Application of tea tree-derived gene CsWRKY23L and its encoded protein in enhancing plant insect resistance

Abstract

The present invention provides a tea tree-derived gene CsWRKY23L and an application of its encoded protein in enhancing plant insect resistance, belonging to the field of biological control technology. The nucleotide sequence of the tea tree-derived gene CsWRKY23L is shown in SEQ ID No. 1. The present invention uses RT-PCR and RACE technology to isolate and clone the tea tree-derived gene CsWRKY23L for the first time, and verifies the plant insect resistance function by overexpressing the gene in Arabidopsis thaliana. It is found that overexpressing the CsWRKY23L gene can significantly improve the plant's resistance to pests, reduce the pest's feeding preference for host plants, and the growth of transgenic overexpressed plants is not affected. The present invention provides an important and potentially universal gene resource for regulating plant insect resistance, provides excellent candidate genes for breeding new varieties of insect-resistant plants, and provides gene resources and technical means for green prevention and control of pests.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control, and in particular relates to application of a tea tree-derived gene CsWRKY23L and a protein encoded therein in enhancing plant resistance to insects. Background Art

[0002] Tea tree is an evergreen shrub of the genus Camellia in the family Theaceae. It often grows in a bushy shrub shape. The leaves are thin and leathery, elliptical-lanceolate or oblong, with short petioles and blunt tips. The flowers are in cymes, white, with downward-curved pedicels. The capsules are spherical. The seeds are brown. The flowering period is September-October, and the fruiting period is November. In spring and autumn, the young leaves of tea trees can be harvested to make tea, the seeds can be used to extract oil, and the trunk material is fine and can be used for carving. Tea is rich in various nutrients and has special medical and health care functions. In addition to lowering cholesterol and preventing atherosclerosis, it also has a good preventive effect on radiation, anemia and other diseases. In recent years, with the continuous expansion of tea planting areas, the introduction of new varieties has gradually increased, which has put forward new requirements for the ecological management of tea gardens and the prevention and control of diseases and pests. However, due to the poor current management and prevention methods, the population structure of pests has changed, and the original secondary pests have gradually become the main pests, the degree of damage has increased, and the yield and quality of tea trees have been seriously affected.

[0003] Arabidopsis thaliana has the characteristics of short growth cycle and small genome, and is often used as a model experimental material for genetics and molecular biology research, especially in plant development and stress biology research. It plays a very important role and is widely planted in laboratories. Tea trees are perennial woody plants with long growth cycles, and currently do not have a mature and stable transgenic technology system. Tea trees and Arabidopsis thaliana are both dicotyledonous plants, so the technical means of introducing tea tree genes into Arabidopsis thaliana to study its biological functions are often used.

[0004] It is reported that WRKY transcription factors have been confirmed to play a critical role in plant response to biotic and abiotic stresses. For example, the tea tree WRKY29 gene can significantly improve the cold resistance of plants. However, so far, there has been no research or report on the tea tree-derived WRKY transcription factor genes and their encoded products in plant insect resistance. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a tea tree-derived gene CsWRKY23L and its encoded protein for use in enhancing plant insect resistance. The tea tree-derived gene CsWRKY23L can significantly improve the plant's resistance to pests, significantly reduce the pests' feeding preference for host plants, and the growth of transgenic overexpressing plants is not affected.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides application of a tea tree-derived gene CsWRKY23L in enhancing plant insect resistance. The nucleotide sequence of the tea tree-derived gene CsWRKY23L is shown in SEQ ID No.1.

[0008] The present invention also provides the use of a protein encoded by the tea tree-derived gene CsWRKY23L in enhancing plant insect resistance. The amino acid sequence of the protein encoded by the tea tree-derived gene CsWRKY23L is shown in SEQ ID No.2.

[0009] Preferably, the insect resistance of the plant is enhanced by overexpressing the tea tree-derived gene CsWRKY23L or a protein encoded by the tea tree-derived gene CsWRKY23L.

[0010] Preferably, the plants include Arabidopsis thaliana and tea plant.

[0011] The present invention also provides a recombinant vector for overexpressing the tea tree-derived gene CsWRKY23L, comprising the tea tree-derived gene CsWRKY23L and an initial expression vector.

