeled, such as by FAM fluorescence, VIC fluorescence and CY5 fluorescence, respectively. The kit may also contain various reagents required for PCR, such as buffers, enzymes, and dNTPs.

[0072] In a preferred embodiment, the kit of the present invention contains the primer sequences shown in SEQ ID NO:1 and 2. In another preferred embodiment, the kit of the present invention contains the probe shown in SEQ ID NO:3, which is labeled with FAM fluorescence; the probe shown in SEQ ID NO:4, which is labeled with VIC fluorescence; and the probe shown in SEQ ID NO:10, which is labeled with CY5 fluorescence.

[0073] Advantages of the SNP tag and its application in this invention:

[0074] This invention can qualitatively or quantitatively detect the adulteration of Longdao 208 rice varieties with other rice varieties. It utilizes molecular biology methods to quantitatively detect adulteration in Longdao 208 rice, applicable to rice seeds, rice, and finished rice products. DNA is rapidly extracted from samples, and quantitative real-time PCR amplification is performed using a developed, highly efficient, and sensitive Longdao 208-specific fluorescent probe and primers. By setting an endogenous reference gene and a reference sample, the amplification data is quantitatively analyzed to quantitatively determine the purity of Longdao 208 rice. The results are intuitive and objective, avoiding human judgment. The operation is convenient and quick, with a quantification limit of 5%, greatly reducing the probability of misjudgment. It is unaffected by variety, region, or environment, making the detection more sensitive and efficient.

[0075] The present invention will be described below by way of specific embodiments. It should be understood that these embodiments are merely illustrative and are not intended to limit the scope of the invention. Materials, reagents, and methods not specifically described in the embodiments are not conventional materials, reagents, and methods in the art.

[0076] Example

[0077] Example 1: Materials and Methods

[0078] 1. Materials

[0079] Longdao 208 rice seeds, other rice variety seeds, and rice samples were all obtained through commercial purchase.

[0080] 2. Enzymes and reagents

[0081] 2×GoldStar Best MasterMix enzymes were purchased from Kangwei Century Company, SsoAdvancedTM Green Supermix enzymes were purchased from Bio-Rad, reagents were purchased from Sinopharm Chemical Reagent Co., Ltd., and a Bio-Rad CFX96 real-time PCR instrument was used. Primers and probes used in the experiment were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0082] 3. Experimental Methods

[0083] 3.1 DNA extraction from rice seeds

[0084] Grind 20g of rice seeds using a grinder, weigh 50mg of powder into a 2mL sample lysis tube, add 500μL of Buffer 1 (0.4M NaCl, 0.1% SDS, 0.1M Tris, 0.5% high-temperature amylase (purchased from Shandong Longda Biotechnology Co., Ltd.), pH 8.0), vortex to mix for 30s, incubate at 52℃ for 30min at 12000rpm; add 500μL of Buffer 2 (0.1M Tris-HCl, pH 7.0), vortex to mix for 30s, centrifuge the mixture for 5min (12000rpm), and aspirate 500μL of the supernatant for later use. Dilute the extracted DNA solution 10-fold with sterile pure water to obtain template DNA, place it in a sample dilution tube for later use, store at 4℃ for short-term storage, and store at -20℃ for long-term storage.

[0085] 3.2 Design of rice-specific primers and probes for Longdao 208

[0086] Specific primers were designed for the Longdao 208 rice variety using Primer5.

[0087] HRM high-resolution melting curve method for primer detection:

[0088] LD208-209-DF2: 5'-CACGTGATAACCGCGATAAC-3' (SEQ ID NO: 1);

[0089] LD208-209-DR2: 5'-CTAGGTCGATTAGGTTGAAAACTC-3 (SEQ ID NO: 2);

[0090] Primers for probe detection:

[0091] LD208-209-DF2: 5'-CACGTGATAACCGCGATAAC-3' (SEQ ID NO: 1);

[0092] LD208-209-DR2: 5'-CTAGGTCGATTAGGTTGAAAACTC-3 (SEQ ID NO: 2);

[0093] Design probes:

[0094] FLD208-209-FAM-P2: 5'-FAM–CACGGTCTTATAAATCTTGGTTTCTG–BHQ1 -3' (SEQ IDNO: 3);

[0095] LD208-209-VIC-P3: 5'-VIC-CACGGTCTGTTTCTGCGATC-BHQ1-3' (SEQ ID NO: 4).

