SNP molecular markers for identification of immune traits in Tibetan sheep and their applications

Abstract

The present invention relates to the technical field of molecular markers, and in particular to SNP molecular markers for identifying immune traits of Tibetan sheep and their uses. A SNP molecular marker for identifying immune traits of Tibetan sheep, the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and the y at the 372nd position of the sequence represents T or C, resulting in the T / C polymorphism of the gene of chromosome 25 of the Tibetan sheep at this site. The present invention can determine the immunoglobulin IgA, IgG, and IgM content of Tibetan sheep individuals, and the present invention provides a new SNP molecular marker resource for Tibetan sheep immune trait marker-assisted selection for non-diagnostic purposes.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, and in particular to SNP molecular markers for identifying immune traits of Tibetan sheep and uses thereof. Background Art

[0002] With the continuous development of the sheep industry, there are more and more types of sheep diseases, the complexity is increasing, and the control is becoming more and more difficult. Sheep diseases are becoming more and more harmful to sheep production. At the same time, the use of a large number of drugs will make the animal body resistant to drugs, posing a hidden danger to the safety of livestock products.

[0003] At present, sheep are mainly vaccinated with vaccines that can prevent corresponding diseases to enhance their disease resistance, which is one of the most important means in the prevention and control of sheep diseases. However, in actual work, sheep often die of corresponding diseases after immunization, or the vaccinated sheep do not produce immune antibodies or the antibody level is very low. Even if the staff immunizes sheep in good health according to the regular immunization procedures of the sheep farm, immunization failure often occurs in the end.

[0004] Therefore, in the long run, starting from the study of the genetic basis of disease resistance, screening resistance genes, carrying out disease-resistant breeding at the molecular level, genetically improving the resistance of sheep to pathogens, and enhancing immunity are important ways to fundamentally solve this problem. The potential huge economic benefits of disease-resistant breeding and the attractive prospect that certain diseases can be used as animal models for studying human diseases are strongly promoting the development of this work. With the development of molecular biology, molecular genetics and genetic engineering technology, disease-resistant breeding has begun to play an important role in sheep breeding.

[0005] Tibetan sheep have lived in the Qinghai-Tibet Plateau for a long time, and the environment is harsh, so they need higher disease resistance to adapt to this environment. Therefore, improving the disease resistance of Tibetan sheep can make them more adaptable to the harsh natural environment such as high altitude, low pressure, strong ultraviolet rays, hypoxia and cold season nutritional stress.

[0006] Immune indicators can reflect the disease resistance of animals. The disease resistance of animals mainly depends on the health and ability of their immune system. The main function of the immune system is to identify and eliminate pathogens that invade the body, such as bacteria and viruses. When pathogens invade, the immune system will respond quickly and initiate a series of immune response processes to fight and eliminate pathogens.

[0007] Immune indicators usually include antibody levels, immune cell numbers and functions, etc. Antibodies are protein molecules produced by B cells that can specifically bind to and neutralize pathogens, enhancing the effect of immune responses. The number and function of immune cells are also important indicators reflecting the state of the immune system. When the immune system is challenged, immune cells are activated and begin to proliferate to respond to the invasion of pathogens. These cells will further differentiate into more effector cells, such as macrophages and cytotoxic T cells, to eliminate pathogens.

[0008] In addition, the disease resistance of animals is also affected by genetic factors, environmental factors, nutritional status and age. Therefore, immune indicators can be used as an important reference to evaluate the disease resistance and health status of animals. By monitoring the changes in immune indicators, we can timely discover the immune problems of animals and take corresponding measures to improve their disease resistance, prevent and treat diseases.

[0009] Therefore, how to use genetics and genetic engineering technology to find the variation sites in genes at the genetic level in Tibetan sheep breeding, discover the relationship between genes and traits through association analysis between genes and traits, and conduct early selection, thereby improving the efficiency and accuracy of selection, has broad application value. Summary of the invention

[0010] The purpose of the present invention is to provide a SNP molecular marker for identifying immune traits of Tibetan sheep and its application.

[0011] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0012] The invention provides a SNP molecular marker for identifying immune traits of Tibetan sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. The y at position 372 of the sequence represents T or C, which leads to the T / C polymorphism of the gene of chromosome 25 of Tibetan sheep at this position.

[0013] The present invention also provides a primer pair for detecting the molecular marker, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2 and 3.

