A novel organic electrochemical transistor, its fabrication method, and its application.

Abstract

This application relates to the field of organic electrochemical transistors, particularly to their fabrication methods and applications. The organic electrochemical transistor includes a substrate layer, and a gate electrode, a source electrode, and a drain electrode disposed on the substrate layer. An organic semiconductor thin film is coated on the working area between the source and drain electrodes, and a biomodification material layer containing streptavidin is applied to the gate electrode. By setting the gate electrode, source electrode, and drain electrode on the substrate layer, and by applying a biomodification material layer containing streptavidin to the surface of the gate electrode, the streptavidin on the biomodification material layer can bind to biotin, thereby constructing an organic electrochemical transistor coated with an antigen-antibody trap. Changes in its relevant electrical parameters can be measured, and different concentrations of the target protein can be directly calculated. Therefore, compared to traditional protein blotting methods, this organic electrochemical transistor has the advantages of fast detection speed, high result sensitivity, fewer intermediate steps, and lower instrument costs.

Description

Technical Field

[0001] This application relates to the field of organic electrochemical transistors, and in particular to their fabrication methods and applications. Background Technology

[0002] ELISA and Western blot (WB) techniques are widely used in scientific research, renowned for their precise quantification. Although ELISA and WB techniques have matured significantly over time, shortcomings remain in their implementation, primarily in the following aspects:

[0003] 1. Too long: The entire WB process includes several major steps such as sample loading, electrophoresis, membrane transfer and color development, which takes about 1.5 days in total. It involves more than 10 actual operation steps, and in order to ensure the accuracy of the detection, no mistakes can be made in each step.

[0004] 2. Insufficient stability: Because the WB process is lengthy and involves many steps, any error or deviation at any stage will lead to differences in the final results. Moreover, the final results can only be observed after color development, so the results often vary considerably.

[0005] 3. Expensive experimental equipment: Western blotting involves a variety of instruments, such as transfer apparatus, electrophoresis apparatus, power supply, and gel clamps. In particular, the fluorescence and ECL color development processes require expensive color development instruments, which greatly limits the implementation of Western blotting in scientific research.

[0006] 4. Long experimental cycle: The implementation of ELISA requires the coating and plate preparation of specific antibodies, which greatly complicates the detection of the corresponding antigens.

[0007] Therefore, how to provide a new method for rapid protein detection to achieve high-sensitivity rapid protein detection is a technical problem that urgently needs to be solved. Summary of the Invention

[0008] This application provides a novel organic electrochemical transistor, its preparation method, and its application, to solve the technical problems of excessive time consumption and low sensitivity in the protein blotting detection process in the prior art.

[0009] In a first aspect, this application provides a novel organic electrochemical transistor, the organic electrochemical transistor comprising a substrate layer, and a gate electrode, a source electrode, and a drain electrode disposed on the substrate layer; the working region between the source electrode and the drain electrode is coated with an organic semiconductor thin film, and the gate electrode is modified with a biomodified material layer containing streptavidin.

[0010] Optionally, the biomodified material layer may further include a carboxyl base layer bound to one end of streptavidin.

[0011] Optionally, the biomodified material layer further includes a binding protein that binds to the other end of streptavidin, the binding protein including a C1q domain.

[0012] Optionally, the binding protein comprises at least three different peptide chains, wherein the head end of the binding protein is a globular protein and the tail end of the binding protein is collagen.

[0013] Optionally, the coding sequence of the binding protein is as shown in SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3.

[0014] Optionally, the non-working area between the source electrode and the drain electrode is coated with an insulating layer.

[0015] In a second aspect, this application provides a method for preparing the organic electrochemical transistor described in the first aspect, the method comprising:

[0016] A conductive material is deposited on the surface of the substrate and treated with a piranha solution, followed by immersion in mercaptoacetic acid to obtain an electrode layer containing a carboxyl base layer.

[0017] The electrode layer was activated and incubated with streptavidin, followed by elimination treatment to obtain a working electrode containing a biomodified material layer.

