Application of HDAC5 gene in regulating P-glycoprotein expression under hypoxia

Abstract

The present invention provides the application of HDAC5 gene in regulating the expression of P-glycoprotein under hypoxia. The regulation is negative regulation. When the expression of HDAC5 gene is downregulated, the expression of P-glycoprotein is upregulated; when the expression of HDAC5 gene is upregulated, the expression of P-glycoprotein is downregulated. The present invention proves that in the hypoxic rat hepatocyte hypoxia model, HDAC5 is upregulated and P-gp is downregulated; there is a negative regulatory relationship between HDAC5 and P-gp. Under high-altitude hypoxia conditions, HDAC5 is upregulated and P-gp is downregulated; the clearance rate of phenytoin sodium decreases. The agonist and inhibitor are given respectively, and the pharmacokinetic curve and parameters also change. The present invention proves that HDAC5 has a significant ability to regulate P-gp through a study on the pharmacokinetics of P-gp substrates, and may affect the pharmacokinetics of P-gp substrates, which is of great significance to the rational use of such drugs at high altitudes.

Description

Technical Field

[0001] The present invention relates to the application of HDAC5 gene in regulating the expression of P-glycoprotein under hypoxia state. Background Art

[0002] P-gp, also known as P-glycoprotein, MDR1, and ABCB1, is a widely distributed transporter that is mainly expressed in hepatocytes, renal proximal tubular epithelial cells, intestinal epithelial cells, brain capillary epithelial cells, and placental epithelial cells. P-gp is located on the cell membrane and its energy comes from ATP, which can protect cells from invasion by foreign harmful molecules. Gastrointestinal P-gp can reduce substrate absorption and bioavailability; P-gp in the intestine and liver can increase non-renal clearance of drugs; and renal P-gp can increase renal clearance. There are many P-gp substrates, including common drugs such as vincristine, mitoxantrone, paclitaxel, digoxin, atorvastatin, domperidone, cimetidine, dexamethasone, cyclosporine, tacrolimus, ribavirin, lidocaine, quinidine, itraconazole, felodipine, nifedipine, verapamil, and mifepristone.

[0003] Phenytoin sodium is a widely used P-gp substrate with a highly selective inhibitory effect on the motor area of ​​the cerebral cortex. Phenytoin sodium has anti-epileptic, anti-neuralgia, and anti-arrhythmic effects. It can be administered orally or by injection in clinical practice. Phenytoin sodium is the drug of choice for the treatment of grand mal seizures. It has a narrow therapeutic window and low safety. At the same time, it is metabolized by the liver and undergoes enterohepatic circulation. Therefore, drug concentration monitoring of phenytoin sodium is of great clinical significance. The more common adverse reactions include behavioral changes, clumsy or unstable gait, confusion, slurred pronunciation, hand tremors, nervousness, or irritability. The US FDA has announced that phenytoin sodium may cause potentially serious skin lesions. Overdose may cause blurred vision or diplopia, etc.; long-term use and sudden cessation may aggravate epilepsy or induce status epilepticus. If phenytoin sodium is used in combination with coumarins, chloramphenicol, isoniazid, phenylbutazone, sulfonamides, carbamazepine, corticosteroids, cyclosporine, digitoxin, estrogen, levodopa, quinidine, valproic acid, etc., the efficacy of the drug will be reduced and even toxic reactions may be caused.

[0004] When the human body quickly enters the plateau area, the P-gp changes in various tissues are different, which has a certain impact on the absorption, distribution, metabolism, and excretion of drugs. The plateau is huge and has a large population, including people from the plains who enter the plateau for various reasons and indigenous people who have lived in the plateau for a long time. In the plateau hypoxic environment, how to start from the root and solve the rational application of related substrates under plateau hypoxia conditions through the expression of P-gp is a key issue in the use of drugs under this condition.

[0005] It is reported that in the microhypoxic environment of tumors, epigenetic modification can regulate P-gp, thereby causing changes in tumor drug resistance. This study under high-altitude hypoxia conditions is expected to solve the problem of high-altitude application of such drugs from the root cause of P-gp protein expression. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the present invention provides the use of HDAC5 gene in regulating the expression of P-glycoprotein under hypoxia.

[0007] The present invention provides application of HDAC5 gene in regulating the expression of P-glycoprotein under hypoxia.