[0012] Preferably, the initial expression vector is pBWA(V)HS vector.

[0013] The present invention also provides a method for constructing the overexpression recombinant vector, comprising the following steps:

[0014] (1) PCR amplified the tea tree derived gene CsWRKY23L, and connected it to the pEASY-blunt zero vector to obtain pEASY-CsWRKY23L;

[0015] (2) PCR amplification of pEASY-CsWRKY23L, followed by BsaI / Eco31I double digestion to obtain the linearized pEASY-CsWRKY23L vector;

[0016] (3) The expression vector pBWA(V)HS was double-digested with BsaI / Eco31I, and homologous recombination and Golden Gate ligation reaction were performed with the linearized pEASY-CsWRKY23L vector obtained in step (2) to obtain the overexpression recombinant vector pBWA(V)HS-CsWRKY23L.

[0017] The present invention also provides a recombinant bacterium for overexpressing the tea tree-derived gene CsWRKY23L, and the overexpression recombinant vector pBWA(V)HS-CsWRKY23L is transferred into Agrobacterium GV3101.

[0018] The present invention also provides a method for cultivating an insect-resistant variety of Arabidopsis thaliana, wherein the overexpression recombinant bacteria are transformed into Arabidopsis thaliana.

[0019] Preferably, the transformation method is Agrobacterium-mediated floral infection.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention uses RT-PCR and RACE technology to isolate and clone the tea tree-derived gene CsWRKY23L for the first time, and verifies the biological function of the gene for the first time through a heterologous stable overexpression system, proving that it can improve the resistance of host plants to pests, reduce the feeding preference of pests on host plants, and will not have a negative impact on the growth of host plants. That is, the present invention provides an important and potentially universal gene resource for regulating plant insect resistance, provides excellent candidate genes for breeding new varieties of insect-resistant plants, and provides gene resources and technical means for green prevention and control of pests, with potential good application prospects and value.

[0022] The present invention applies the CsWRKY23L gene to insect-resistant tea trees and insect-resistant Arabidopsis breeding, which has important practical significance for green pest control of tea trees and Arabidopsis and ensuring the green and healthy development of the tea industry. That is, the present invention provides gene resources for the breeding of new insect-resistant plant varieties and has good potential application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the map of the overexpression recombinant vector pBWA(V)HS-CsWRKY23L;

[0024] Figure 2 This is the gel electrophoresis image of the PCR amplification product of the full length of CsWRKY23L gene;

[0025] Figure 3 The relative expression results of CsWRKY23L gene in different Arabidopsis plants were measured. Figure 3 The values ​​in are means ± standard errors (n = 6);

[0026] Figure 4 The growth status of different Arabidopsis plants after 25 days of cultivation;

[0027] Figure 5 The feeding preference results of Plutella xylostella on wild-type Arabidopsis and overexpression Arabidopsis line 1 and on wild-type Arabidopsis and overexpression Arabidopsis line 2 are shown in Figure 2. Figure 5 The values ​​in the table are mean ± standard error (n = 8), "*" indicates that there is a significant difference between the wild-type Arabidopsis and the overexpression strain (t-test, p < 0.05); "**" indicates that there is a very significant difference between the wild-type Arabidopsis and the overexpression strain (t-test, p < 0.01);

[0028] Figure 6 The photos are of the feeding preference experiment of Plutella xylostella on wild-type Arabidopsis and overexpression Arabidopsis strains 1 and 2;

[0029] Figure 7 This is a diagram of the device for testing the insect resistance of Plutella xylostella;

[0030] Figure 8 The results of biological assays on Plutella xylostella are shown in Table 1. “*” indicates significant differences between wild-type Arabidopsis and overexpression strains (t-test, p<0.05), and “**” indicates extremely significant differences between wild-type Arabidopsis and overexpression strains (t-test, p<0.01). The bar graphs are mean ± standard error (n=25). Figure 8 Each circle in the figure represents one biological replicate;

[0031] Fig. 9 A diagram of the experimental setup for treating tea trees for feeding damage by tea geometrids;

[0032] Fig.10 The induced expression of CsWRKY23L gene in tea plants after feeding by tea geometrids. The bar graph is the mean ± standard error (n = 6), and “**” indicates that there is a very significant difference between the treatment group and the control group (t-test, p < 0.01). DETAILED DESCRIPTION

[0033] The present invention provides application of a tea tree-derived gene CsWRKY23L in enhancing plant insect resistance. The nucleotide sequence of the tea tree-derived gene CsWRKY23L is shown in SEQ ID No.1.