[0018] Photolithography is performed on the working electrode to obtain the gate electrode, source electrode, and drain electrode, respectively;

[0019] An organic thin film is spin-coated onto the working region between the source electrode and the drain electrode to obtain an organic semiconductor thin film;

[0020] A photoresist layer is formed by covering the working area between the source electrode and the drain electrode;

[0021] By binding a binding protein containing a C1q domain to the surface of the gate electrode, an organic electrochemical transistor is obtained.

[0022] Optionally, the activation solution comprises a mixed solution of N-(3-(dimethylamino)propyl)-N′-ethylcarbodiimide hydrochloride, N-hydroxysuccinimide, and 2-(N-morpholino)ethanesulfonic acid.

[0023] Optionally, the raw materials for the organic semiconductor thin film include poly(3,4-ethylenedioxythiophene-polystyrene sulfonic acid), dimethyl sulfoxide, glycerol, and 3-glycidyl etheroxypropyltrimethoxysilane; and / or,

[0024] The substrate layer is made of glass or a polymer film.

[0025] Thirdly, this application provides an application of a novel organic electrochemical transistor, the application of which includes using the organic electrochemical transistor described in the first aspect for the detection of universal proteins.

[0026] The technical solutions provided in this application have the following advantages compared with the prior art:

[0027] This application provides a novel organic electrochemical transistor. By fabricating a gate electrode, source electrode, and drain electrode on a substrate, and simultaneously depositing a streptavidin-containing biomodified material layer on the surface of the gate electrode, the streptavidin on the biomodified material layer can bind to biotin, thereby constructing an organic electrochemical transistor with antigen-antibody capture capability. This organic electrochemical transistor can bind to antigen-antibody complexes in solution, forming a bridge for exciton-plasmotropic resonance energy transfer (EPI) and specifically binding antigen-antibody complexes formed by specific target proteins. When antigen-antibody complexes formed by different concentrations of the target protein bind to the biomodified material layer containing streptavidin, the EPI effect weakens or even disappears, causing a change in the photovoltage on the gate electrode. This, in turn, causes changes in relevant electrical parameters such as current flow rate in the organic electrochemical transistor. Since the organic electrochemical transistor has both sensing and signal amplification functions, the concentrations of the target protein can be directly calculated by measuring the changes in these relevant electrical parameters. Therefore, compared with traditional protein blotting methods, this organic electrochemical transistor has the advantages of fast detection speed, high result sensitivity, fewer intermediate steps, and low instrument cost. Attached Figure Description

[0028] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this application and, together with the description, serve to explain the principles of this application.

[0029] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 A schematic diagram of the biomodified material layer provided in the embodiments of this application;

[0031] Figure 2 This is a schematic diagram of the structure of an organic electrochemical transistor provided in an embodiment of this application;

[0032] Figure 3This is a schematic diagram of the activation process provided in an embodiment of this application;

[0033] Figure 4 A schematic diagram of the process flow for the organic electrochemical transistor provided in the embodiments of this application;

[0034] Figure 5 This is a schematic flowchart of a method for preparing organic electrochemical transistors provided in an embodiment of this application;

[0035] Figure 6 A schematic diagram of the standard curve for the detection process of the organic electrochemical transistor provided in the embodiments of this application;

[0036] Figure 7 A comparative schematic diagram of the detection results of organic electrochemical transistors provided in the embodiments of this application;

[0037] Among them, 1-substrate layer, 2-gate electrode, 3-source electrode, 4-drain electrode, 5-organic semiconductor thin film, 6-biomodified material layer, 7-carboxylic acid base layer, 8-insulating layer, and 9-electrode layer. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0039] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.

[0040] The creative thinking behind this application is:

[0041] Organic electrochemical transistors (OECTs) are high-performance sensors and amplifiers that convert biological signals into electrical signals. OECT-based biosensors offer advantages such as high sensitivity, low cost, ease of fabrication, and mechanical flexibility, making them suitable for high-throughput and multiplex detection of biomarkers. A typical OECT has a simple device structure, including three electrodes (gate, source, and drain), an organic semiconductor channel between the source and drain electrodes, and an electrolyte connecting the gate and the channel. This device exhibits low operating voltage, good biocompatibility, and excellent stability. In recent years, OECTs have been successfully used to detect various biomolecules, including nucleic acids, proteins, and metabolites. However, current applications of OECTs in biosensoring rely on protein-specific binding to the target protein. Detecting different binding proteins often requires a large number of OECTs, thus increasing the cost of detection.