[0008] Preferably, the regulation is negative regulation, that is, when the expression of HDAC5 gene is downregulated, the expression of P-glycoprotein is upregulated; when the expression of HDAC5 gene is upregulated, the expression of P-glycoprotein is downregulated.

[0009] The present invention also provides the use of an agent for inhibiting or down-regulating HDAC5 gene expression in preparing a drug for up-regulating P-glycoprotein expression under hypoxia.

[0010] Preferably, the hypoxic state is plateau hypoxia.

[0011] Preferably, the hypoxic state is acute high-altitude hypoxia.

[0012] Preferably, the agent for inhibiting or downregulating HDAC5 gene expression is an agent for silencing HDAC5 gene by RNA interference.

[0013] Preferably, the agent for inhibiting or down-regulating HDAC5 gene expression is a siRNA targeting the HDAC5 gene; the sequence of the siRNA is as follows (1) or (2):

[0014] (1) Justification chain: GAAACAAGGAGAAGAGCAATT;

[0015] Antisense strand: UUGCUCUUCUCCUUGUUUCTTT;

[0016] (2) Sense strand: GGCAGAAGCUGGACAGUAATT;

[0017] Antisense strand: UUACUGUCCAGCUUCUGCCTT.

[0018] The present invention also provides the use of a reagent for inhibiting or down-regulating HDAC5 gene expression in the preparation of a phenytoin sodium adjuvant under hypoxia.

[0019] Preferably, the hypoxic state is plateau hypoxia.

[0020] Preferably, the hypoxic state is acute high-altitude hypoxia.

[0021] Preferably, the agent for inhibiting or downregulating HDAC5 gene expression is an agent for silencing HDAC5 gene by RNA interference.

[0022] Preferably, the agent for inhibiting or down-regulating HDAC5 gene expression is a siRNA targeting the HDAC5 gene; the sequence of the siRNA is as follows (1) or (2):

[0023] (1) Justification chain: GAAACAAGGAGAAGAGCAATT;

[0024] Antisense strand: UUGCUCUUCUCCUUGUUUCTTT;

[0025] (2) Sense strand: GGCAGAAGCUGGACAGUAATT;

[0026] Antisense strand: UUACUGUCCAGCUUCUGCCTT.

[0027] The present invention establishes a rat hepatocyte BRL hypoxia model, screens epigenetic chromatin modifying enzymes that change greatly under normoxic and hypoxic conditions by PCR array, and verifies by Real-time PCR. The changes of P-gp under hypoxic conditions are explored by Western blot. The regulatory effect of epigenetic chromatin modifying enzymes on P-gp is explored by small interfering RNA technology. Wistar male rats were transported to Batang, Yushu, Qinghai, at an altitude of 4010m, with 6 rats in each group, for a plateau field experiment.

[0028] The present invention proves that in the hypoxic rat hepatocyte hypoxia model, HDAC5 is upregulated and P-gp is downregulated; there is a negative regulatory relationship between HDAC5 and P-gp. Under high altitude hypoxia conditions, HDAC5 is upregulated and P-gp is downregulated; the clearance rate of phenytoin sodium decreases. The pharmacokinetic curves and parameters also change when agonists and inhibitors are given respectively.

[0029] The present invention studies the pharmacokinetics of P-gp substrates and proves that HDAC5 has a significant ability to regulate P-gp and may affect the pharmacokinetics of P-gp substrates, which is of great significance for the rational use of such drugs at high altitudes. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0031] Figure 1Cells after hypoxia treatment.

[0032] Figure 2 This is the PCR array result.

[0033] Figure 3 The changes of P-gp in the hypoxia model.

[0034] Figure 4 The regulatory effect of HDAC5 on P-gp.

[0035] Figure 5 The changes of P-gp and HDAC5 in the plateau group.

[0036] Figure 6 The blood concentration-time curve of phenytoin sodium in different groups of rats (n=6).

[0037] Figure 7 The expression levels of P-gp in different groups (n=3). (Compared with Ph, **P<0.01).

[0038] Figure 8 The expression levels of HDAC5 in different groups (n=3). (Compared with Ph1, *P<0.05). DETAILED DESCRIPTION

[0039] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0040] Example 1 Establishment of in vitro rat hepatocyte BRL hypoxia model

[0041] 1 Experimental materials Test drugs: rat liver cells BRL (purchased from Boster Company), CCK8 (ABmole).