[0096] HRM high-resolution melting curve method for detecting primer amplification fragments:

[0097] Nucleic acid sequence of non-Longdao 208 rice (114bp):

[0098] CACGTGATAACCGCGATAACCACACGGTCTTATAAATCTTGGTTTCTG CGATCTTGTAAAATATAACCATGACAAACAATAGATCAATCCGGAGTTTCA ACCTAATCGACCTAG (SEQ ID NO: 5, Figure 1 )

[0099] Longdao 208 rice nucleic acid sequence (103bp):

[0100] CACGTGATAACCGCGATAACCACACGGTCTGTTTCTGCGATCTTGTAA AATATAACCATGACAAACAATAGATCAATCCGGAGTTTCAACCTAATCGAC CTAG (SEQ ID NO: 6, Figure 1 )

[0101] Probe-based detection of primer amplification fragments:

[0102] Nucleic acid sequence of non-Longdao 208 rice (114bp):

[0103] CACGTGATAACCGCGATAACCACACGGTCTTATAAATCTTGGTTTCTG CGATCTTGTAAAATATAACCATGACAAACAATAGATCAATCCGGAGTTTCA ACCTAATCGACCTAG (SEQ ID NO: 5, Figure 1 )

[0104] Longdao 208 rice nucleic acid sequence (103bp):

[0105] CACGTGATAACCGCGATAACCACACGGTCTGTTTCTGCGATCTTGTAA AATATAACCATGACAAACAATAGATCAATCCGGAGTTTCAACCTAATCGAC CTAG (SEQ ID NO: 6, Figure 1 )

[0106] Rice endogenous gene PLD primers:

[0107] PLD-F: 5'-TGGTGAGCGTTTTGCAGTCT-3' (SEQ ID NO: 8);

[0108] PLD-R: 5'-CTGATCCACTAGCAGGAGGTCC-3' (SEQ ID NO: 9).

[0109] Rice endogenous gene actin probe:

[0110] PLD-CY5-P: 5'-CY5-TGTTGTGCTGCCAATGTGGCCTG-BHQ1-3'. (SEQ ID NO:10).

[0111] Example 2: Real-time quantitative PCR detection using HRM high-resolution melting curve method

[0112] Using extracted DNA as a template, real-time quantitative PCR amplification of primer pairs LD208-209-DF2 and LD208-209-DR2 was performed using the HRM high-resolution melting curve method. The PCR reaction volume was 20 μL, containing SsoAdvanced™ 10 μL Green Supermix, 0.5 μL each of LD208-209-DF2 and LD208-209-DR2 primers (10 μM), 2 μL template DNA (50-100 ng / μL), and sterile water to a final volume of 20 μL. For the blank control, sterile water was used instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds; 60°C annealing extension for 1 minute, for a total of 45 cycles.

[0113] After real-time fluorescence PCR amplification, the amplified products were directly read using Bio-Rad for high-resolution HRM melting curve reading. The HRM high-resolution melting curve melting process was as follows: 95℃ for 1 min, 70℃ for 1 min, and then the temperature was increased from 70℃ to 95℃ at a rate of 0.2℃ / 0.1s. The melting curve data were collected and used for HRM high-resolution melting curve typing in Precision Melt Analysis Software.

