A biomimetic mineralized material with high stability for protecting DNA and a preparation method thereof

By self-assembling DNA with divalent metal ions to form nanoparticles and depositing polyelectrolytes and polydopamine layers on the surface, a biomimetic mineralization material with high stability and protection for DNA is constructed, solving the problem of the stability and integrity of DNA molecules in complex environments and realizing low-cost and high-efficiency DNA storage.

CN118240813BActive Publication Date: 2026-05-08FUZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
FUZHOU UNIV
Filing Date
2024-03-08
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies cannot effectively protect DNA molecules from maintaining stability and integrity in complex environments. Traditional methods are costly or toxic and have low storage density.

Method used

By self-assembling DNA and divalent metal ions to form nanoparticles, assembling polyelectrolyte layers layer by layer, and depositing a polydopamine layer on the surface, DNA/Fe@LBL@PDA particles are formed, thus constructing a highly stable biomimetic mineralization material that protects DNA.

Benefits of technology

It achieves long-term stability and integrity of DNA molecules, resisting damage from harsh environments such as nucleases, oxidative free radicals, and high temperatures, thereby reducing storage costs and increasing storage density.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118240813B_ABST
    Figure CN118240813B_ABST
Patent Text Reader

Abstract

The application discloses a kind of biomimetic mineralization materials with high stable protection DNA and preparation method thereof.DNA molecule is self-assembled with divalent metal ion, and DNA / metal nanoparticle is obtained; polyelectrolyte layer is wrapped on the surface of DNA / metal nanoparticle by layer-by-layer assembly technology, and DNA / metal@LBL nanoparticle is obtained; polydopamine layer is deposited on the surface of DNA / metal@LBL nanoparticle, and DNA / Fe@LBL@PDA particle is obtained, which is biomimetic mineralization material with high stable protection DNA.The biomimetic mineralization material has the advantages of simple construction, high density and long-term stability, and can effectively protect the stability and integrity of DNA molecule in harsh external storage environment (such as ROS, high temperature, high salt, alkaline, humid, biological solvent and nuclease environment).The present application can provide technical support for DNA high-density storage and long-term stability storage, and has wide application value in the fields of biological medicine, genetic engineering, disease treatment and DNA storage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology materials science, specifically relating to a biomimetic mineralization material with high stability in protecting DNA and its preparation method. Background Technology

[0002] DNA, the genetic material of living organisms, possesses extremely high storage density and serves as a natural carrier of various life genetic and disease information. Due to its ease of modification, precise assembly, highly effective disease treatment, and high storage density, DNA is widely used in drug delivery, genetic engineering, DNA-based structural design, and as an ideal information storage medium. However, DNA molecules are highly susceptible to damage from nucleases, metal ions, oxidative free radicals, and high temperatures in the environment without protection, leading to the loss of their inherent information and function. Currently known methods for protecting DNA molecules mainly include dehydration, cryopreservation, chemical modification, and silica mineralization. However, these methods cannot provide long-term protection for DNA molecules and also suffer from drawbacks such as high maintenance costs, expensive reagents used in the preparation process, and toxicity.

[0003] Therefore, developing green, environmentally friendly, low-cost, and highly stable biomimetic mineral materials for DNA protection holds promise for achieving long-term stability and integrity during DNA storage. Summary of the Invention

[0004] The purpose of this invention is to provide a biomimetic mineralization material with high stability for protecting DNA and its preparation method, thereby improving the stability, integrity and effectiveness of DNA molecules under complex storage conditions.

[0005] The technical solution adopted in this invention is as follows:

[0006] A method for preparing a biomimetic mineralization material with high DNA protection stability includes the following steps:

[0007] 1) DNA molecules are self-assembled with divalent metal ions to obtain DNA / metal nanoparticles;

[0008] 2) DNA / metal@LBL nanoparticles were obtained by coating a polyelectrolyte layer on the surface of DNA / metal nanoparticles using a layer-by-layer assembly technique;

[0009] 3) A polydopamine layer is deposited on the surface of DNA / metal@LBL nanoparticles to obtain DNA / Fe@LBL@PDA particles, which are biomimetic mineralization materials with high stability in protecting DNA.