[0042] Therefore, solving the technical problems of excessive time consumption and low sensitivity in the existing protein blotting detection process, as well as the technical problem of consuming a large number of organic electrochemical transistors for detecting different proteins, are urgent technical issues that need to be addressed.

[0043] Figure 1 An exemplary schematic diagram of the biomodified material layer provided in an embodiment of this application is shown;

[0044] Figure 2 An exemplary schematic diagram of the structure of the organic electrochemical transistor provided in an embodiment of this application is shown;

[0045] Figure 3 An exemplary schematic diagram of the activation process provided in an embodiment of this application is shown;

[0046] like Figure 1 , Figure 2 and Figure 3 As shown, this application provides a novel organic electrochemical transistor, which includes a substrate layer 1, and a gate electrode 2, a source electrode 3, and a drain electrode 4 disposed on the substrate layer 1; the working area between the source electrode 3 and the drain electrode 4 is coated with an organic semiconductor thin film 5, and the gate electrode 2 is modified with a biomodified material layer 6 containing streptavidin.

[0047] In some alternative embodiments, the biomodified material layer 6 further includes a carboxyl base layer 7 bound to one end of streptavidin.

[0048] In this embodiment, by providing a carboxyl base layer 7 that can bind to streptavidin on the surface of the gate electrode 2, streptavidin can be stably bound to the surface of the gate electrode 2, enabling timely changes in the EPI effect. This allows for accurate changes in the relevant electrical parameters in the organic electrochemical transistor, facilitating the intuitive calculation of different concentrations of the target protein based on these changes in electrical parameters.

[0049] In some alternative embodiments, the biomodified material layer 6 further includes a binding protein that binds to the other end of streptavidin, the binding protein including a C1q domain that binds to the antibody.

[0050] In this embodiment, by chemically modifying the collagen at the tail end of the C1q domain to link a biotin, a biotin can be linked to bind with streptavidin to form an antigen-antibody trap. The modified antibody trap is then coated onto the gate electrode 2, thereby forming an EPI bridge. This facilitates subsequent intuitive observation of the changes in relevant electrical parameters caused by different concentrations of the test protein.

[0051] In some alternative embodiments, the coding sequence of the binding protein is as shown in SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3.

[0052] In this embodiment, by controlling the specific coding sequence, it can be determined that the antigen-antibody trap only binds to epitopes that expose the constant region of the antibody. That is, the antigen-antibody trap can specifically bind to antibodies that have undergone conformational changes. Using this characteristic, an organic electrochemical transistor can be constructed into an antigen-antibody trap, which facilitates subsequent intuitive observation of the changes in relevant electrical parameters caused by different concentrations of the test protein.

[0053] In some alternative embodiments, the non-working area between the source electrode 3 and the drain electrode 4 is coated with an insulating layer 8.

[0054] In this embodiment, by providing an insulating layer 8 on the non-working area between the source electrode 3 and the drain electrode 4, the source electrode 3 and the drain electrode are effectively prevented from being connected through the electrolyte, thereby affecting the working performance of the device, and thus enabling the relevant electrical parameters of the organic electrochemical transistor to change accurately.

[0055] Figure 4 An exemplary schematic diagram of the process flow of the organic electrochemical transistor provided in the embodiments of this application is shown;

[0056] Figure 5 An exemplary schematic diagram of the method flow for preparing organic electrochemical transistors provided in an embodiment of this application is shown;

[0057] like Figure 4 and Figure 5 As shown, based on a general technical concept, this application provides a method for preparing the organic electrochemical transistor, the method comprising:

[0058] S1. A conductive material is deposited on the surface of the substrate layer 1 and treated with a piranha solution, followed by immersion in mercaptoacetic acid to obtain an electrode layer 9 containing a carboxyl base layer 7.

