Application of CYP19A1 gene g.44057663G>A site in growth traits of goats

Abstract

The present invention belongs to the technical field of molecular marker-assisted selection of goats, and specifically relates to the application of the g.44057663G>A site of the goat CYP19A1 gene in the growth traits of goats. The molecular marker is g.44057663G>A located on chromosome 10 in the goat genome Capra hircusARS1.2. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the mutation site is at the 125th base in the sequence. The SNP site mutation of the present invention can significantly affect the growth traits of goats, and provides a new molecular marker for goat growth trait detection or molecular marker-assisted breeding. The present invention also provides a substance for detecting single nucleotide polymorphisms of goat SNP sites, and the application in goat genetic breeding. The scheme of the present invention can improve the growth traits of offspring goats.

Description

Technical Field

[0001] The invention belongs to the technical field of goat molecular marker-assisted selection, and particularly relates to application of a CYP19A1 gene g.44057663G>A site in goat growth traits. Background Art

[0002] Goats are one of the oldest domesticated animals. They provide a variety of livestock products such as meat, skin, wool, and dairy products for human life. They are an important source of food and industrial raw materials. Growth traits such as body weight and body size are important factors affecting livestock production performance and economic value, and targeted improvement of important economic traits such as meat production and body shape is an important part of modern goat breeding programs. The low meat production rate and lagging growth performance of excellent goat breeds in many parts of my country have restricted the development of the local goat industry. Germplasm resources or genetic resources are the material basis of animal breeding, and the excavation and utilization of high-quality genetic resources are the key to the breeding of excellent varieties. It is of great significance to explore important candidate genes and molecular markers and use molecular marker-assisted selection breeding (MAS) to genetically improve important growth traits of goats.

[0003] Single nucleotide polymorphism (SNP) refers to the polymorphism of DNA sequence caused by variation between single nucleotides at the genome level, and the frequency of one allele in the population is not less than 1%. The forms of single nucleotide variation in genomic DNA molecules include base conversion, insertion, transversion, and deletion, generally referring to the conversion and transversion of double alleles, with a ratio of 2:1. Using SNP to assist the selection of goat growth traits will help improve the growth traits of goats in my country and increase mutton production. Whole genome sequencing (WGS) is a new gene detection technology that uses high-throughput sequencing technology to sequence the complete genome sequence in individuals or groups to discover information such as sequence or structural variation. Then, the association between single nucleotide polymorphism sites and specific complex traits is analyzed through genome-wide association study (GWAS) to determine the gene variation related to the trait.

[0004] Cytochrome P450 aromatase (CYP19A1) was isolated from the placenta in 1988. It belongs to the cytochrome P450 family and can convert androstenedione, testosterone (T) and 16a-hydroxyandrostenediol into estrone (E1), estradiol (E2) and estriol (E3) respectively; and the aromatase-catalyzed conversion of androgens to estrone and estradiol is the last step in estrogen synthesis. Research on CYP19A1 mainly focuses on its impact on animal reproductive performance, and no relevant research on goat CYP19A1 gene as a molecular marker for growth traits has been reported. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the CYP19A1 gene g.44057663G>A site in goat growth traits, which can assist in breeding goats with excellent growth traits.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides an application of a molecular marker in a goat CYP19A1 gene in detecting goat growth traits, wherein the molecular marker is a G>A base mutation at a g.44057663 site in ARS1.2 of a goat genome.

[0008] The invention provides an application of a molecular marker in a goat CYP19A1 gene in detecting goat growth traits, wherein the molecular marker is a G>A base mutation at the 125 bp position of the 5' end of a sequence shown in SEQ ID NO:1 in the goat genome.

[0009] The present invention also provides a method for detecting growth traits of goats, which detects the base type at the g44057663 site in the goat genome ARS1.2 or the 125 bp in the sequence shown in SEQ ID NO:1. The March weight, March body oblique length and March chest circumference of AA genotype goats are all higher than those of GG genotype and GA genotype.

[0010] The present invention also provides a substance for detecting single nucleotide polymorphism of a goat SNP site, including a PCR primer for amplifying a genomic DNA fragment including the SNP site or a kit containing the primer.

[0011] The present invention also provides a molecular marker associated with goat growth traits in the CYP19A1 gene, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a C>T base mutation at the 125bp in the SEQ ID NO.1.

[0012] The above-mentioned substance for detecting single nucleotide polymorphism of goat SNP site or molecular marker associated with goat growth traits is used in goat genetic breeding, and the genetic breeding is to improve the growth traits of offspring goats.