[0010] Furthermore, the specific steps of the preparation method of the above-mentioned biomimetic mineralization material with high stability and DNA protection are as follows:

[0011] 1) Prepare a 1-10 μM DNA molecule solution with enzyme-free water, and prepare a 1-20 mM divalent metal ion salt solution with enzyme-free water; mix the DNA molecule solution and the divalent metal ion salt solution evenly in deionized water, incubate in a 95℃ metal bath for 0.5-3 h, and then cool naturally to room temperature to obtain a DNA / metal nanoparticle solution;

[0012] 2) Add polycationic electrolyte to DNA / metal nanoparticle solution and react at room temperature for 10-60 min. Then add polyanionic electrolyte and continue to react at room temperature for 10-60 min to coat the surface of DNA / metal nanoparticles with polyelectrolyte layer to obtain DNA / metal@LBL nanoparticle solution.

[0013] 3) Add dopamine monomer to DNA / metal@LBL nanoparticle solution, adjust pH to 8.5, place in a shaker and react at room temperature and 100-700 rpm for 2-16 h to deposit polydopamine layer on the surface of DNA / metal@LBL nanoparticles to obtain DNA / Fe@LBL@PDA particle solution;

[0014] 4) The DNA / Fe@LBL@PDA particle solution was purified by centrifugation and washing with ultrapure water to separate the purified DNA / Fe@LBL@PDA particles, which are biomimetic mineralization materials with high stability in protecting DNA. They were then stored by vacuum freeze-drying.

[0015] The DNA molecules include, but are not limited to, one or more modified or unmodified double-stranded DNA molecules, single-stranded DNA molecules, and circular DNA molecules.

[0016] The divalent metal ions include, but are not limited to, divalent iron ions, divalent copper ions, and divalent zinc ions;

[0017] The polycationic electrolyte includes, but is not limited to, polyallylamine hydrochloride, polyethyleneimine, and polydimethyldiallyl ammonium chloride;

[0018] The polyanionic electrolyte includes, but is not limited to, poly(4-styrenesulfonic acid), polyacrylic acid, and sodium polystyrenesulfonate; the centrifugal washing is performed at a speed of 8000–12000 rpm for 5–20 min, and 3–6 times.

[0019] A biomimetic mineralization material with high stability in protecting DNA is obtained by the above-mentioned preparation method.

[0020] The above-mentioned preparation methods or biomimetic mineralization materials are used in the field of DNA storage.

[0021] The significant advantages of this invention are:

[0022] This invention discloses a biomimetic mineralization material with high stability for protecting DNA and its preparation method. The preparation method is simple, efficient, green and environmentally friendly, and has wide applicability. It avoids the shortcomings of traditional methods such as poor stability, loss of data function and low DNA loading density during DNA molecule storage. It overcomes the damage caused by harsh environments during storage and ensures the long-term stability of DNA molecule storage. In particular, it plays an important guiding role in solving the problems of low storage unit density, complex synthesis and poor storage stability encountered by traditional DNA molecule storage platforms. Attached Figure Description

[0023] Figure 1 Schematic diagram of the preparation of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles.

[0024] Figure 2 TEM images of DNA / Fe nanoparticles, DNA / Fe@(PAH / PSS)1 nanoparticles, and DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles.

[0025] Figure 3 :Structural stability of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles.

[0026] Figure 4 DNA integrity of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles. Detailed Implementation

[0027] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0028] Example 1

[0029] A method for preparing a biomimetic mineralization material with high stability in protecting DNA ( Figure 1 It includes the following steps:

[0030] 1) Design and artificially synthesize the following DNA oligonucleotide chain with the sequence shown below: 5'-AAGCTTCCAAACTGTGTGGCAAACAAACCCAACCAATTCACCGTGCGGTGACTGCTTC AGCGCTCTGGCAACACAAGAGTCGCATCTTGGAGAGCTATCGGCATCGCGGCATTATAG ACACTTAGCGGCTATGGCTACGA-3'. Prepare a 5 μM DNA oligonucleotide chain solution with enzyme-free water; prepare a 20 mM FeCl2·4H2O solution with enzyme-free water; prepare a 1 mg / ml PAH solution with deionized water; prepare a 1 mg / ml PSS solution with deionized water; prepare a 2 mg / ml DA solution with deionized water.