[0059] S2. Activate the electrode layer 9, add streptavidin for incubation, and then perform elimination treatment to obtain a working electrode containing a biomodified material layer 6;

[0060] S3. Perform photolithography on the working electrode to obtain the gate electrode 2, the source electrode 3, and the drain electrode 4, respectively;

[0061] S4. Spin-coating an organic thin film onto the working area between the source electrode 3 and the drain electrode 4 to obtain an organic semiconductor thin film 5;

[0062] S5. Photoresist is applied to the working area between the source electrode 3 and the drain electrode 4 to obtain an insulating layer 8;

[0063] S6. By binding a binding protein containing a C1q domain to the surface of the gate electrode 2, an organic electrochemical transistor is obtained.

[0064] This method relates to the fabrication method of the above-mentioned organic electrochemical transistor. The specific structure of the organic electrochemical transistor can be referred to in the above embodiments. Since this method adopts some or all of the technical solutions of the above embodiments, it has at least all the beneficial effects brought about by the technical solutions of the above embodiments, which will not be elaborated here.

[0065] In some alternative embodiments, the activation solution comprises a mixed solution of N-(3-(dimethylamino)propyl)-N′-ethylcarbodiimide hydrochloride, N-hydroxysuccinimide, and 2-(N-morpholino)ethanesulfonic acid.

[0066] In some optional embodiments, the raw materials for the organic semiconductor thin film 5 include poly(3,4-ethylenedioxythiophene-polystyrene sulfonic acid), dimethyl sulfoxide, glycerol, and 3-glycidyl etheroxypropyltrimethoxysilane; and / or,

[0067] The substrate layer 1 is made of glass or a polymer film.

[0068] In this embodiment, controlling the specific solution used for activation can fully activate the carboxyl groups on the conductive material of the substrate layer 1, thereby facilitating the subsequent binding between the carboxyl groups and streptavidin, and ensuring that streptavidin exists stably on the electrode material.

[0069] The specific raw materials of the organic semiconductor thin film 5 can be controlled by using dimethyl sulfoxide, glycerol, and 3-glycidyl etheroxypropyltrimethoxysilane to enhance the film-forming properties of poly(3,4-ethylenedioxythiophene)-polystyrene sulfonic acid and its adhesion to the substrate.

[0070] By controlling the specific material of the substrate layer 1, the conductive material can be stably covered on the substrate layer 1, and it is convenient to subsequently photolithographically form the gate electrode 2, source electrode 3 and drain electrode 4.

[0071] Based on a general inventive concept, embodiments of this application provide an application of a novel organic electrochemical transistor, the application of which includes using the organic electrochemical transistor in the detection of universal proteins.

[0072] In this embodiment, the organic electrochemical transistor can be used for protein detection in animals or plants. Compared with traditional detection techniques, this detection method is convenient, fast, low-cost, and highly sensitive. Therefore, it can replace existing ELISA and Western blotting techniques and perform highly sensitive absolute or relative quantitative detection of proteins.

[0073] This method is based on the above-mentioned organic electrochemical transistor. The specific structure of the organic electrochemical transistor can be referred to the above embodiments. Since this method adopts some or all of the technical solutions of the above embodiments, it has at least all the beneficial effects brought about by the technical solutions of the above embodiments, which will not be elaborated here.

[0074] The present application is further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the application. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. If there is no corresponding national standard, then general international standards, conventional conditions, or conditions recommended by the manufacturer are followed.

[0075] Example 1

[0076] 1. Preparation of streptavidin-labeled gold electrodes

[0077] Fabrication of micro gold electrodes using thermal evaporation or magnetron sputtering processes:

[0078] The Au electrode (D=0.6mm) was treated with piranha solution (H) for 5 min and cleaned periodically.

[0079] The gold electrode was immersed in a 50 mM solution of mercaptoacetic acid (MAA) and left in the dark overnight to obtain carboxyl groups.

