G101t snp site related to wheat wet gluten content and application thereof

By developing the KASP-marked G101T SNP site, wheat genotypes were identified using PCR amplification and fluorescence scanning techniques. This solved the problem of low efficiency in identifying wet gluten content in wheat in existing technologies, enabling efficient screening of high-quality wheat varieties and improving the quality and efficiency of wheat breeding.

CN121023085BActive Publication Date: 2026-02-10INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511497671.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-20
Publication Date
2026-02-10
Estimated Expiration
2045-10-20

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively utilize molecular marker-assisted selection methods for efficiently identifying wet gluten content in wheat, resulting in poor wheat quality improvement effects.

Method used

We developed a KASP-based G101T SNP site, designed specific fluorescent primers, and used PCR amplification and fluorescence scanning techniques to identify the G101T SNP genotype in the wheat genome, thereby achieving efficient detection and screening of wet gluten content in wheat.

Benefits of technology

This provides a rapid and accurate method for efficiently screening wheat varieties with high wet gluten content, thereby improving the efficiency and quality of wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121023085B_ABST
    Figure CN121023085B_ABST
Patent Text Reader

Abstract

The application discloses a G101T SNP related to wheat wet gluten content, which is located at the physical position 80813538 bp of the 6A chromosome in the Chinese spring wheat genome IWGSC RefSeq v1.0, and the genotype is G or T. The application develops a KASP marker and a KASP primer group for identifying the wheat wet gluten content based on the SNP site, and provides a method for identifying or assisting in identifying the wheat wet gluten content, and it is found through the method that the wheat wet gluten content of the G101T SNP site genotype TT is higher than or higher than the wheat wet gluten content of the genotype GG. The application has important theoretical significance and economic value for utilizing molecular marker assisted selection to obtain wheat germplasm or breeding offspring materials with higher wet gluten content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to the G101T SNP site related to wet gluten content in wheat and its application. Background Technology

[0002] Wheat is the world's most widely planted, most applicable, and highest-yielding cultivated grain. China is the largest wheat producer and consumer, and wheat plays a vital strategic role in ensuring my country's food security. Before the 1980s, my country's wheat breeding work focused on yield, resulting in a late start in genetic improvement of wheat quality and overall processing quality lower than that of foreign wheat. In the past 20 years, with social development and the improvement of people's living standards, the demand for high-quality wheat has become increasingly urgent, and wheat quality improvement has been listed as an important breeding goal. According to my country's current "Classification Standard for Wheat Variety Quality (GB / T 17320-2013)," wheat quality indicators mainly include grain hardness, crude protein content, and the wet gluten content, sedimentation value, water absorption, stability time, maximum tensile resistance, and energy of wheat flour. Strong gluten wheat has a wet gluten content ≥30%, medium-strong gluten wheat has a wet gluten content of 28%–30%, medium gluten wheat has a wet gluten content of 26%–28%, and weak gluten wheat has a wet gluten content <26%. Therefore, the determination of wet gluten content is of great significance for evaluating the classification of wheat varieties.

[0003] Wet gluten is a network-like mixture with a certain degree of viscosity and elasticity obtained by mechanically mixing, kneading, and washing wheat flour. Its main components are glutenin and prolamins, which interact in a certain proportion and quantity to jointly influence the processing quality traits of wheat. The wet gluten content of wheat is significantly positively correlated with dough stability time, stretching area, and maximum stretching resistance, making it one of the important indicators for evaluating the quality of wheat flour. Wet gluten content is a quantitative trait, and its heritability is controlled by multiple genes, with gene effects mainly being additive. Currently, some QTLs associated with wheat wet gluten content have been identified, but due to the influence of factors such as the mapping population, genetic background, and mapping methods, the results can only reflect the gene information contained in specific wheat varieties. Moreover, most QTLs have a small contribution to the phenotype and poor repeatability across different environments, so they still cannot meet the needs of marker-assisted selection.