[0042] 2 Methods and Results:

[0043] The cells were divided into a control group (C) and a hypoxia group (H), and inoculated in a 96-well plate, 4000 cells per well. After the cells were inoculated and cultured for 24 hours, the hypoxia model was constructed. The control group has been cultured in a complete medium containing serum under conditions of 5% CO2 and 95% air; the hypoxia group was replaced with a basic DMEM medium without serum and placed in a modular culture chamber (0.5% O2 was passed into the chamber) for 12 hours to obtain a hypoxia model. The reoxygenation process was that after the end of hypoxia, the H group was replaced with a complete medium containing serum and cultured for different periods of time under conditions of 5% CO2 and 95% air. After the end of hypoxia, 10uL CCK8 was added to each well according to the instructions, and the absorbance was measured after incubation for 1.5 hours.

[0044]

[0045] Three wells were measured in each group, and each sample was measured three times in parallel. The experimental data were statistically analyzed using SPSS21.0 software and graphed using GraphPad Prism software. The experimental results are shown in Tables 1 and Figure 1 .

[0046] Figure 1 Cells after hypoxia treatment. (a) shows the cell survival rate; (b) shows the cell morphology of the control group, 10*; (c) shows the cell morphology of the hypoxia 12h group, 10*; (compared with the control group, ***P<0.001).

[0047] Table 1 Cell survival rate of each group after hypoxia treatment

[0048]

[0049] Note: The time before the “+” sign represents the hypoxia time, and the time after the “+” sign represents the reoxygenation time.

[0050] 3 The CCK8 experiment showed that the hypoxia effect was significant when the hypoxia lasted for 12 hours and was stable after three repeated independent experiments, so the hypoxia time was 12 hours.

[0051] Example 2 PCR array screening of epigenetic chromatin modifying enzymes that vary significantly under hypoxia

[0052] 1 Experimental Materials Test drugs: rat hepatocyte BRL, rat epigenetic chromatin modifying enzyme PCR array (Woji Gene), RT Master Mix(RR036A,Takara),TB Premix EX Taq (Takara). Sequence of HDAC5: CCGTGATGACTTTCCCCTCC (front primer), TGTGCCTGTGATCTCCGACTG (back primer); sequence of β-actin: CACCCGCGAGTACAACCTTC (front primer), CCCATACCCACCATCACACC (back primer).

[0053] 2 Methods and Results: The cells were divided into a control group (C) and an oxygen-deficient group (H) as described in Example 1. According to the instructions, 9 μL of cDNA was added to the PCR array. The PCR program was: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s. The experimental data were plotted using Graphpad software. The results are shown in Figure 2 .

[0054] Figure 2 The results of PCR array. (a) is the heat map result; (b) is the H / C result; (c) is the HDAC5 verification result; (compared with group C, ***P<0.001).

[0055] 3 The results showed that some epigenetic chromatin modifying enzymes showed an up-regulation or down-regulation trend under hypoxia, among which the HDAC family showed a large change. Real-time PCR verification showed that HDAC5 was up-regulated, which was consistent with the PCR array results.

[0056] Example 3 Changes in P-gp in the hypoxia model and regulation of P-gp by HDAC5

[0057] 1 Experimental materials Test drugs: rat hepatocyte BRL, P-gp antibody (bioss), ATP1A1 (abcam), secondary antibody anti-rabbit (proteintech), Lipo2000 (ThermoFisher), Opti-MEM (Gibco), si HDAC5 was synthesized by Shanghai Bioengineering.

[0058] 2 Methods and results: Grouping was the same as above. Changes in P-gp under hypoxic conditions were determined by Western blot. P-gp sequence: TGAGGTCGTGATGGAGTTT (previous), ATGCCAACAGCAGGTTTC (latter). The regulatory effect of HDAC5 on P-gp was determined by small interfering RNA. The sequence of siRNA is shown in Table 2. The operation method is: according to the instructions, dissolve siRNA powder in enzyme-free water to prepare a solution. Add Opti-MEM, Lipo2000 and siRNA solution to the plated cells, incubate for 24 hours, and then perform subsequent treatment. The experimental results are shown in Figure 3 , Figure 4 .