[0080] Then, the gold electrode was activated for 1 h at room temperature in an aqueous solution of N-(3-(dimethylamino)propyl)-N′-ethylcarbodiimide hydrochloride (EDC, 20 mg / ml) and N-hydroxysuccinimide (NHS, 10 mg / ml) in 2-(N-morpholino)ethanesulfonic acid (MES). Excess streptavidin was added to the MES buffer and incubated at room temperature for 3 h. Afterward, the gold electrode was treated with MEA solution for 1 h to eliminate unbound carboxyl groups.

[0081] Example 2

[0082] Based on the streptavidin-labeled gold electrode prepared in Example 1, subsequent experiments were conducted:

[0083] 2. OECT preparation

[0084] OECT is manufactured using multilayer photolithography technology:

[0085] A gold electrode (Cr, 10 nm; Au, 40 nm) prepared as in Example 1 was deposited on a glass or polymer thin film substrate by magnetron sputtering or thermal evaporation. The gate electrode 2, source electrode 3 and drain electrode 4 were then fabricated using photolithography in micro-nano fabrication. The electrode width of each electrode was 50 μm.

[0086] The region between the source electrode 3 and the drain electrode 4 is the working region of the organic semiconductor thin film 5, with a length of (L) 30 μm and a width of (120 μm).

[0087] To effectively prevent the source electrode 3 and the drain electrode from being connected through the electrolyte and thus affecting the device's performance, a layer of SU-8 photoresist is applied to the non-working areas of the source electrode 3 and the drain electrode 4 using a photolithography process, serving as an insulating layer 8 to protect the Au electrode.

[0088] Finally, an organic semiconductor polymer film (poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate), PEDOT:PSS) is spin-coated onto the working region between the source electrode 3 and the drain electrode 4, and dimethyl sulfoxide (DMSO), glycerol, and 3-glycidyl etheroxypropyltrimethoxysilane (GOPS) are added to form an organic polymer mixture. The addition of DMSO, glycerol, and GOPS to the above organic polymer mixture is to enhance the film-forming properties of PEDOT:PSS and its adhesion to the substrate.

[0089] The above-mentioned organic electrochemical transistor device was annealed at 110°C for 50 min in a high-purity nitrogen atmosphere.

[0090] Example 3

[0091] Based on the organic electrochemical transistor device prepared in Example 2, subsequent experiments were conducted:

[0092] 3. Preparation of antigen-antibody complex traps

[0093] An antigen-antibody trap is a C1q-binding protein linked to biotin. Its characteristic is that it cannot bind to an antibody when the antibody is not bound to the antigen. It only binds to the Fc fragment of the antibody when the antigen-antibody complex is formed. Therefore, an antigen-antibody trap can be constructed by utilizing its properties.

[0094] The coding sequence of this binding protein is as follows:

[0095] gacaccatgg agacctctca gggatggctg gtggcctgtg tgctgaccat gaccctagtatggacagtgg ctgaagatgt ctgccgagca cccaacggga aggatggggc tccaggaaat cctggccgcccggggaggcc gggtctcaaa ggagagagag gggagccagg agccgctgct gacccagggg aatctggccc ccctggcaaa cctggcaatg tggggctccc aggtcccagtggtcccctgg gggacagcgg cccccaagga ctgaagggcg tgaaaggcaa tccaggcaat atcagggaccagccccggcc agctttctca gccattcggc agaacccaat gacctcggc aggcggtta tctttgacaaggtcctcacc aaccaggaga gtccatacca gaaccacacg ggtcgcttca tctgtgcagt gccggcttctattacttca acttccaagt gatctccaag tgggaccttt gtctgtttat caagtcttcc tccgggggccagcccaggga ttccctgacacac caggtgttag cagggggcaccgtgcttcag ctgcgacgag gggacgaggt gtggatcgaa aaggaccccg caaagggtcg catttaccagggcactgaag ccgacagcat cttcagcgga ttcctcattt tcccctcggc ctga(SEQ ID) NO.1.