[0114] Using DNA extracted from different rice varieties as templates, real-time quantitative PCR amplification of primer pairs LD208-209-DF2 and LD208-209-DR2 was performed using the HRM high-resolution melting curve method. HRM high-resolution melting curves were then read and analyzed using Precision Melt Analysis Software for HRM high-resolution melting curve genotyping. The results showed ( Figure 2 Longdao 208 rice variety has a unique HRM curve, which is different from the HRM classification of other rice varieties. Other rice varieties that are not Longdao 208 include: Wuyoudao 4, Liaoxing 1, Longyang 16, Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao 1, Longqingdao 21, Qijing 10 and Nanjing 9108, etc.

[0115] Example 3: Real-time quantitative PCR detection using probe method

[0116] Using extracted DNA as a template, the Longdao 208 rice probe method was used to detect primers: LD208-209-DF2 and LD208-209-DR2, the Longdao 208 rice-specific probe LD208-209-VIC-P3, and the non-Longdao 208 rice-specific probe FLD208-209-FAM-P2, along with the endogenous reference gene PLD probes PLD-F and PLD-R, for real-time fluorescence PCR detection. The PCR reaction volume was 20 μL, containing 10 μL of 2×GoldStar Best MasterMix, 1 μL of LD208-209-DF2 and LD208-209-DR2 primers (10 μM), 0.4 μL each of PLD-F and PLD-R primers (10 μM), 0.25 μL each of FLD208-209-FAM-P2 probe (10 μM) and LD208-209-VIC-P3 probe (10 μM), 0.2 μL of PLD-CY5-P probe (10 μM), 2 μL of template DNA, and sterile water to a final volume of 20 μL. The blank control was prepared using sterile water instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; and 60℃ annealing extension for 45 s, for a total of 45 cycles.

[0117] First, specificity analysis was performed on the probe method. The Longdao 208 rice-specific probe LD208-209-VIC-P3 showed amplification signals only in the Longdao 208 rice variety, with no amplification signals in other rice varieties. The non-Longdao 208 rice probe FLD208-209-FAM-P2 showed amplification signals in non-Longdao 208 rice varieties, but no amplification signal in Longdao 208 rice. Analysis of the quantitative real-time PCR data allowed for the quantification of Longdao 208 and non-Longdao 208 rice varieties in the rice samples. Gene expression data processing employed a 2... -ΔΔCT The method involves using the PLD-CY5-P probe of the rice PLD gene as an endogenous reference gene. The CT values ​​of the LD208-209-VIC-P3 and FLD208-209-FAM-P2 probes in the sample are subtracted from the CT value of the PLD-CY5-P probe. This result is then subtracted from the ΔCT of a reference sample containing 100% Longdao 208 rice or 100% non-Longdao 208 rice. The negative number of the resulting ΔCT is raised to the square to obtain a relative content value, which is used to quantitatively determine the content of Longdao 208 rice and non-Longdao 208 rice varieties in rice samples.

[0118] Using DNA extracted from standard samples with different concentrations as templates, real-time fluorescence PCR was performed using primers LD208-209-DF2 and LD208-209-DR2, non-Longdao 208 rice-specific probes FLD208-209-FAM-P2 and Longdao 208 rice-specific probes LD208-209-VIC-P3, and endogenous reference gene PLD primers PLD-F and PLD-R, and probe PLD-CY5-P. The fluorescence quantitative PCR data were analyzed, and the results showed ( Figure 3 Five standards were established: 0% Longdao 208 rice standard, 5% Longdao 208 rice standard, 50% Longdao 208 rice standard, 95% Longdao 208 rice standard, and 100% Longdao 208 rice standard. The relative gene expression levels of these five standards also increased with increasing Longdao 208 rice content. These standards can be used to quantify the content of Longdao 208 rice in unknown samples. Figure 3 A). Five standards were established: 100% non-Longdao 208 rice standard, 95% non-Longdao 208 rice standard, 50% non-Longdao 208 rice standard, 5% non-Longdao 208 rice standard, and 0% non-Longdao 208 rice standard. The relative gene expression levels of these five standards decreased in descending order of non-Longdao 208 rice content. These standards can be used to quantify the content of non-Longdao 208 rice in unknown samples. Figure 3 B).