[0059] Table 2 siRNA sequences

[0060] siRNA Justice sense (5'-3') Antisense (5'-3') siHDAC5-1 GAAACAAGGAGAAGAGCAAdTdT UUGCUCUUCUCCUUGUUUCdTdTdT siHDAC5-2 GGCAGAAGCUGGACAGUAAdTdT UUACUGUCCAGCUUCUGCCdTdT siHDAC5-3 GCAACAGACGCUCAUAdTdT UAUGAGCGUGCUCUGUUGCdTdT

[0061] Figure 3 The changes of P-gp in the hypoxia model. (a) The figure shows the real-time PCR results of P-gp; (b) The figure shows the Western blot results of P-gp, where the left side shows the electrophoresis results of the control group and the right side shows the electrophoresis results of the hypoxia group; (c) The figure shows the bar graph of the Western blot results of P-gp; (compared with group C, ***P<0.001, ****P<0.0001).

[0062] Figure 4The figure shows the regulatory effect of HDAC5 on P-gp. (a) The figure shows the function of siHDAC5; (b) The figure shows the regulatory effect of HDAC5 on P-gp. (Compared with group C, **P<0.01, ***P<0.001, ****P<0.0001; compared with group H, ####p<0.0001).

[0063] 3 Real-time PCR and Western blot showed that P-gp was downregulated in hepatocytes under hypoxic conditions. In the small interference experiment, siHDAC5-1 and siHDAC5-2 showed good knockout activity. P-gp was downregulated under hypoxic conditions, and after interfering with the highly expressed HDAC5, P-gp was upregulated, close to normal levels. HDAC5 can regulate P-gp in hepatocytes, and the two are negatively correlated.

[0064] Example 4 Plateau Field Experiment

[0065] 1 Experimental materials Test drugs: Test animals: 30 Wistar male rats (Beijing Sibeifu, license number SCXK (Beijing) 2019-0010), weighing 200±20g; divided into the following five groups: control group (Control group) and plateau group, 6 rats in each group, both of which were given phenytoin sodium; plain group (P), plateau 1d group (H1) and plateau 3d group (H3) (the timing started after the rats arrived at the Yushu plateau environment, the plateau 1d group was the rats that entered the plateau environment for one day (24h), and the plateau 3d group was the rats that entered the plateau environment for three days (72h)), 6 rats in each group, none of these three groups were given phenytoin sodium. Phenytoin sodium standard (National Food Inspection Institute), phenytoin sodium tablets (Shanghai Xinyi Huanghe Pharmaceutical), loratadine standard (National Food Inspection Institute), methanol (chromatographic grade, Merck), formic acid (chromatographic grade, Dima), acetonitrile (chromatographic grade, Merck).

[0066] 2 Methods and Results

[0067] The control group (Control group) and the plain group were operated in the SPF-level laboratory in Lanzhou (Lanzhou, Gansu, 1500 m above sea level, atmospheric pressure 86.3 kPa, temperature 24±2°C, relative humidity 40%). The rats in the plateau group, plateau 1d group (H1) and plateau 3d group (H3) were adaptively grown in the Animal Experiment Department of the 940th Hospital of the Lanzhou Joint Logistics Support Force 3 days in advance. On the morning of the 4th day, the mice were transported to Xining Airport by a constant temperature box truck, and then transported by air to the plateau field laboratory of Yushu Tibetan Autonomous Prefecture, Qinghai Province (Yushu, Qinghai, 4010 m above sea level, atmospheric pressure 60.0 kPa, temperature 20±2°C, relative humidity 60%). Jelly was used to replenish water freely during transportation.

[0068] Pharmacokinetic experiment: After fasting for 12 hours, the control group (Control group) was intragastrically administered with 50 mg / kg of phenytoin sodium. The timing was started after intragastrically administering. Blood was collected from the rats' orbital venous plexus at 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12 and 24 hours, and dripped into a centrifuge tube moistened with heparin sodium. The tube was centrifuged at 5000 r / min for 5 minutes, and the supernatant, i.e., plasma, was aspirated and stored in a -80°C refrigerator for later use. The timing of the plateau group was started after the rats rapidly entered the plateau, and the operation was the same as that of the Control group.

[0069] Materials collection: The rats in the plain group (P), the rats in the plateau 1d group (H1) and the rats in the plateau 3d group (H3) were humanely killed 1d after arriving at the Yushu plateau environment, and their liver tissues were collected and stored at -80℃.