[0096] tgaagacaca gtggggtgag gtctggacac acctgttact gctgcttcta ggttttctccatgtgtcctg ggcccaaagc agctgcaccg ggccccctgg catccctggc atccctgggg tccctggggttcctggctct gatggccaac caggcactcc agggataaag ggggagaaag ggctccctgg actggctggagaccttggtg agttggaga gaaagggac ccagggatcc ctgggactcc aggcaaagtt ggccctaagggtcccgtcgg ccctaagggt actccaggcc cctctggacc ccgcggtccc aaaggcgatt ctggggactacggggctaca cagaaagtcg ccttctctgc cctgaggacc atcaacagcc ccttgcgacc gaaccaggtcattcgcttcg aaaaggtgat caccaacgcg aacgagaact atgagccacg caacggcaag ttcacctgcaaggtgcctgg cctcactact ttcacctatc atgccagctc ccggggcaac ctgtgtgtga atctcgttcgtggccgcgat cgggacagca tgcagaaagt agtcaccttc tgtgactatg cccagaacac cttccaggtgaccacaggtg gggtagtctt gaagctagag caagaggagg ttgttcacct gcaggccaca gacaagaactccctcctggg cattgagggt gccaacagca tcttcactgg ctttctgctt ttccctgaca tggatgcgtaa(SEQ ID NO. 2);

[0097] atggtcgt tggacccagt tgccagcctc catgtggact ttgcctgctg ctgctgtttcttctggccct accactcagg agccaggcca gcgctggctg ctatgggatc ccagggatgc caggcatgccgggggcccct gggaaggacg ggcatgatgg actccagggg cccaagggag agccaggaat cccagccgtccctgggaccc gaggacccaa gggtcagaag ggcgagcctg gcatgcctgg ccaccgtggg aaaaatggccccagggggac ctcagggttg ccaggggacc caggccccag ggggcctccg ggggagccag gtgtggagggccgatacaaa cagaagcacc agtcggtatt cacagtcacc cggcagacca cccagtaccc agaggccaacgccctcgtca ggttcaactc tgtggtcacc aaccctcagg ggcattacaa cccaagcaca gggaagttcacctgtgaagt gccgggcctc tactacttcg tctactacac atcgcatacg gccaacctgt gcgtgcacctgaacctcaac cttgccaggg tggccagctt ctgcgaccac atgttcaaca gcaagcaggt cagctccggaggagtcctcc tgcggctcca gaggggcgat gaggtgtggc tatcagtcaa tgactacaat ggcatggtgggcatagaggg ctccaacagc gtcttctctg gtttcctact gtttcccgac tag(SEQ ID NO. 3).

[0098] The C1q protein was expressed in yeast by gene cloning, and the protein was extracted by liquid chromatography to obtain the recombinant C1q protein.

[0099] The prepared recombinant C1q protein was dialyzed in 0.05M CB buffer for 4 hours in the dark. A biotin solution was prepared by dissolving 1 mg of biotin in 180 μL of pure water to a concentration of 5.5 mg / mL. Biotin was then added to protein A at a ratio of 15 μL to 1 mg of protein. The mixture was dialyzed again for 1 hour in the dark at room temperature. After the reaction, the protein was stored at -80℃ in the dark. This yielded a recombinant C1q protein with biotin at its N-terminus. This protein was then attached to a gate electrode to form an antigen-antibody trap (AAT).

[0100] Relevant experimental and effect data:

[0101] The in vitro synthesized standard antigen was diluted to 0.5 μg / μL using antigen diluent, and then diluted 10,000 times to produce three loading volumes: 50 pg, 200 pg, and 2500 pg, which were designated as standard one, standard two, and standard three, respectively. Antibody diluent was used as a blank control.

[0102] Figure 6 An exemplary illustration shows a standard curve diagram of the organic electrochemical transistor detection process provided in an embodiment of this application;

[0103] Figure 7 An exemplary schematic diagram showing the comparison of detection results of organic electrochemical transistors provided in an embodiment of this application is illustrated;

[0104] Using the antibody trap described above, blank, standard one, standard two, and standard three were detected respectively. Current was used for detection, and current-voltage curves were plotted. The results are as follows: Figure 6 As shown, the correlation coefficient of the standard curve is 0.9984, indicating that the curve can accurately simulate the effect of different protein concentrations on current and voltage.