[0004] Marker-assisted selection (MAG) is a modern breeding method that uses DNA molecular markers closely linked to a target trait to select genotypes for that trait. It has the advantage of being unaffected by external environmental factors. KASP (Kompetitive Allele-Specific PCR) is a fluorescence-based homogenization technique developed in recent years. Primers are designed based on specific SNPs or InDels in the target allele, and different fluorescent groups are added to the primer ends. Genotyping of the target sequence is based on the reading of the fluorescence signal at the PCR terminal. It has the advantages of high efficiency, accuracy, and low cost, and has broad application prospects in crop breeding.

[0005] Therefore, identifying SNPs related to wet gluten content in wheat and developing corresponding KASP markers can provide an effective detection method for breeding high-quality wheat varieties, which is of great significance for improving the level of high-quality wheat breeding in my country. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide G101T SNP sites related to the wet gluten content of wheat and their applications.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0008] A method for identifying or assisting in the identification of wet gluten content in wheat, characterized by: identifying or assisting in the identification of wet gluten content in wheat based on specific genotypes at single nucleotide polymorphism sites in the wheat genome.

[0009] As a preferred embodiment of the present invention, the single nucleotide polymorphism site is located at position 80813538 bp on chromosome 6A in the IWGSC RefSeq v1.0 genome of Chinese spring wheat, corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 4, and is named G101T SNP; the genotype of the G101T SNP includes GG or TT; the wet gluten content of wheat with the TT genotype is higher than or candidate to be higher than that of wheat with the GG genotype.

[0010] As a preferred embodiment of the present invention, the method for detecting whether the genotype of the G101T SNP site in the wheat genome is GG or TT is as follows: PCR amplification of the wheat genomic DNA to be tested is performed using KASP-labeled primer sequences, and the genotype of the wheat to be tested is determined after fluorescence scanning.

[0011] As a preferred embodiment of the present invention, the KASP-labeled primer sequence includes downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO: 3.

[0012] As a preferred embodiment of the present invention, the downstream primers R1 and R2 have FAM and HEX fluorescent adapter sequences added to their 5' ends, respectively, to distinguish the polymorphic differences of the G101T SNP site; the upstream primer F is a universal KASP upstream primer; primers R1, R2 and F together constitute the KASP-labeled primer sequence.

[0013] As a preferred embodiment of the present invention, the wheat genomic DNA to be tested is amplified by PCR using the primer sequence in claim 5 to obtain PCR amplification products; then the fluorescence signal is converted into an analyzable value, and the fluorescence scanning results are graphically displayed using GraphPad Prism.

[0014] If it has FAM fluorescence and is distributed near the x-axis, then the genotype of the G101T SNP site in the wheat genome to be tested is GG;

[0015] If the SNP locus in the wheat genome is HEX fluorescent and located near the y-axis, then the genotype of the G101T SNP locus is TT.

[0016] On the other hand, the present invention also includes the application of any of the methods described above in wheat breeding.

[0017] On the other hand, the present invention also includes an allelic variant KASP marker primer for detecting the above-mentioned G101T SNP site, including downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO: 3.

[0018] On the other hand, the present invention also includes a reagent or kit for detecting the above-mentioned G101TSNP site, which includes at least the above-mentioned KASP-labeled primer sequence.

[0019] Finally, the present invention also includes the use of allelic variant KASP-labeled primers or the reagents or kits in any one of the following (1)-(4):

[0020] (1) Screening or assisting in screening wheat with high wet gluten content;

[0021] (2) To identify or assist in the identification of wet gluten content in wheat;

[0022] (3) To identify or assist in the identification of the genotype of wheat qWGC6A.1;

[0023] (4) Wheat breeding.

[0024] The beneficial effects of adopting the above technical solution are as follows: This invention provides a novel G101T SNP associated with wheat wet gluten content, located at nucleotide position 80813538 bp on chromosome 6A of the Chinese spring wheat genome (IWGSC RefSeq v1.0), with genotypes GG or TT. This invention provides a KASP marker for identifying wheat wet gluten content and a method for identifying or assisting in the identification of wheat wet gluten content. This method reveals that wheat with the TT genotype at the G101TSNP locus has a higher or potentially higher wet gluten content than wheat with the GG genotype. This invention, through molecular genetic modification of wheat variety characteristics, is of paramount importance for improving wheat flour quality. Attached Figure Description

[0025] Figure 1 A schematic diagram of the KASP marker primer positions for allelic variation.