[0070] UFLC-MS conditions: Chromatographic column: Shim-pack XR-ODS column (3.0 mm × 75 mm, 2.0 μm), column temperature 25 ° C. Isocratic elution mobile phase ratio acetonitrile-2 mM ammonium acetate-formic acid (60:40:0.2, v / v / v). The flow rate of the mobile phase is 0.40 mL min -1 The injection volume of each sample was 10 μL and the analysis time was 3 min.

[0071] The mass spectrometry conditions were as follows: negative ion multiple reaction (MRM) mode, electrospray ion source (ESI) detection, spray voltage (IS) of 4500 V, and nebulization temperature (TEM) of 350°C. The collision energy (CE) of phenytoin sodium and loratadine was 22.0 psi and 30.0 psi, respectively; the collision induced dissociation voltage (DP) was 27 V and 43 V, respectively. The detection ions of phenytoin sodium and loratadine were m / z 253.2→182.2 and 383.2→337.2, respectively.

[0072] The precision, accuracy, recovery, stability and linearity of this method were all qualified.

[0073] The plasma sample processing method is as follows: 30 μL of plasma sample is accurately drawn with a pipette, and then 75 μL of 12.5 ng / mL loratadine acetonitrile solution is added to precipitate protein, mixed on a vortex mixer, and then centrifuged at 13000 r / min at room temperature for 5 min, 80 μL of supernatant is drawn and transferred to the injection bottle, and the injection volume is 10 μL. The experimental results are shown in Table 3 and Figure 5 .

[0074] Experimental results: The ct curve of phenytoin sodium showed significant differences between the control group and the plateau group. The plasma concentration of phenytoin sodium in the plateau group was significantly higher than that in the control group. As shown in Table 3, the AUC of phenytoin sodium (AUC 0-t and AUC 0-∞) In the plateau group, the CL was significantly increased by 60.35% and 66.73%, and the MRT (MRT 0-t and MRT 0-∞ ) significantly increased by 47.53% and 58.95%, t 1 / 2 It also increased significantly by 61.11%.

[0075] Table 3 Comparison of pharmacokinetic parameters of phenytoin sodium (x±s, n=6)

[0076] Pharmacokinetic parameters Control group Plateau Group <![CDATA[AUC 0-∞ (μg / L*h)]]> 54684.861±19173.379 164363.618±62496.007* AUC0-t (μg / L*h) 53930.26±19263.372 136014.45±46524.193* CL(L / h) 1.009±0.347 0.332±0.093* <![CDATA[MRT 0-∞ (h)]]> 6.639±1.053 9.599±4.765* <![CDATA[MRT0-t(h)]]> 6.279±0.933 16.172±2.015* <![CDATA[t 1 / 2 (h)]]> 3.733±0.486 9.599±4.765* Tmax(h) 1.4±0.894 1.4±0.758 Vd(L) 5.619±2.557 4.634±2.957

[0077] Compared with the Control group, *P<0.05.

[0078] Figure 5 The changes of P-gp and HDAC5 in the plateau group.

[0079] Depend on Figure 5 (a) It can be concluded that after the administration of phenytoin sodium at high altitude, the pharmacokinetic parameters were different from those of the control group. (b) and (c) show that in the blank rats without drug administration at high altitude, the expression of P-gp in the liver decreased and HDAC5 increased. Similarly, P-gp and HDAC5 showed negative regulation.

[0080] 3 The results showed that rapid plateauing did affect the pharmacokinetic characteristics of phenytoin sodium in rats. In the plateau group, the AUC, MRT, and t 1 / 2 The results showed that after entering the plateau, the absorption degree and absorption rate of phenytoin sodium were accelerated, while the excretion slowed down, that is, phenytoin sodium was eliminated from the body more slowly in the hypoxic environment of the plateau, resulting in a higher plasma drug concentration in the body than the Control group. From the perspective of clearance rate, it was verified that P-gp was downregulated in the liver at high altitude. Western blot results showed that P-gp was downregulated under plateau conditions, and HDAC5 was upregulated, which was consistent with the conclusion of the cell part.

[0081] Therefore, the experiment proved that hypoxia affects the metabolic process of phenytoin sodium in the body. Under high altitude hypoxia conditions, the usage and dosage of phenytoin sodium need to be adjusted to ensure the safety and effectiveness of the drug in the body.