[0014] The present invention also provides a method for detecting molecular markers related to immune traits of Tibetan sheep, comprising the following steps:

[0015] (1) Extracting Tibetan sheep genomic DNA;

[0016] (2) amplifying the genomic DNA of step (1) using the primer pair;

[0017] (3) Typing and identifying the polymorphic sites of the amplified product obtained in step (2).

[0018] Preferably, the amplification system in step (2) is: 22 μL of PCR premix, 1 μL of upstream primer, 1 μL of downstream primer and 1 μL of template.

[0019] Preferably, the PCR premix is ​​Gold Mix (green).

[0020] Preferably, the amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 57°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0021] The present invention also provides the use of the molecular marker or the primer pair or the method in in vitro detection of immune traits of Tibetan sheep for non-diagnostic purposes.

[0022] The present invention also provides application of the molecular marker or the primer pair or the method in assisted breeding of Tibetan sheep.

[0023] Preferably, the application is to screen Tibetan sheep breeds with high immunity.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention can determine the immunoglobulin IgA, IgG and IgM content of individual Tibetan sheep, and provides a new SNP molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0027] Figure 1 is the PCR amplification product; M represents Marker; 1, 2, and 3 represent three groups of repetitions.

[0028] Figure 2 The peak diagram and sequence are obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1

[0031] 1. Sample collection

[0032] The samples came from Tibetan sheep populations under natural grazing conditions, including 45 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 45 samples from Yushu Prefecture, Qinghai Province, and 83 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 173 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for DNA extraction.

[0033] 2 Main reagents and instruments

[0034] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genome extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebaugh Technology Co., Ltd.; Gold Medal Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (E027-1-1), IgG (E026-1-1), and IgM (E025-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0035] 3 Methods

[0036] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0037] The determination was performed using the spectrophotometer method according to the IgA, IgG, and IgM detection kits of Nanjing Jiancheng Bioengineering Institute. First, a standard curve was established using a standard substance; secondly, distilled water, a standard solution and 7 μL of the sample to be tested were added to the blank tube, the standard tube and the measuring tube respectively, and R1 solution was added to 900 μL, incubated at 37°C for 5 min, and the reading was recorded as A1 at a wavelength of 340 nm; then 180 μL of R2 solution was added to each tube, incubated at 37°C for 5 min, and the reading was recorded as A2 at a wavelength of 340 nm; finally, △A=A2-A1 was calculated, and △A was substituted into the standard curve equation to calculate the sample IgA, IgG, and IgM concentrations (the corresponding standard curves are recorded in the instructions of the IgA, IgG, and IgM detection kits; http: / / www.njjcbio.com / products.asp?id=841; http: / / www.njjcbio.com / products.asp?id=840; http: / / www.njjcbio.com / products.asp?id=839).

[0038] 3.2 Extraction of genomic DNA from blood

[0039] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0040] 3.3 Primer design

[0041] Referring to the gene sequence of chromosome 25 of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019482.2), a pair of specific primers including the g43208919T>C SNP site were designed using primer premier5.0 software.

[0042] Primer sequences:

[0043] F: 5'-TTGCAAGTCCACGCTCTATCCTC-3' (SEQ ID NO: 2);

[0044] R: 5'-AGTCCCAGGTCAAGATCGCTTC-3' (SEQ ID NO: 3).

[0045] The length of the amplified fragment was 535 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0046] 3.4 PCR amplification and sequencing

[0047] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template 1 μL.

[0048] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 57°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0049] The PCR products were detected by 1.5% agarose gel electrophoresis. After the PCR products were qualified by agarose gel electrophoresis, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO: 4, and the SNP marker is located at position 372 of the nucleotide sequence shown in SEQ ID NO: 4, and the site can be T / C (the nucleotide sequence of the SNP marker is shown in SEQ ID NO. 1).

[0050] The biological analysis software MEGA 6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0051] 4 Statistical analysis

[0052] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g43208919T>C gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0053] 5 Results

[0054] 5.1 PCR amplification and sequencing results

[0055] The amplified product of the g43208919T>C SNP site on chromosome 25 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 535bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0056] SEQ ID NO: 4