[0026] Figure 2 This is a schematic diagram showing the genotyping results of 391 wheat germplasms in a natural population.

[0027] Figure 3 This is a schematic diagram illustrating the association between wheat germplasm with mean wet gluten content at the G101T SNP locus genotype GG and genotype TT in natural populations under different environments. Detailed Implementation

[0028] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, when used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination and all possible combinations of one or more of the associated listed items, and includes such combinations.

[0029] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0030] Example 1: Discovery of SNP sites related to wet gluten content in wheat and development of KASP markers

[0031] 1. Discovery of the G101T SNP site

[0032] A SNP was found on the common wheat wet gluten content-related QTL qWGC6A.1, located at physical location 80813538 bp on chromosome 6A (referencing the Chinese spring wheat genome IWGSC RefSeq v1.0). This SNP, named the G101T SNP, was found to exist in two genotypes (G or T) in the natural wheat population. See SEQ ID NO: 4 for sequence information.

[0033] CTGTTCATCCTAAAGACCGACTGCGCTACTGCGGTGGATATGATCTGAGGCCCAGCCAGGGACCGTTCCCCTTTGGCAACCATGGTGAGTAAGATTAAAAKGTTCATGAGTATAGGTAAAGTGCATGCACTATCACACGTTCATCGAGGATAAAATGAAGTTAGTCATAAGTTGTGCCAGATGGGGAGAGTTGGTCCATG (SEQ ID NO: 4; among them, the K at position 101 is G or T).

[0034] 2. Development of KASP tags

[0035] To facilitate the identification and selection of G101T SNP sites related to wet gluten content in wheat, and to reduce breeding costs and workload while enhancing the operability of breeding work, it is necessary to develop the target molecular marker probe sequence into a KASP marker that can be identified and screened using conventional molecular biology methods.

[0036] The KASP marker Kasp_qWGC6A.1 and the KASP primer set for detecting this marker were designed. The sequence of wheat chromosome 6A at physical locations 80813438 bp-80813637 bp was obtained for primer design.

[0037] The KASP primer set consists of three primers: downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO: 3.

[0038] Downstream primer R1: 5'-GAAGGTGACCAAGTTCATGCTGCACTTTACCTATACTCATGAACC-3' (SEQ ID NO: 1)

[0039] Downstream primer R2: 5'-GAAGGTCGGAGTCAACGGATTATGCACTTTACCTATACTCATGAACA-3' (SEQ ID NO: 2)

[0040] Upstream primer F: 5'-TTCATCCTAAAGACCGACTGCGCTA-3' (SEQ ID NO: 3)

[0041] like Figure 1As shown in the figure, the sequence is the sequence of physical location 80813438 bp-80813637 bp on wheat chromosome 6A. The positions of upstream and downstream primers marked by KASP are indicated by boxes, and the red background represents the SNP at physical location 80813538 bp on chromosome 6A.

[0042] Example 2: Establishment of a method for genotyping using the KASP marker Kasp_qWGC6A.1

[0043] 1. Extract genomic DNA from the wheat samples.

[0044] Genomic DNA was extracted from common wheat using the CTAB method and dissolved in 300 μL of ultrapure water. DNA quality was assessed by 1% agarose gel electrophoresis, requiring clear bands, no obvious impurities, and no degradation. The concentration was then determined and the DNA was diluted to 28.3 ng / μL.

[0045] 2. PCR amplification.

[0046] PCR amplification was performed using diluted genomic DNA as a template.

[0047] Preparation of KASP-labeled primer working solution: Two KASP downstream primers were designed based on the SNP at physical location 80813538 bp of the wheat wet gluten content-related QTL qWGC6A.1 in wheat genome version IWGSC RefSeq v1.0. The polymorphism of this SNP site is a G / T base difference. FAM and HEX fluorescent adapter sequences were added to the 5' end of the primers, respectively. At the same time, universal KASP upstream primers were designed, referring to the KASP primer set in Example 1, including downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO: 3. The KASP-labeled primer working solution consisted of: 12 μL each of the two downstream primers (100 μM), 30 μL of the upstream primer (100 μM), and 46 μL of ultrapure water. After mixing, the solution was stored at -20℃ for later use.