[0034] In the present invention, the nucleotide sequence of the tea plant-derived gene CsWRKY23L is: ATGGAGAGGAAACAAGCTGTGAAGATTGAGGACTCGATCCAACACTTTCCATTTTCCGATTACTATCCAGCGAGTACACCATTATCAAGCATGTTGGATTTCTCAAGTGAAGCTGAAAGAAGCTCATTCGGGTTCATGGACTTACTGGGTATTCAAGATTTCTCTCCTTCCTCCATCTTTGATACTCCATTTGTAGAGCAACAGATTCAGAGTTCATCAGCTCCTCCTCTTGCGGACTCTTCATCGGAGGTCTTGAATAACCAGCCCATGACTCCCAACTCTTCAACCATTTCATCGGAATCGAGTGGTGCCCCTAGTGGTGAACAGAGTAAACCAAATGATGATGATGATGATAAAGAAGAAAAGCACCAAAAGACCAAGAAACAGTTGAAAGCAAGGAAAATGTGTGAGAAGAAGAAGCAGAGAGAGCCGAGATTTGCTTTCATGACGAAGAGCGAGGTTGATCATCTGGAAGATGGGTACAGATGGAGAAAGTATGGCCAAAAAGCTGTCAAGAACAGCCCTTTTCCTAGAAGTTACTATCGTTGCACCACAGCTACATGTAATGTGAAGAAGAGAGTGGAGAGATGTTTCAATGATCCAAGCATAGTTGTCACCACATACGAAGGCAAACACGCCCATCCAAGCCCCATCATGCTCCGCCAGACCTCCTCCGCTGCCACCGGACTCCCACCACCGCCACCGCCACCACCACCACCTTGTCCCGGCTTCTCTGCCAATGCCGCCACTTTCGCTCCTCCACTGCAGCCGATGCAAGTGCCATTCTTGTCTCATCAATCCCAATTCAGAAATTTGGCTCATCAAATGAACTTGGGTTACTTGAATTACATAAATCCCAAGTGTGAAACAGACTATGCCCTTCTTCAAGATATTGTGCCATCGCTTGTTACAAAGGAAGAGTAG(SEQ ID No.1).

[0035] The present invention also provides the use of a protein encoded by the tea tree-derived gene CsWRKY23L in enhancing plant insect resistance. The amino acid sequence of the protein encoded by the tea tree-derived gene CsWRKY23L is shown in SEQ ID No.2.

[0036] In the present invention, the amino acid sequence of the tea tree source gene CsWRKY23L is: MERKQAVKIEDSIQHFPFSDYYPASTPLSSMLDFSSEAERSSFGFMDLLGIQDFSPSSIFDTPFVEQQIQSSSAPPLADSSSEVLNNQPMTPNSSTISSESSGAPSGEQSKPNDDDDDKEEKHQKTKKQLKARKMCEKKKQREPRFAFMTKSEVDHLEDGYRWRKYGQKAVKNSPFPRSYYRCTTATCNVKKRVERCFNDPSIVVTTYEGKHAHPSPIMLRQTSSAATGLPPPPPPPPPPCPGFSANAATFAPPLQPMQVPFLSHQSQFRNLAHQMNLGYLNYINPKCETDYALLQDIVPSLVTKEE* (SEQ ID No. 2).

[0037] In the present invention, the insect resistance of plants is enhanced by overexpressing the tea tree-derived gene CsWRKY23L or the protein encoded by the tea tree-derived gene CsWRKY23L; the plants preferably include Arabidopsis thaliana and tea trees.

[0038] The present invention also provides a recombinant vector for overexpressing the tea tree-derived gene CsWRKY23L, comprising the tea tree-derived gene CsWRKY23L and an initial expression vector.

[0039] In the present invention, the initial expression vector is preferably a pBWA(V)HS vector.