[0105] Select sample four to be tested, and proceed as follows: Figure 6 The standard curve was used to determine the predicted concentration, and then the actual protein concentration was detected. It was found that the actual concentration of sample four was basically consistent with the predicted concentration, with the error kept at around 5%. The results are as follows: Figure 7 As shown.

[0106] Various embodiments of this application may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a hard limitation on the scope of this application; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Furthermore, whenever a numerical range is referred to herein, it means including any referenced number (fraction or integer) within the referred range.

[0107] In this application, unless otherwise stated, directional terms such as "upper" and "lower" specifically refer to the drawing directions in the accompanying drawings. Furthermore, in the description of this application, terms such as "comprising" and "including" mean "including but not limited to." In this document, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. In this document, "and / or" describes the relationship between related objects, indicating that three relationships can exist; for example, A and / or B can represent: A alone, A and B simultaneously, or B alone. A and B can be singular or plural. In this document, "at least one" means one or more, and "more than one" means two or more. "At least one," "at least one of the following," or similar expressions refer to any combination of these items, including any combination of single or plural items. For example, "at least one of a, b, or c" or "at least one of a, b, and c" can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be a single or multiple.

[0108] The above description is merely a specific embodiment of this application, enabling those skilled in the art to understand or implement this application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of this application. Therefore, this application is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein.

Claims

1. An organic electrochemical transistor, characterized in that, The organic electrochemical transistor includes a substrate (1), and a gate electrode (2), a source electrode (3), and a drain electrode (4) disposed on the substrate (1); the working region between the source electrode (3) and the drain electrode (4) is coated with an organic semiconductor thin film (5), and the gate electrode (2) is modified with a biomodified material layer (6) containing streptavidin; the biomodified material layer (6) further includes a carboxyl base layer (7) that binds to one end of streptavidin; the biomodified material layer (6) further includes a binding protein that binds to the other end of streptavidin, the binding protein including a C1q domain that binds to an antibody; the coding sequence of the binding protein is shown in SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.

3.

2. The organic electrochemical transistor according to claim 1, characterized in that, The non-working area between the source electrode (3) and the drain electrode (4) is coated with an insulating layer (8).

3. A method for preparing an organic electrochemical transistor as described in claim 1 or 2, characterized in that, The method includes: A conductive material is deposited on the surface of the substrate (1), and then treated with a piranha solution and soaked in mercaptoacetic acid to obtain an electrode layer (9) containing a carboxyl base layer (7). The electrode layer (9) was activated and incubated with streptavidin, followed by elimination treatment to obtain a working electrode containing a biomodified material layer (6). Photolithography was performed on the working electrode to obtain the gate electrode (2), source electrode (3) and drain electrode (4), respectively; An organic thin film is spin-coated on the working area between the source electrode (3) and the drain electrode (4) to obtain an organic semiconductor thin film (5); Photoresist is applied to the working area between the source electrode (3) and the drain electrode (4) to obtain an insulating layer (8); By binding a binding protein containing a C1q domain to the surface of the gate electrode (2), an organic electrochemical transistor is obtained.

4. The method according to claim 3, characterized in that, The activation solution includes a mixture of N-(3-(dimethylamino)propyl)-N′-ethylcarbodiimide hydrochloride, N-hydroxysuccinimide, and 2-(N-morpholino)ethanesulfonic acid.

5. The method according to claim 3, characterized in that, The raw materials for the organic semiconductor thin film (5) include poly(3,4-ethylenedioxythiophene-polystyrene sulfonic acid), dimethyl sulfoxide, glycerol, and 3-glycidyl etheroxypropyltrimethoxysilane.

6. The method according to claim 3, characterized in that, The substrate layer (1) is made of glass or a polymer film.

7. An application of an organic electrochemical transistor, characterized in that, The applications shown include using the organic electrochemical transistor as described in claim 1 or 2 for the detection of universal proteins.

Images