[0048] PCR amplification system: 1.5 μL template DNA, 0.0417 μL primer working solution, 0.75 μL 2×KASP Master Mix (LGC, Lot No. 13426773), and sterile ultrapure water to make up to 3 μL.

[0049] PCR reaction program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, annealing / extension for 20 s (first annealing / extension temperature is 61℃, decreasing by 0.6℃ for each cycle), 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing / extension for 1 min, 26 cycles; 72℃ extension for 3 min; store at 4℃.

[0050] 3. Genotyping determination

[0051] After the PCR reaction, a fluorescence signal reader (Omega) and a fluorescence detection system (Araya) were used to convert the fluorescence signal into analyzable values. The fluorescence scanning results were graphically displayed using GraphPad Prism. G bases showed FAM fluorescence, distributed near the x-axis; T bases showed HEX fluorescence, distributed near the y-axis; the negative control (CK) showed no detectable signal, distributed near the origin. Figure 2 As shown, GG is the homozygous GG type, i.e., genotype qWGC6A.1a; TT is the homozygous TT type, i.e., genotype qWGC6A.1b; CK is the negative control.

[0052] Example 3: Application of the KASP marker Kasp_qWGC6A.1 in the identification and screening of wet gluten content in natural wheat populations.

[0053] Thirty-nine thousand wheat germplasm materials from China were planted for three consecutive years (2020-2021, 2021-2022, and 2022-2023) at the Dishan Experimental Station of the Institute of Grain and Oil Crops, Hebei Academy of Agricultural and Forestry Sciences. Each year, they were sown under normal irrigation and fertilization conditions (irrigated twice, once at the jointing stage and once at the grain-filling stage, with an irrigation volume of 50 m³). 3 (nitrogen fertilizer 12 kg / mu) and low-nitrogen treatment (irrigation once each at the jointing and grain-filling stages, with an irrigation volume of 50 m³). 3 Under two conditions (6 kg / mu of nitrogen fertilizer and 6 kg / mu of nitrogen fertilizer), with a row length of 3 m, a randomized block design with three replicates.

[0054] After harvest, wheat grains were milled into flour using a Brabender mill. The wet gluten content was determined according to the national standard "Wheat and Wheat Flour Gluten Content Part 2: Instrumental Determination of Wet Gluten (GB / T 5506.2-2008)". KASP marker detection revealed that among 391 Chinese wheat germplasm materials, 225 were of the qWGC6A.1a allele type (GG homozygous), and 166 were of the qWGC6A.1b allele type (TT homozygous). Table 1 shows the allele types of wheat germplasm materials and the wet gluten content under different years and conditions.

[0055] Table 1. Results of Kasp_qWGC6A.1 marker detection in wheat germplasm and wet gluten content of wheat in different years and under different environments.

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] Note: 1. NA indicates the absence of average wet gluten content.

[0066] 2. Genotype qWGC6A.1a is GG homozygous and qWGC6A.1b is TT homozygous.

[0067] Statistical results showed that the mean wet gluten content of wheat germplasm carrying the qWGC6A.1b allele (G101T SNP genotype TT) was significantly higher than that of wheat germplasm carrying the qWGC6A.1a allele (G101T SNP genotype GG) under different years and environments (P < 0.01). The results are shown in Table 2 and... Figure 3 As shown, Figure 3The genotypes for 20-21 normal_G and 20-21 normal_T are qWGC6A.1a and qWGC6A.1b respectively, both under normal water and fertilizer conditions in 2020-2021. Similarly, the genotypes for 21-22 normal_G and 21-22 normal_T are qWGC6A.1a and qWGC6A.1b respectively, both under normal water and fertilizer conditions in 2021-2022. The genotypes for 22-23 normal_G and 22-23 normal_T are qWGC6A.1b and qWGC6A.1b respectively, both under normal water and fertilizer conditions in 2022-2023. -21 Low Nitrogen_G represents the genotype qWGC6A.1a of the low nitrogen treatment in 2020-2021; 20-21 Low Nitrogen_T represents the genotype qWGC6A.1b of the low nitrogen treatment in 2020-2021; 21-22 Low Nitrogen_G represents the genotype qWGC6A.1a of the low nitrogen treatment in 2021-2022; 21-22 Low Nitrogen_T represents the genotype qWGC6A.1b of the low nitrogen treatment in 2021-2022; 22-23 Low Nitrogen_G represents the genotype qWGC6A.1a of the low nitrogen treatment in 2022-2023; 22-23 Low Nitrogen_T represents the genotype qWGC6A.1b of the low nitrogen treatment in 2022-2023; ** represents P < 0.01, i.e., the difference is highly significant.