[0040] The present invention also provides a method for constructing the overexpression recombinant vector, comprising the following steps:

[0041] (1) PCR amplified the tea tree derived gene CsWRKY23L, and connected it to the pEASY-blunt zero vector to obtain pEASY-CsWRKY23L;

[0042] (2) PCR amplification of pEASY-CsWRKY23L, followed by BsaI / Eco31I double digestion to obtain the linearized pEASY-CsWRKY23L vector;

[0043] (3) The expression vector pBWA(V)HS was double-digested with BsaI / Eco31I, and homologous recombination and Golden Gate ligation reaction were performed with the linearized pEASY-CsWRKY23L vector obtained in step (2) to obtain the overexpression recombinant vector pBWA(V)HS-CsWRKY23L.

[0044] In the present invention, the tea tree derived gene CsWRKY23L is amplified by PCR and connected to the pEASY-blunt zero vector to obtain pEASY-CsWRKY23L.

[0045] In the present invention, the primers used for PCR amplification of the tea tree source gene CsWRKY23L preferably include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is preferably 5'-TCCATGGAGAGGAAACAAGCTG-3' (SEQ ID No. 3), and the nucleotide sequence of the downstream primer is preferably 5'-TCACCACATCAGAGTCAGCAA-3' (SEQID No. 4); the PCR amplification system is preferably: 50 μL, cDNA template 2 μL, 2×PCR buffer 25 μL, 2mMdNTP 10 μL, 10pmol / μL upstream primer 1.5 μL, 10pmol / μL downstream primer 1.5 μL, KOD high-fidelity enzyme 1 μL, water 9 μL; the PCR amplification conditions are preferably: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min.

[0046] In the present invention, pEASY-CsWRKY23L was amplified by PCR and double-digested with BsaI / Eco31I to obtain a linearized pEASY-CsWRKY23L vector.

[0047] In the present invention, the amplification primers of the pEASY-CsWRKY23L preferably include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is preferably: 5'-CAGTGGTCTCACAACATGTCTGATGAACCAGGAGG-3' (SEQ ID No.5), and the nucleotide sequence of the downstream primer is preferably: 5'-CAGTGGTCTCATACATCATGGCTCTTGTTTAAAAA-3' (SEQ ID No.6); the PCR amplification system is preferably: 50 μL, 2 μL of plasmid template, 25 μL of 2×PCR buffer, 2 mM dNTP 10μL, 10pmol / μL upstream primer 1.5μL, downstream primer 1.5μL, KOD high-fidelity enzyme 1μL, water 9μL; the PCR amplification conditions are preferably: 98℃×4min→(98℃×20sec→62℃×20sec→68℃×60sec)×35 cycles→68℃×3min; the double enzyme digestion reaction system is preferably: 20μL, rDNA or pBWA(V)HS plasmid 3μL, 10× buffer 2μL, BsaI 1μL, Eco31I 1μL, water 13μL.

[0048] In the present invention, the expression vector pBWA(V)HS double-digested with BsaI / Eco31I is subjected to homologous recombination and Golden Gate ligation reaction with the linearized pEASY-CsWRKY23L vector obtained in step (2) to obtain the overexpression recombinant vector pBWA(V)HS-CsWRKY23L.

[0049] In the present invention, the map of the overexpression recombinant vector pBWA(V)HS-CsWRKY23L is as follows Figure 1 shown.

[0050] The present invention also provides a recombinant bacterium for overexpressing the tea tree-derived gene CsWRKY23L, and the overexpression recombinant vector pBWA(V)HS-CsWRKY23L is transferred into Agrobacterium GV3101.

[0051] In the present invention, the transfer method is preferably a chemical conversion method.

[0052] The present invention also provides a method for cultivating an insect-resistant variety of Arabidopsis thaliana, wherein the overexpression recombinant bacteria are transformed into Arabidopsis thaliana.

[0053] In the present invention, the transformation method is preferably Agrobacterium-mediated floral infection.

[0054] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] Example 1 Acquisition and sequence analysis of tea tree derived gene CsWRKY23L

[0056] Total RNA was extracted from leaves of tea tree 'Longjing 43' (two-year-old potted seedlings, obtained by cuttings and propagation in the laboratory) using the RNAPlant Plus Kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.); concentration and quality were tested using a Nanodrop instrument, and RNA samples with OD260 / 280>2.0 and OD260 / 230>1.8 were judged to be qualified.