[0031] 2) Mix 4.2 μL of DNA oligonucleotide chain solution (5 μM) with 1.8 μL of FeCl2·4H2O solution (20 mM) in 44 μL of deionized water until homogeneous. Incubate in a 95℃ metal bath for 3 h, then allow to cool naturally to room temperature to obtain a DNA / Fe nanoparticle solution, which serves as the template motif. Add 2.5 μL of LPAH solution (1 mg / ml) to the obtained DNA / Fe nanoparticle solution and react at room temperature for 30 min. Then add 5 μL of PSS solution (1 mg / ml) and continue reacting at room temperature for another 30 min to coat the template motif with a polyelectrolyte layer, thereby making the template more stable. This yields a DNA / Fe@(PAH / PSS)1 nanoparticle solution, also known as DNA / Fe@LBL nanoparticle solution. Add 6 μL of DA solution (2 mg / ml) to the obtained DNA / Fe@(PAH / PSS)1 nanoparticle solution, and then add pH... The pH was adjusted to 8.5 with Tris-HCl buffer (8.5), and the mixture was reacted in a shaker at room temperature and 418 rpm for 10 h to deposit a polydopamine (PDA) layer on the surface of DNA / Fe@(PAH / PSS)1 nanoparticles, resulting in a DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle solution, also known as DNA / Fe@LBL@PDA biomimetic mineralized DNA particle solution. The obtained DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle solution was then purified by centrifugation with ultrapure water at 8000–12000 rpm. Centrifuge for 5-20 minutes each time, collect the precipitate, and centrifuge 3 times to obtain purified DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles, which are the biomimetic mineralized materials. The purified DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles are then freeze-dried under vacuum (vacuum freeze-drying process conditions: pre-freezing temperature -20℃, pre-freezing time 5h, sublimation temperature (condensation temperature) -52℃, vacuum degree 45Pa, vacuum freeze-drying time 10-24h) to obtain DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle freeze-dried powder for later use.

[0032] The morphology of DNA / Fe nanoparticles, DNA / Fe@(PAH / PSS)1 nanoparticles, and purified DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles was observed using transmission electron microscopy (TEM). Results are shown in [Figure number missing]. Figure 2 .in, Figure 2 A is a TEM image of DNA / Fe nanoparticles. Figure 2 B is a TEM image of DNA / Fe@(PAH / PSS)1 nanoparticles. Figure 2C is a TEM image of the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles. As can be observed from the image, this invention successfully prepared micron-sized DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles.

[0033] 1000 ng of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle lyophilized powder was incubated at 37°C for 32 h in solutions of 1xPBS (pH 7.4), 10% fetal bovine serum (FBS), 2 U / mL DNase I, and pH 10, respectively. The morphology of the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles before and after incubation was observed by TEM. 1000 ng of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle lyophilized powder was stored in artificial climate chambers at 25°C and 70% humidity and at 25°C and 90% humidity for 32 h, respectively. The morphology of the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles before and after storage was observed by TEM. 1000 ng of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle lyophilized powder was heated at 100℃ for 16 h. The morphology of the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles before and after heating was observed by TEM. 1000 ng of DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle lyophilized powder was then incubated with 2.5 μL L-ascorbic acid solution (20 mM), 12.5 μL H2O2 solution (20 mM), and 17.5 μL CuCl2 solution (500 μM) at 25℃ for 15 min. Then, 17.5 μL EDTA (100 mM) was added to terminate the reaction. The morphology of the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles before and after the reaction was observed by TEM. Results are shown below. Figure 3 As observed in the figure, the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles maintained excellent morphology and structure even after 32 hours of treatment under conditions of PBS, FBS, DNase I, pH 10, 70% and 90% air humidity. After 16 hours of high-temperature treatment, the morphology and structure of the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles remained intact. These particles effectively resisted ROS attack. These results demonstrate that the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles possess excellent resistance to harsh storage environments and can effectively protect DNA.

[0034] Further, 1000 ng of naked DNA (i.e., the DNA oligonucleotide chain in this invention) or DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle lyophilized powder was co-incubated with 2 U / mL DNase I at 37°C for 32 h. After dilution with enzyme-free water, the pH was adjusted to 3, and then heated at 95°C for 1 h to release the template DNA. The mixture was then centrifuged at 12000 rpm for 10 min, and the supernatant was collected and 1xPBS (pH 7.4) was added to adjust the pH to neutral to obtain the template DNA, which was then used for PCR amplification. Alternatively, 1000 ng of naked DNA or DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particle lyophilized powder was heated at 100°C for 16 h, diluted with enzyme-free water, and then heated at 95°C for 1 h to release the template DNA. The mixture was then centrifuged at 12000 rpm for 10 min, and the supernatant was collected and 1xPBS (pH 7.4) was added to adjust the pH to neutral to obtain the template DNA, which was then used for PCR amplification. The PCR amplification reaction system was as follows: In a 50 μL PCR reaction, 1 μL of template DNA was mixed with 6 μL of 10 μM forward primer (5'-AAGCTTCCAAACTGTGTGGC-3), 6 μL of 10 μM reverse primer (5'-TCGTAGCCATAGCCGCTAAG-3'), 5 μL of dNTPs, and Mg... 2+ Mix 5 μL buffer, 26.5 μL DCEP water, and 0.5 μL LA Taq DNA polymerase. The reaction followed the thermal protocol: (1) 95℃ for 3 min, (2) 95℃ for 30 s, (3) annealing at 60℃ for 30 s, (4) 72℃ for 40 s, and (2)-(4) were repeated 30 times. After the PCR amplification reaction, the PCR products were detected by agarose gel electrophoresis. The results are shown in the figure. Figure 4 As can be observed from the figure, the DNA / Fe@(PAH / PSS)1@PDA biomimetic mineralized DNA particles can effectively protect DNA under DNase I and high temperature conditions, thus ensuring the integrity of the DNA (lanes 1 and 3 show uniform bands, around 140bp), while the integrity of naked DNA is destroyed and cannot be effectively amplified by PCR.