[0068] Table 2. Statistical analysis of the relationship between QTL qWGC6A.1 allelic variation type and wet gluten content of common wheat.

[0069]

[0070] Note: P < 0.01 indicates that the difference is highly significant.

[0071] In summary, this invention provides the KASP marker Kasp_qWGC6A.1 for identifying the G101T SNP genotype and its correlation with wheat wet gluten content. Applying the KASP marker from this invention to marker-assisted selection of wheat wet gluten content can rapidly and efficiently screen wheat varieties with higher wet gluten content, thereby accelerating the breeding process of high-quality new wheat varieties. This invention has significant theoretical and economic value for utilizing marker-assisted selection of wheat germplasm or breeding progeny materials with higher wet gluten content.

[0072] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A method for identifying or assisting in the identification of wet gluten content in wheat, characterized in that: The wet gluten content of wheat is identified or assisted in the identification of specific genotypes at single nucleotide polymorphism (SNP) sites in the wheat genome. The SNP site is located at position 80813538 bp on chromosome 6A in the IWGSC RefSeq v1.0 genome of Chinese spring wheat, corresponding to the 101st base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 4, and is named G101T SNP. The genotype of G101T SNP includes GG or TT. The wet gluten content of wheat with the TT genotype is higher than or candidate to be higher than that of wheat with the GG genotype.

2. The method according to claim 1, characterized in that: The method for detecting whether the genotype of the G101T SNP site in the wheat genome is GG or TT is as follows: PCR amplification of the wheat genomic DNA to be tested is performed using a KASP-labeled primer set, and the genotype of the wheat to be tested is determined after fluorescence scanning. The KASP-labeled primer set includes downstream primer R1 shown in SEQ ID NO: 1, downstream primer R2 shown in SEQ ID NO: 2, and upstream primer F shown in SEQ ID NO:

3.

3. The method according to claim 2, characterized in that: The downstream primers R1 and R2 have FAM and HEX fluorescent adapter sequences at their 5' ends, respectively, to distinguish the polymorphic differences of the G101T SNP site.

4. The method according to claim 2 or 3, characterized in that: The wheat genomic DNA to be tested was amplified by PCR using the KASP-labeled primer set described in claim 2 to obtain PCR amplification products; then the fluorescence signal was converted into an analyzable value, and the fluorescence scanning results were graphically displayed using GraphPad Prism. If it has FAM fluorescence and is distributed near the x-axis, then the genotype of the G101T SNP site in the wheat genome to be tested is GG; If the SNP locus in the wheat genome is HEX fluorescent and located near the y-axis, then the genotype of the G101T SNP locus is TT.

5. The application of the method according to any one of claims 1-4 in wheat breeding, wherein the breeding objective includes screening or assisting in screening wheat with high wet gluten content.

6. The use of the KASP-labeled primer set as described in claim 2, or a reagent or kit containing the primer set, in any of the following: (1) Screening or assisting in screening wheat with high wet gluten content; (2) To identify or assist in the identification of wet gluten content in wheat; (3) Wheat breeding, wherein the breeding objectives include screening or assisting in screening wheat with high wet gluten content.

Citation Information

Patent Citations

  • KASP molecular marker of wheat wet gluten content major QTL QWgc.cau-2D and application of KASP molecular marker

    CN117867163A