[0057] Using PrimeScript TM The qualified RNA was reverse transcribed by using RT reagent Kit (purchased from TaKara Company) to synthesize cDNA. The detailed operation method was carried out according to the manufacturer's instructions.

[0058] Primers that can amplify the full length of the CsWRKY23L gene were designed using the NCBI Primer Blast website to obtain the upstream primer: 5'-TCCATGGAGAGGAAACAAGCTG-3' (SEQ ID No. 3) and the downstream primer: 5'-TCACCACATCAGAGTCAGCAA-3' (SEQ ID No. 4).

[0059] The cDNA obtained by reverse transcription was used as a template, and KOD high-fidelity enzyme (purchased from Toyobo Co., Ltd.) was used to perform PCR amplification of the full length of the CsWRKY23L gene. The amplification system was as follows: 50 μL, cDNA template 2 μL, 2×PCR buffer 25 μL, 2 mM dNTP 10 μL, 10 pmol / μL upstream primer 1.5 μL, downstream primer 1.5 μL, KOD high-fidelity enzyme 1 μL, water 9 μL. The amplification conditions were: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min. The PCR fragment product band containing the complete CsWRKY23L gene coding region sequence was obtained as shown in FIG. Figure 2 shown.

[0060] The PCR purified product obtained by the above amplification was connected to the pEASYblunt zero vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) to obtain pEASY-CsWRKY23L, and plasmid PCR identification was performed using universal primers M13 (upstream primer: 5'-GTAAAACGACGGCCAGT-3' (SEQ ID No. 7), downstream primer: 5'-CAGGAAACAGCTATGAC-3' (SEQ ID No. 8)). The specific connection method and identification method were carried out according to the manufacturer's instructions.

[0061] The positive plasmid obtained by identification was sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing, and the CsWRKY23L gene sequence shown in SEQ ID NO.1 was obtained after sequencing.

[0062] Example 2 Construction of a recombinant vector overexpressing the tea tree derived gene CsWRKY23L

[0063] Using the pEASY-CsWRKY23L plasmid in Example 1 as a template, PCR amplification was performed using a primer set consisting of an upstream primer: 5'-CAGTGGTCTCACAACATGTCTGATGAACCAGGAGG-3' (SEQ ID No. 5) and a downstream primer: 5'-CAGTGGTCTCATACATCATGGCTCTTGTTTAAAAA-3' (SEQ ID No. 6) to obtain a PCR product rDNA.

[0064] The amplification system is: 50 μL, plasmid template 2 μL, 2×PCR buffer 25 μL, 2 mM dNTP 10 μL, 10 pmol / μL upstream primer 1.5 μL, 10 pmol / μL downstream primer 1.5 μL, KOD high-fidelity enzyme 1 μL, water 9 μL. Amplification conditions are: 98°C×4min→(98°C×20sec→62°C×20sec→68°C×60sec)×35 cycles→68°C×3min.

[0065] The PCR product rDNA and the expression vector pBWA(V)HS (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) were subjected to BsaI / Eco31I double enzyme digestion reaction, respectively. The enzyme digestion reaction system was: 20 μL, 3 μL of rDNA or pBWA(V)HS plasmid, 2 μL of 10× buffer, 1 μL of BsaI, 1 μL of Eco31I, and 13 μL of water.

[0066] The PCR product rDNA and the expression vector pBWA(V)HS were purified by PCR purification kit (purchased from Axygen), and then the purified PCR product rDNA and the purified expression vector pBWA(V)HS were subjected to homologous recombination and GoldenGate ligation reaction to obtain the overexpression recombinant vector pBWA(V)HS-CsWRKY23L. The map is shown in FIG. Figure 1 shown.

[0067] Sequencing analysis showed that the recombinant vector pBWA(V)HS-CsWRKY23L was obtained by cloning the CsWRKY23L gene shown in SEQ ID No.1 into the plasmid pBWA(V)HS, and the vector expressed the CsWRKY23L protein shown in SEQ ID No.2.