[0082] Example 5 Pharmacokinetic changes caused by changes in the P-gp substrate phenytoin sodium under high altitude field conditions

[0083] 1 Experimental materials Test drugs: Test animals: 36 Wistar male rats (Beijing Sibeifu, license number SCXK (Beijing) 2019-0010) were divided into 6 groups, 6 rats in each group, and each rat weighed 200±20g.

[0084] 2 Methods and Results: The test animals were randomly divided into 6 groups: plateau phenytoin sodium group (Ph), plateau phenytoin sodium and hypericin group (Ph+Hy), plateau phenytoin sodium and verapamil group (Ph+Ve), plateau phenytoin sodium group (Ph1), plateau phenytoin sodium and hypericin group (Ph+Hy1), plateau phenytoin sodium and verapamil group (Ph+Ve1).

[0085] Among them: Ph, Ph+Hy, Ph+Ve groups: drug administration, on the plateau. Phenytoin sodium, P-gp agonists and inhibitors. Pharmacokinetic experiments, no sampling process.

[0086] Ph1, Ph+Hy1, Ph+Ve1 groups: drug administration, on the plateau. Phenytoin sodium, P-gp agonists and inhibitors. There is a sampling process, but no pharmacokinetic experiments.

[0087] After fasting for 12 h, the mice in the Ph and Ph1 groups were intragastrically administered with 50 mg / kg of phenytoin sodium.

[0088] After fasting for 12 h, the mice in the Ph+Hy and Ph+Hy1 groups were intragastrically administered with 50 mg / kg of phenytoin sodium and 1.5 mg / kg of hypericin.

[0089] After fasting for 12 h, the mice in the Ph+Ve and Ph+Ve1 groups were intragastrically administered with 50 mg / kg of phenytoin sodium and 50 mg / kg of verapamil.

[0090] The pharmacokinetic experiments and sampling methods were the same as above.

[0091] UFLC-MS conditions: Chromatographic column: Gemini C18 (3.0 mm × 75 mm, 3.0 μm), column temperature 25 ° C. Isocratic elution mobile phase ratio acetonitrile: water: formic acid (85:15:0.1, v / v / v). The flow rate of the mobile phase is 0.40 mL min -1 The injection volume of each sample was 10 μL and the analysis time was 3 min.

[0092] The mass spectrometry conditions were as follows: negative ion multiple reaction (MRM) mode, electrospray ion source (ESI) detection, spray voltage (IS) of 4500 V, nebulization temperature (TEM) of 350 ° C. The collision energy (CE) of phenytoin sodium and loratadine was 22.0 psi and 30.0 psi, respectively; the collision induced dissociation voltage (DP) was 27 V and 43 V, respectively. The detection ions of phenytoin sodium and loratadine were m / z 253.2→182.2 and 383.2→337.2, respectively.

[0093] The precision, accuracy, recovery, stability and linearity of this method were all qualified.

[0094] Plasma sample processing: Take 60 μL of rat plasma in a 1.5 mL centrifuge tube, add 240 μL of acetonitrile, and vortex for 20 seconds. Centrifuge at 13000 r / min for 10 minutes, and take the supernatant to a new 1.5 mL centrifuge tube. Then put it into a centrifugal concentrator, evaporate the organic phase, add 80 μL of internal standard solution to re-dissolve, vortex for 1 minute, and 4°C, 13000 r / min -1 Centrifuge for 10 min, aspirate 60 μL of the supernatant and inject for analysis.

[0095] The experimental data were statistically analyzed using SPSS 21.0 software and analyzed using the one-way analysis of variance (ANOVA) LSD method. The experimental results are shown in Table 4 and Figure 6-8 .

[0096] Table 4 Main pharmacokinetic parameters of phenytoin sodium in rats of different groups (n=6, x±s)

[0097]

[0098] * P<0.05, ** P<0.01 compared with Ph.

[0099] Figure 6 The blood concentration-time curve of phenytoin sodium in different groups of rats (n=6).

[0100] Figure 7 The expression levels of P-gp in different groups (n=3). (Compared with Ph1, **P<0.01).

[0101] Figure 8 The expression levels of HDAC5 in different groups (n=3). (Compared with Ph1, *P<0.05).