[0119] Example 4: Purity Detection of Longdao 208 Rice in Blind Samples

[0120] A blind sample of one Longdao 208 rice product was tested. DNA extraction, quantitative PCR amplification, and data analysis were performed according to the instructions of the Longdao 208 rice variety purity detection kit. The results showed ( Figure 4 The content of Longdao 208 rice in the blind sample was 52% in sample 1. The test results of the blind sample were basically consistent with the ratio. The content of the ratio was 50% Longdao 208 rice in sample 1.

[0121] Conclusion: This invention utilizes molecular biology methods to quantitatively detect adulteration in Longdao 208 rice. DNA is rapidly extracted from rice samples, and quantitative real-time PCR amplification is performed using a developed, highly efficient, and sensitive fluorescent probe and primers specific to Longdao 208 rice. By setting an endogenous reference gene and a reference sample, the amplification data is quantitatively analyzed, thereby quantitatively determining the purity of Longdao 208 rice. The results are intuitive, the operation is convenient and fast, and it is unaffected by variety, region, or environment, making the detection more sensitive and efficient.

Claims

1. An isolated nucleic acid molecule from Oryza sativa comprising a marker, characterized in that, The marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome, and the nucleic acid molecule is 10bp-640bp in length; the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:5 or 6.

2. A primer for detecting a marker in a rice genome, characterized in that, The marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome. The primers are selected from: (1) The sequences shown in SEQ ID NO:1 and 2; and (2) (1) The mixture of the sequences.

3. A probe for detecting a genomic marker of rice, characterized in that, The marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome. The probe has the nucleotide sequence shown in (1) SEQ ID NO:3 or 4, or the complementary sequence of (2) (1).

4. A kit comprising reagents for detecting a marker in a rice genome, characterized in that, The marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome. The kit contains primers for detecting the label, optional probes for detecting the label, and optional nucleic acid molecules containing the label; The kit comprises: the primers of claim 2, the probe of claim 3, and the nucleic acid molecule of claim 1.

5. A method for identifying rice varieties, characterized by, The method includes: (1) Detecting markers in the rice genome, wherein the marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome; (2) According to the identification of rice varieties, if TATAAATCTTG is missing, it is identified as Longdao 208 rice; otherwise, it is identified as non-Longdao 208 rice.

6. The method of claim 5, wherein, The detection includes performing PCR.

7. The method of claim 6, wherein, The detection method is quantitative real-time PCR or HRM detection.

8. A method for detecting the content or purity of rice Longyou 208 in a sample, characterized in that, The method includes: (1) The step of amplifying the marker-containing sequence in the rice genome, wherein the marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome. (2) Determine the content or purity of Longdao 208 rice based on the amplification results of the markers, wherein the amplification results of TATAAATCTTG deletion indicate the content or purity of Longdao 208 rice, the amplification is quantitative real-time PCR, and the method further includes using 2 -ΔΔCT The method determines the content or purity of Longdao 208 rice. The 2 -ΔΔCT The method includes: comparing the CT value of the probe described in claim 3 in the sample with the CT value of the endogenous reference probe using real-time PCR, and comparing the comparison result with the ΔCT of the control to obtain ΔΔCT, and using ΔΔCT to determine the content or purity of Longdao 208 rice.

9. The use of reagents for detecting markers in the rice genome in identifying rice varieties or detecting the content or purity of Longdao 208 rice in rice, or in the preparation of kits for identifying rice varieties or detecting the content or purity of Longdao 208 rice in rice, wherein, The marker site is the deletion of TATAAATCTTG at position 6372872 on chromosome 5 of the rice genome. The reagent comprises the primers of claim 2, the probe of claim 3, and the nucleic acid molecule of claim 1.