[0068] Example 3 Construction of recombinant bacteria overexpressing tea tree derived gene CsWRKY23L

[0069] The overexpression recombinant vector pBWA(V)HS-CsWRKY23L was transformed into Agrobacterium GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by chemical transformation to obtain the overexpression recombinant bacteria, named GV3101 / pBWA(V)HS-CsWRKY23L.

[0070] The empty vector pBWA(V)HS was introduced into Agrobacterium GV3101 to obtain the recombinant bacteria GV3101 / pBWA(V)HS as an empty vector control.

[0071] Example 4 Construction of transgenic Arabidopsis thaliana overexpressing CsWRKY23L gene

[0072] The overexpression recombinant bacteria GV3101 / pBWA(V)HS-CsWRKY23L constructed in Example 3 were transformed into wild-type Arabidopsis thaliana (Columbia ecotype, which can be purchased conventionally) by Agrobacterium-mediated floral infection to obtain transgenic Arabidopsis thaliana T0 seeds.

[0073] Since the pBWA(V)HS vector carries a hygromycin resistance selection gene, the transgenic Arabidopsis T0 seeds were screened on MS medium plates containing 15 mg / L hygromycin. Arabidopsis that can grow normally on the hygromycin medium plates are transgenic T1 positive seedlings, and those that cannot grow normally are negative seedlings. The seeds harvested from the positive seedlings are T1 seeds. The T1 seeds were screened for hygromycin resistance, and the segregation ratio was identified. The strain with a positive seedling: negative seedling ratio of about 3:1 was selected, indicating that in this strain, the vector carrying the CsWRKY23L gene was inserted into the Arabidopsis genome in a single copy form. The T2 positive seedlings in these strains were removed, and single-plant planting and harvesting were performed to obtain T2 seeds, which were then screened for hygromycin resistance. The T3 seedlings that were all positive seedlings were single-copy T3 homozygous CsWRKY23L overexpression transgenic strains. Two strains were randomly selected and named strain 1 and strain 2, respectively. The harvested T3 homozygous seeds can be used for subsequent experiments.

[0074] The seeds of wild-type Arabidopsis and CsWRKY23L gene overexpressing Arabidopsis T3 homozygous were sterilized, grown on MS medium for 10 days, and then transferred to seedling blocks and placed in a light incubator for further culture. After 25 days, the wild-type, overexpression strain 1 and strain 2 plants with consistent growth were selected for the experiment.

[0075] Example 5 Detection of relative expression level of CsWRKY23L gene in overexpressed plants

[0076] The total RNA of the leaves of wild-type Arabidopsis thaliana, overexpression line 1, and overexpression line 2 in Example 4 was extracted using the RNAPlant Plus Kit, and the total RNA extracted from the leaves of Arabidopsis thaliana was reverse transcribed using the PrimeScriptTM RT reagent Kit to synthesize cDNA. The detailed operation method was carried out according to the manufacturer's instructions.

[0077] Using Arabidopsis AtACTIN gene (TAIR, AT3G18780) as an internal reference, fluorescence quantitative PCR was used to detect the relative expression of CsWRKY23L in Arabidopsis leaves. The detection primer pair used consisted of an upstream primer with a sequence of 5'-TTCCATGATGATCGCTACGC-3' (SEQ ID No. 9) and a downstream primer with a sequence of 5'-AGCTCATGTGTGAAGAGCCT-3' (SEQ ID No. 10). The detection results are shown in Figure 2. Figure 3 shown.

[0078] Depend on Figure 3 It can be seen that the overexpression effect of the tea tree-derived CsWRKY23L gene can be detected in both transgenic Arabidopsis lines 1 and 2.

[0079] Example 6 Growth phenotype analysis of transgenic Arabidopsis thaliana overexpressing CsWRKY23L gene

[0080] The seeds of wild-type Arabidopsis, overexpression line 1, and overexpression line 2 were sterilized separately, grown on MS medium (purchased from Beijing Solebow Technology Co., Ltd.) for 10 days, and then moved into cylindrical seedling blocks with a diameter and height of 4 cm and 5 cm respectively, and placed in a light incubator for continued cultivation. The incubator conditions were set as follows: the photoperiod was 16 hours of light and 8 hours of darkness; the light intensity was 10,000 lux; the temperature was 22°C under light conditions and 20°C under dark conditions. During this period, the growth of wild-type Arabidopsis and CsWRKY23L overexpressing transgenic Arabidopsis lines 1 and 2 was observed, and growth phenotype photos were collected at 25 days. The experimental results are shown in the figure below. Figure 4 shown.