[0102] 3 The results showed that compared with the group given phenytoin sodium alone, the AUC(0-t) (19045.8475±4977.74973vs 16685.1466±2392.54849) increased by 14.15%, AUC (0-∞) (22884.3140±6924.26442vs 20956.5667±7832.9119) increased by 9.20%, MRT (0-t) (7.5232±0.92735vs 7.4334±1.16003) increased by 1.21%, MRT (0-∞) (10.8615±3.48368vs9.2788±2.03966) increased by 17.06%, t 1 / 2z (7.3068±0.80199vs 5.8320±1.2044) increased by 25.29%, CL z / F (3.2563±0.13123vs 2.9008±0.80432) increased by 12.26%, V z / F (26.10166±10.62800vs24.6540±7.30756) decreased by 5.87%. This indicates that under high altitude hypoxia conditions, AUC (0-t) , AUC (0-∞) , MRT (0-t) , MRT (0-∞) ,t 1 / 2z , CL z / F Hypericin, as a P-gp agonist, increases P-gp expression, affects the pharmacokinetic parameters of phenytoin sodium, and reduces the absorption of phenytoin sodium.

[0103] Compared with the group only given phenytoin sodium, the AUC (0-t) (10934.9272±1809.98529vs 16685.1466±2392.54849) decreased by 34.46%, AUC (0-∞) (11147.8800±2062.17487vs 20956.5667±7832.9119) decreased by 46.80%, MRT (0-t) (5.4340±0.77735vs7.4334±1.16003) decreased by 26.90%, MRT (0-∞) (6.0750±1.62323vs9.2788±2.03966) decreased by 34.53%, t 1 / 2z (2.4798±1.28101vs 5.8320±1.2044) decreased by 57.48%, CL z / F(3.0913±1.44314vs 2.9008±0.80432) increased by 6.57%, V z / F (12.4763±7.65512vs24.6540±7.30756) decreased by 49.39%. This indicates that under high altitude hypoxia conditions, administration of P-gp inhibitors reduced P-gp expression in rats, AUC (0-t) , AUC (0-∞) , MRT (0-t) , MRT (0-∞) ,t 1 / 2z Reduce, CL z / F Basically the same. Verapamil, as a P-gp inhibitor, reduces P-gp expression, affects the pharmacokinetic parameters of phenytoin sodium, and increases the absorption of phenytoin sodium.

[0104] Compared with the Ph1 group, the expression of P-gp in the Ph+Hy1 group increased, while that in the Ph+Ve1 group decreased. Hypericin and verapamil played a good role as agonists and inhibitors. Compared with the Ph1 group, the HDAC5 protein level in the Ph+Hy1 group decreased, while that in the Ph+Ve1 group increased.

[0105] In summary, under high altitude hypoxia, compared with normal oxygen in plains, the expression of P-gp in rat liver is closely related to HDAC5, and HDAC5 can regulate P-gp expression. When P-gp agonists or inhibitors are given, P-gp expression changes accordingly, and the changes in P-gp are accompanied by changes in HDAC5. The results of this study show that under high altitude hypoxia, HDAC5 regulates the expression of P-gp in rat liver, and this regulatory effect affects the pharmacokinetics of P-gp substrates. However, the specific regulatory relationship between HDAC5 and P-gp, whether it is direct or indirect regulation, and whether there are other factors involved in the middle, still needs further exploration.

[0106] This application preliminarily explores the regulatory relationship between HDAC5 and P-gp under high-altitude hypoxic environment, in order to further explore the mechanism affecting transporter expression and changes in the pharmacokinetics of related drugs under this condition, and provide guidance for the rational use of drugs for plateau residents.

[0107] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. The use of reagents that inhibit or downregulate HDAC5 gene expression in the preparation of phenytoin sodium adjuvants for patients with acute hypoxia at high altitude; The agent for inhibiting or downregulating HDAC5 gene expression is siRNA targeting HDAC5 gene; the sequence of the siRNA is as follows (1) or (2): (1) Justice chain: GAAACAAGGAGAAGAGCAATT; Antisense strand: UUGCUCUUCUCCUUGUUUCTTT; (2) Justification chain: GGCAGAAGCUGGACAGUAATT; Antisense strand: UUACUGUCCAGCUUCUGCCTT.

Images