[0013] The present invention provides a genetic breeding method for improving the growth traits of goats, which determines the single nucleotide polymorphism of the above-mentioned SNP site of the breeding goats in the core group of goats, and makes corresponding selections according to the single nucleotide polymorphism of the SNP site of the goats: the breeding of the breeding goats selects the individuals whose base at the 125bp in the sequence shown in SEQ ID NO.1 is AA type, and eliminates the GG type and GA type individuals. The method can increase the frequency of the gene A at the site generation by generation, thereby improving the three-month weight, three-month body oblique length and three-month chest circumference performance of the offspring goats.

[0014] Preferably, the goat growth traits are goat weight in March, body oblique length in March and chest circumference in March.

[0015] Beneficial effects of the present invention:

[0016] The present invention discovers a molecular marker associated with growth traits in a goat CYP19A1 gene, wherein the molecular marker contains a SNP site of g.44057663G>A; and the haplotype composed of the SNP site can be used as a molecular marker for goat growth traits.

[0017] The present invention verifies the effects of the above-mentioned SNP molecular markers on the goat's March body weight, March body oblique length and March chest circumference, and can be applied to the genetic improvement of breeding sheep to improve growth traits, thereby improving the growth performance of offspring and further increasing the market competitiveness of breeding enterprises.

[0018] The present invention provides a new molecular marker for molecular marker-assisted breeding of goat growth traits, realizes early selection of goat growth traits and shortens the breeding process; the detection method is fast and accurate and is not affected by breeding environment conditions. DETAILED DESCRIPTION

[0019] The present invention provides an application of a molecular marker in a goat CYP19A1 gene in detecting growth traits of a goat. The present invention performs whole-genome resequencing on goat genomic DNA to obtain all SNP sites on the CYP19A1 gene, and by analyzing the correlation between each site and the growth trait, a molecular marker g.44057663G>A associated with the growth trait is obtained, which is located on chromosome 10 in the goat genome CaprahircusARS1.2.

[0020] The embodiment of the present invention performs whole genome resequencing on 500 black-headed goats (the offspring of Macheng black goats and Boer goats), of which 466 are sequenced at a low depth of 1X and 34 are sequenced at a high depth of 15X, with the purpose of using high-depth sequencing results (less) to perform genotype filling on low-depth sequencing results (more) to reduce sequencing costs. Then, the resequencing data is compared with the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy is used to perform genetic variation detection and genotype filling on all autosomes of the 500 samples to obtain all SNP sites on the CYP19A1 gene. Finally, the SNP sites are associated with the weight, body length, and chest circumference in March, and the molecular markers related to the growth traits of goats are screened: g.44057663G>A.

[0021] Molecular marker of g.44057663G>A site: The nucleotide sequence of this fragment is shown in SEQ ID NO:1, and there is a G>A base mutation at the 125 bp position in the sequence;

[0022] AGAGACTGGAGACCCATGGCGTCCTCAGAGCCTTTTGTAAGGAGTCACTTGACATCCAAACCATACTTTTTTCTCACCAGCAGGCTGAGTCTGTCTCATGGAGAGGCAGAACAGGCCAGGCTGGNCATCATTCCCATAGCAGCACTTCAAGAGGTTTCCCACCACTTCACTTTTCAACTCA (SEQ ID NO. 1).

[0023] The results of GWAS analysis showed that the molecular marker of the g.44057663G>A site was significantly correlated with the growth traits of goats. The body weight, body length and chest circumference in March of individuals with genotype AA were significantly higher than those of individuals with genotype GG and GA, indicating that A is an allele that is beneficial to the improvement of growth traits and is of great significance to goat breeding.

[0024] The molecular markers screened by the present invention can be applied to the genotype of genes related to goat growth traits or the association analysis related to goat growth traits, providing a new molecular marker resource for molecular marker-assisted selection of goat growth traits.

[0025] The present invention does not limit the breed of goats, and preferably the goat breeds include Dongbao black-headed goats, Macheng black goats, Boer goats, Yichang white goats and Matou goats.