[0035] In summary, this invention discloses a biomimetic mineralization material with high stability for protecting DNA and its preparation method, belonging to the field of DNA-based mineralization protection technology, and particularly relating to a highly stable DNA information storage method. This invention constructs a high-density primitive template through the self-assembly of DNA and metal ions, and then uses Layer-by-Layer biomimetic mineralization technology to construct high-density, structurally stable biomimetic mineralized DNA particles from the bottom up, offering advantages such as simple construction, high density, and long-term stability. The preparation method of this biomimetic mineralization material is expected to provide technical support for achieving high-density and long-term stable DNA storage.

[0036] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A method for preparing a biomimetic mineralization material with high stability in protecting DNA, characterized in that: Includes the following steps: 1) DNA molecules are self-assembled with divalent metal ions to obtain DNA / metal nanoparticles; 2) DNA / metal@LBL nanoparticles are obtained by coating a polyelectrolyte layer on the surface of DNA / metal nanoparticles using a layer-by-layer assembly technique: a polycationic electrolyte is added to a DNA / metal nanoparticle solution and reacted, then a polyanionic electrolyte is added and the reaction continues, so as to coat a polyelectrolyte layer on the surface of DNA / metal nanoparticles and obtain a DNA / metal@LBL nanoparticle solution. 3) A polydopamine layer is deposited on the surface of DNA / metal@LBL nanoparticles to obtain DNA / Fe@LBL@PDA particles, which are biomimetic mineralization materials with high stability in protecting DNA; The divalent metal ion is a divalent iron ion; The polycationic electrolyte is polyallylamine hydrochloride; The polyanionic electrolyte is poly(4-styrenesulfonic acid).

2. The preparation method according to claim 1, characterized in that: The specific steps are as follows: 1) Prepare a 1-10 μM DNA molecule solution with enzyme-free water, and prepare a 1-20 mM divalent metal ion salt solution with enzyme-free water; mix the DNA molecule solution and the divalent metal ion salt solution evenly in deionized water, incubate in a 95℃ metal bath for 0.5-3 h, and then cool naturally to room temperature to obtain a DNA / metal nanoparticle solution; 2) Add polycationic electrolyte to DNA / metal nanoparticle solution and react at room temperature for 10-60 min. Then add polyanionic electrolyte and continue to react at room temperature for 10-60 min to coat the surface of DNA / metal nanoparticles with polyelectrolyte layer to obtain DNA / metal@LBL nanoparticle solution. 3) Add dopamine monomer to DNA / metal@LBL nanoparticle solution, adjust pH to 8.5, place in a shaker and react at room temperature and 100~700 rpm for 2~16 h to deposit polydopamine layer on the surface of DNA / metal@LBL nanoparticles to obtain DNA / Fe@LBL@PDA particle solution; 4) The DNA / Fe@LBL@PDA particle solution was purified by centrifugation and washing with ultrapure water to separate the purified DNA / Fe@LBL@PDA particles, which are biomimetic mineralization materials with high stability in protecting DNA. They were then stored by vacuum freeze-drying.

3. The preparation method according to claim 2, characterized in that: The DNA molecules include, but are not limited to, one or more modified or unmodified double-stranded DNA molecules, single-stranded DNA molecules, and circular DNA molecules.

4. The preparation method according to claim 2, characterized in that: The centrifugal washing is performed at a speed of 8000~12000 rpm for 5~20 min, and 3~6 times.

5. A biomimetic mineralization material with high stability in protecting DNA, characterized in that: It is obtained by the preparation method described in claim 1.

6. The application of the preparation method according to claim 1 or the biomimetic mineralization material according to claim 5 in the field of DNA storage.