[0057] TTGCAAGTCCACGCTCTATCCTCTGCAGCTCAGGTCCTCAGACTGGGCTCCAGGGAGCACGGAAGAGCCTGTGCAGGCCCAGGGGACGCCAGACGGAGTGTTTTATATACTGAGGCTCCACATGAATATTTCATCTGATGAAAAGCTATTTGTTTTCAGTAAAACCCAACTTTGACGCCCGCCCG GGGGCTCCCCTGGAATTTTTTTCTGTAGTGGTTTCTTCTTAGGCTCATTTGACATTTTCGGTCTAAATTGGGAGCCCTAAGTTTGCCATCAAAAGATGGCTGTTCCCAGGTTGGAAGTCCACCTGACACCGGGCTGGCCACAGGACAGAAGCTTTCTCCACCTTCATTCAAAAGTCAAACCCAGAG T ATCCCAGCGGCCCCCGCCCGCCACACACACACACACCATAGTATCCATCCCTTCTAGAAATGCTGACAAGACTCCCGCTCTGAACCAAACCACCTGTATGCTGCTCAGGGCATGGGGCCAGGCACACGTCAGTCAGCAGAGAAGCGATCTTGACCTGGGACT.

[0058] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the TC mutation occurred at the g43208919T>CSNP site, and there are three genotypes: TT, TC, and CC.

[0059] 5.2 Statistical analysis results

[0060] From the perspective of population genetics, the genotype and allele frequencies of the g43208919T>C SNP site on chromosome 25 of Tibetan sheep were analyzed. As shown in Table 1, at the g43208919T>C SNP site, the TT genotype frequency was the highest, which was the dominant genotype, and the T allele frequency was 90.5%, which was a dominant allele. 2 The fitness test showed that the SNP site deviated significantly from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of the site was 0.173, the PIC was 0.158, and the PIC was <0.25, which was a low degree of polymorphism.

[0061] Table 1 Polymorphism of g43208919T>C SNP locus on chromosome 25 of Tibetan sheep

[0062]

[0063]

[0064] 5.3 Association analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0065] The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with CC genotype were significantly higher than those of individuals with TT and TC genotypes (p<0.05), and there was no significant difference in immunoglobulins IgA, IgG, and IgM between individuals with TT and TC genotypes (p>0.05), indicating that the base of the g43208919T>C SNP site on chromosome 25 of Tibetan sheep was significantly correlated with IgA, IgG, and IgM of Tibetan sheep, and was a SNP marker related to IgA, IgG, and IgM of Tibetan sheep. The results are shown in Table 2.

[0066] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0067]

[0068] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0069] In summary, the SNP molecular marker described in the present invention is located at the 43208919th base on chromosome 25 of the international sheep reference genome Oar_v4.0 version; the variation type is T / C, named g43208919T>C, and there are three genotypes. When the 43208919th base on chromosome 25 is T, the genotype is TT or TC; when the 43208919th base on chromosome 25 is C, the genotype is CC; through the association analysis of different genotypes with the contents of immunoglobulins IgA, IgG, and IgM, it was found that the immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with the CC genotype were significantly higher than those of individuals with TT and TC genotypes (p<0.05), and there were no significant differences in immunoglobulins IgA, IgG, and IgM between individuals with TT and TC genotypes (p>0.05). By detecting the base at the 43208919th nucleotide position on chromosome 25 of Tibetan sheep, the immunoglobulin IgA, IgG, and IgM content of individual Tibetan sheep can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes.

[0070] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP molecular marker for identifying immune traits of Tibetan sheep, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and the y at position 372 of the sequence represents T or C, resulting in the T / C polymorphism of the gene on chromosome 25 of Tibetan sheep at this position; The immunoglobulins IgA, IgG, and IgM of Tibetan sheep individuals with CC genotype at this locus were significantly higher than those of individuals with TT and TC genotypes.

2. Use of a reagent for detecting the SNP molecular marker according to claim 1 in the preparation of an in vitro detection reagent for immune traits of Tibetan sheep or a reagent for auxiliary breeding of high-immunity Tibetan sheep varieties, characterized in that: The immunoglobulins IgA, IgG and IgM of Tibetan sheep individuals with CC genotype of the SNP molecular marker are significantly higher than those of individuals with TT and TC genotypes.

3. The use according to claim 2, characterized in that: The method for detecting the SNP molecular marker comprises the following steps: (1) Extraction of Tibetan sheep genomic DNA; (2) amplifying the genomic DNA in step (1) using a primer pair; the nucleotide sequence of the primer pair is shown in SEQ ID NOs: 2 and 3; (3) Typing and identifying the polymorphic sites of the amplified product obtained in step (2).

4. The use according to claim 3, characterized in that: The amplification system in step (2) is: 22 μL of PCR premix, 1 μL of upstream primer, 1 μL of downstream primer and 1 μL of template.

5. The use according to claim 3, characterized in that: The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 57°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

Images