[0026] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1

[0028] Goat whole genome resequencing

[0029] 1. Blood Collection and Leukocyte Separation

[0030] Collect 5 mL of goat venous blood in an EDTA anticoagulant tube, place the anticoagulant tube in an ice box with ice packs, bring it back to the laboratory and store it in a 4°C refrigerator, and extract white blood cells. The specific steps are as follows:

[0031] (1) Take 2 mL of blood into a 10 mL centrifuge tube;

[0032] (2) Add ultrapure water to the 9-10 mL mark, invert 20 times, and let stand for 10 minutes;

[0033] (3) Place the centrifuge tube in a centrifuge and centrifuge at 5000 rpm for 10 min. Discard the supernatant (try to pour out the supernatant as much as possible and do not pour out the white blood cells at the bottom);

[0034] (4) Repeat steps (2) and (3);

[0035] (5) Store the separated white blood cells in a -80°C refrigerator for future use.

[0036] 2. Genomic DNA Extraction and Whole Genome Resequencing

[0037] The blood / cell genomic DNA kit (Beijing Tianmo Technology Development Co., Ltd.) was used to extract DNA from leukocytes. The specific method is described in the instructions. The genomic DNA that passed the quality inspection was sent to Beijing Novogene Technology Co., Ltd. for secondary quality inspection and library construction, and the whole genome resequencing of PE150 was performed on the BGI platform. The original data was obtained in FASTQ format. 34 samples were subjected to high-depth whole genome resequencing, with an average sequencing depth of approximately 19.72X and a total data size of 1.4T; 466 samples were subjected to low-depth whole genome resequencing, with an average sequencing depth of approximately 1.65X and a total data size of 1.6T.

[0038] Example 2

[0039] Genome alignment, genetic variation detection, and genotype filling

[0040] 1. Raw sequencing data analysis and genome alignment

[0041] The high-depth sequencing data and low-depth sequencing data were quality controlled using the same process.

[0042] (1) The raw data were filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value lower than 20 and a ratio of more than 30% were removed; reads with an n base greater than 5% were removed. Clean reads were obtained after quality control in the above steps.

[0043] (2) Use BWA software to align clean reads to the goat reference genome Capra_hircus.ARS1.2).

[0044] (3) Use Samtools software to sort the aligned BAM files.

[0045] (4) Use Picard to mark duplicate reads.

[0046] (5)Samtools software builds the index.

[0047] 2. Detection of variant sites and genotype filling

[0048] (1) GATKHaploytypeCaller generates a gvcf file for each sample according to the autosome number.

[0049] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0050] (3) GATKGenotypeGVCFs performs population SNP calling by chromosome.

[0051] (4) GATKMergeVcfs merges autosomal population vcf files.

[0052] (5) GATKSelectVariants screens SNPs in population vcf files.

[0053] (6) GATKVariantFiltration marks false positive SNP sites.

[0054] (7) The grep command filters the marked SNP sites.

[0055] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0056] (9) Beagle software was used to fill in the missing sites.

[0057] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and type genetic variations in population genomes.

[0058] (11) Beagle was used for genotype filling, and ultimately 26,131,221 high-quality SNPs were obtained.

[0059] Example 3

[0060] Detection of polymorphic distribution of molecular markers of the present invention in goat populations

[0061] The genotype frequency and allele frequency of the SNP loci of the CYP19A1 gene after typing in black-headed sheep were calculated. The specific formula and method are as follows:

[0062] Genotype frequency = number of individuals with the genotype / total number of samples in the test population;

[0063] Allele frequency = homozygous genotype frequency of the allele + heterozygous genotype frequency of the gene / 2.

[0064] SPSS software was used to perform differential analysis on the distribution of different genotypes at the loci. Hardy-Weinberg equilibrium is an ideal situation in which a population (not affected by specific interference factors, such as non-random mating, selection, migration, mutation, or limited population size) has a constant gene frequency and a stable equilibrium state after many generations.

[0065] p 2 represents the frequency of homozygous alleles (such as Y), q2 represents the frequency of homozygous alleles (such as y), and 2pq represents the frequency of heterozygotes (such as Yy). If a population reaches genetic equilibrium, its genotype frequency should meet 2(p+q)=p 2 +2p2q2+q2=1. Based on the theoretical value, the actual value can be calculated to perform a chi-square test to determine whether each gene in the population is in a Hardy-Weinberg equilibrium state:

[0066] χ2=∑(Oi-Ei)2 / Ei

[0067] Among them, O represents the observed value of gene frequency, E represents the expected value of gene frequency, and χ2 is the obtained chi-square test value. Compare the calculated chi-square value with the corresponding chi-square table. If the p-value range is greater than 0.05, it means that this site conforms to Hardy-Weinberg equilibrium. If it is less than 0.05, this site deviates from Hardy-Weinberg equilibrium.