[0081] Depend on Figure 4 It can be seen that there is no significant difference in growth phenotype and state between CsWRKY23L overexpressing transgenic Arabidopsis lines 1 and 2 and wild-type Arabidopsis, indicating that CsWRKY23L overexpression has no negative effect on plant growth.

[0082] Example 7 Determination of feeding preference of Plutella xylostella on Arabidopsis thaliana overexpressing CsWRKY23L gene

[0083] Select 5 leaves from the same leaf position of the wild type, overexpression line 1 and overexpression line 2 Arabidopsis plants obtained by cultivation in Example 6, cut them, place them in a 10 cm × 10 cm square culture dish, and cover the base of the petiole with filter paper to keep it moist. After the leaves are placed, 5 third-instar diamondback moth larvae (purchased from Keyun Biopesticide Technology Research and Development Center) are inoculated in the upper middle part of the culture dish. After 3, 6, 18, and 30 hours of inoculation, the number of larvae feeding on the wild type and overexpression lines is investigated and statistically analyzed. A total of 8 biological replicates were set for each treatment. The experimental results are shown in the figure. Figure 5 and Figure 6 shown.

[0084] Depend on Figure 5 and Figure 6 It can be seen that compared with overexpression lines 1 and 2, diamondback moth larvae tend to feed on wild-type plants more, that is, compared with CsWRKY23L overexpression transgenic plants, diamondback moth prefers to feed on wild-type plants, indicating that the insect resistance of Arabidopsis thaliana overexpressing the CsWRKY23L gene is significantly improved. Figure 6 The figure shows the amount of leaves remaining in the culture dish 30 hours after the feeding preference test of Plutella xylostella. Figure 6 It can also be clearly seen that the diamondback moth feeds less on Arabidopsis thaliana overexpressing the CsWRKY23L gene.

[0085] Example 8 Identification of the insect resistance function of Arabidopsis thaliana overexpressing the CsWRKY23L gene

[0086] Wild-type, CsWRKY23L transgenic Arabidopsis strain 1 and strain 2 plants of about 30 days old with consistent growth were selected and placed in cylindrical plastic cups (upper diameter 9.5 cm, lower diameter 5.5 cm, height 10.5 cm), and a second-instar diamondback moth larva was inoculated at the central leaf position of each plant. Figure 7 As shown. After the diamondback moth had fed for 3 days, its weight was taken out and calculated. A total of 26-28 biological replicates were set for each treatment, including 25 biological replicates for the wild type, 26 biological replicates for CsWRKY23L transgenic Arabidopsis line 1, and 28 biological replicates for CsWRKY23L transgenic Arabidopsis line 2. The experimental results are shown in Figure 8 shown.

[0087] Depend on Figure 8 It can be seen that compared with the wild-type Arabidopsis, the weight of the diamondback moth larvae feeding on the overexpression line 1 and the overexpression line 2 plants was significantly reduced, indicating that the insect resistance of Arabidopsis overexpressing the CsWRKY23L gene was significantly improved.

[0088] Example 9 Treatment of tea geometrid feeding and damage

[0089] Select the second fully expanded leaf of two-year-old potted tea seedlings with the same growth, inoculate two third-instar tea geometrid larvae on the leaf (collected from the experimental tea garden of the Tea Research Institute of the Chinese Academy of Agricultural Sciences, and placed in an environment with a temperature of 26±2℃, a relative humidity of 70-80%, and a photoperiod of 12h light and 12h dark, and obtained by successive breeding using tea branches) and then cover the leaf and the tea geometrid larvae with a 10cm×6cm nylon mesh bag, and close the base of the petiole to prevent the tea geometrid larvae from escaping. The above is used as the treatment group. The experimental device is shown in the figure below. Fig. 9 shown.

[0090] Healthy leaves that were not inoculated but covered with nylon mesh bags in the same leaf position were used as experimental controls. Six biological replicates were set for each treatment. The timing started when the tea geometrid began to feed and visible notches appeared. After the tea geometrid had fed for 1.5, 3, 6, 12, 24, and 48 hours, the nylon mesh bags were removed and the tea geometrids were removed. The treated leaves were cut off as samples, immediately immersed in liquid nitrogen, and stored at -80°C for later use.

[0091] Example 10 Analysis of expression characteristics of CsWRKY23L gene

[0092] The total RNA of the leaf samples in the treatment group and the control group in Example 9 was extracted using the RNAPlant Plus Kit. After the concentration and quality were tested by Nanodrop instrument and passed, the total RNA was analyzed by PrimeScript TM The extracted total RNA was reverse transcribed using the RTreagentKit to synthesize cDNA.

[0093] The tea tree CsGAPDH gene (NCBI, XM_028237220) was used as an internal reference, and a primer set consisting of an upstream primer with a sequence of 5'-TTCCATGATGATCGCTACGC-3' (SEQ ID No.9) and a downstream primer with a sequence of 5'-AGCTCATGTGTGAAGAGCCT-3' (SEQ ID No.10) was used for fluorescence quantitative PCR (qRT-PCR) detection, and the reaction system was prepared using LightCycler480 SYBR Green I premix (purchased from Roche), and the fluorescence signal was detected using a Roche LightCycler480 quantitative PCR instrument. The specific reaction system and procedures are shown in the product manual. The experimental results are shown in Fig.10 shown.

[0094] Depend on Fig.10 It can be seen that the tea geometrid larvae feeding treatment can significantly and continuously induce the expression of CsWRKY23L gene. Compared with the control, tea geometrid larvae feeding for 1.5 hours can rapidly induce the expression of CsWRKY23L gene, with an induction multiple of about 15 times; tea geometrid larvae feeding for 48 hours can induce the expression of CsWRKY23L gene up to about 200 times. Therefore, it is speculated that the CsWRKY23L gene plays a key role in plant insect resistance.

[0095] The above research results prove that the CsWRKY23L gene and its encoded product play a key role in improving plant insect resistance. This result will provide genetic resources and basis for the breeding and application of new insect-resistant plant varieties and green control of pests.

[0096] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of tea tree derived gene CsWRKY23L in enhancing plant insect resistance, characterized in that: The nucleotide sequence of the tea tree-derived gene CsWRKY23L is shown in SEQ ID No. 1; The plant is Arabidopsis thaliana; The insect is Plutella xylostella; The application of the tea tree-derived gene CsWRKY23L in enhancing the insect resistance of plants is to enhance the insect resistance of plants by overexpressing the tea tree-derived gene CsWRKY23L.

2. Application of the protein encoded by the tea tree-derived gene CsWRKY23L in enhancing plant insect resistance, characterized in that: The amino acid sequence of the protein encoded by the tea tree-derived gene CsWRKY23L is shown in SEQ ID No. 2; The plant is Arabidopsis thaliana; The insect is Plutella xylostella; The application of the protein encoded by the tea tree-derived gene CsWRKY23L in enhancing the insect resistance of plants is to enhance the insect resistance of plants by overexpressing the protein encoded by the tea tree-derived gene CsWRKY23L.

3. A method for cultivating insect-resistant Arabidopsis varieties, characterized in that: The overexpression recombinant bacteria were transformed into Arabidopsis thaliana; The insect is Plutella xylostella; The overexpression recombinant bacteria are obtained by transferring the overexpression recombinant vector pBWA(V)HS-CsWRKY23L into Agrobacterium GV3101; The method for constructing the overexpression recombinant vector comprises the following steps: (1) PCR amplifying the tea tree source gene CsWRKY23L described in claim 1, and connecting it to the pEASY-blunt zero vector to obtain pEASY-CsWRKY23L; (2) PCR amplifying pEASY-CsWRKY23L, and performing BsaI restriction enzyme digestion to obtain a linearized pEASY-CsWRKY23L vector; (3) using BsaI to digest the expression vector pBWA(V)HS, and performing homologous recombination and GoldenGate ligation reaction with the linearized pEASY-CsWRKY23L vector obtained in step (2) to obtain the overexpression recombinant vector pBWA(V)HS-CsWRKY23L.

4. The method according to claim 3, characterized in that The transformation method is Agrobacterium-mediated floral infection.

Images