[0068] The test results are shown in Table 1: The SNP loci showed three genotypes in the goat population, g.44057663G>A was dominated by homozygous GG, and allele T was the dominant allele. And the chi-square test found that this polymorphic locus did not conform to the Hardy-Weinberg law (P>0.05).

[0069] Table 1 Genetic information parameters of CYP19A1 gene SNPs in goat population

[0070]

[0071]

[0072] Example 4

[0073] Association analysis and application of molecular markers and growth traits of the present invention

[0074] In order to determine the association analysis between the g.44057663G>A locus of the CYP19A1 gene and the growth traits of goats, the SAS self-programming language was used to calculate the fixed linear model. The fixed effects for subsequent analysis were determined by multivariate regression and analysis of variance on the traits. Several models with all possible combinations of fixed effects were tested, and the significance of each effect was systematically evaluated, and each non-significant effect was removed from the model in a step-by-step manner. The final model is as follows:

[0075] Yikjlm=μ+Ii+Ak+Bj+Cl+Dm+Eikjlm

[0076] Y is the trait value, I is the genotype fixed effect, A is the ram fixed effect, B is the litter fixed effect, C is the sex fixed effect, D is the animal random effect, μ is the mean of a single trait, and E is the random error.

[0077] (3) Additive dominant effect value SAS statistical software was used to analyze the genetic effect of genotype on ewe growth traits using linear models, and the GLM program was used to analyze the association between markers and traits. The statistical model for gene effect analysis: except for the individual ewe as a random effect, all other factors were fixed effects. The model used is as follows:

[0078] Model 1: Y = overall mean + genotype + farm environment effect + residual

[0079] Model 2: Y = overall mean + additive effect + dominant effect + farm environment effect + residual

[0080] Among them, Y is the phenotypic value of the trait, additive effect = (homozygous 1 - homozygous 2) / 2, with 1, 0, and -1 representing homozygous 1, heterozygous, and homozygous 2 respectively; dominant effect = heterozygous - (homozygous 1 + homozygous 2) / 2, with 1, -1, and 1 representing homozygous 1, heterozygous, and homozygous 2 respectively.

[0081] The statistical analysis results are shown in Table 2: The weight, body length and chest circumference of the AA genotype in the g.44057663G>A locus in March were significantly higher than those of the GG genotype and TC genotype (P<0.05). The results show that screening ewes with the AA genotype in the g.44057663G>A locus is expected to improve the growth traits of goats.

[0082] Table 2 Association analysis between CYP19A1 gene polymorphisms and growth traits in goats

[0083]

[0084]

[0085]

[0086]

[0087] Note: The values ​​in the table are expressed as mean ± standard error. Different lowercase letters in the same row indicate significant differences (P<0.05), and the same letters indicate insignificant differences (P>0.05).

[0088] It can be seen from the above examples that the goat CYP19A1 gene g.44057663G>A site described in the present invention can be used as a new molecular marker for genetic improvement of goat growth traits, can be used to detect goat growth traits, and is helpful for the screening of excellent growth traits.

[0089] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The use of a reagent for detecting molecular markers in goat CYP19A1 gene in detecting growth traits of goats, characterized in that: The molecular marker is the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide sequence shown in SEQ ID NO.1 has a G>A base mutation at the 125th position from the 5' end; the goat growth traits are the goat's weight in March, body oblique length in March and chest circumference in March.

2. A method for detecting growth traits of goats, characterized in that: The base type at the g.44057663 site in the ARS1.2 of the goat genome or at the 125bp position in the sequence shown in SEQ ID NO.1 was detected. The March weight, March body oblique length and March chest circumference of the AA genotype goats were higher than those of the GG genotype and GA genotype goats.

3. Application of a reagent for detecting molecular markers in goat CYP19A1 gene in goat genetic breeding, characterized in that: The genetic breeding is to improve the growth traits of offspring goats; the growth traits of the goats are the goat weight in March, the body oblique length in March and the chest circumference in March.

4. A genetic breeding method for improving goat growth traits, characterized in that: The growth traits of the goats are the goat weight, body length and chest circumference in March; corresponding selection is made according to the goat SNP sites: the successive breeding of breeding goats selects individuals with AA type base at the 125th base from the 5' end of the sequence shown in SEQ ID NO.1, and eliminates GG type and GA type individuals.

Images