Application of TAK1 in the preparation of drugs for treating peripheral nerve injury

Abstract

The present invention provides the use of TAK1 in the preparation of drugs for the treatment of peripheral nerve injury, which relates to the field of biomedical technology. The present application constructs a sciatic nerve crush model mouse and conducts behavioral, morphological, and molecular biological tests. The results show that TAK1 kinase can promote the repair of damaged sciatic nerve myelin, promote motor balance ability, and has a positive therapeutic effect on peripheral nerve myelin damage diseases. And compared with wild-type model mice, TAK1 treatment promotes the regeneration and repair of sciatic nerve myelin in mice after crushing.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to application of TAK1 in preparing medicine for treating peripheral nerve injury. Background Art

[0002] The peripheral nervous system is widely distributed in the body and plays a role in signal transmission between target organs and the central nervous system. Peripheral nerve regeneration is a complex biological process involving multiple regulatory factors, including Schwann cells, inflammatory cells, neurotrophic factors, extracellular matrix and inflammatory factors. Peripheral nerve injury can cause the disintegration of distal nerve stump axons and the inflammatory response of non-neuronal cells, leading to degenerative lesions, also known as Wallerian degeneration. Therefore, the increase in the expression of inflammatory factors in damaged nerve tissue will aggravate the inflammatory response of the nerve tissue, cause an increase in the number of newly born unmyelinated nerves, and ultimately inhibit the repair and regeneration of damaged nerves, leading to a delay in the repair process of damaged nerves. Among them, the sciatic nerve is the most important and most intuitive material for studying the development and regeneration of peripheral nerves. Therefore, the sciatic nerve is usually used in the prior art for subsequent experiments.

[0003] In the prior art, peripheral nerve injury is usually treated with analgesics and surgical treatment, but there is a lack of treatment methods, so new treatment methods need to be developed. Summary of the invention

[0004] The purpose of the present invention is to solve the technical problems that the treatment methods for peripheral nerve injury in the prior art are very limited and lacking.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Application of TAK1 in the preparation of drugs for treating peripheral nerve injury.

[0007] Preferably, the peripheral nerve injury comprises sciatic nerve myelin injury.

[0008] Preferably, through the overexpression of TAK1, the expression of inflammation-related genes is inhibited, the repair of the sciatic nerve myelin sheath is promoted, and the motor balance ability is promoted.

[0009] The present application also provides a method for constructing a sciatic nerve myelin injury model, which is used to verify the application of TAK1 in the preparation of drugs for treating peripheral nerve injury. The construction method comprises the following steps:

[0010] S1: Mice were anesthetized by subcutaneous injection of 3% sodium pentobarbital;

[0011] S2: The skin below the buttocks was incised and the muscle was bluntly dissected using fine surgical scissors and forceps to expose the right sciatic nerve in the mid-thigh;

[0012] S3: The sciatic nerve of mice was crushed 0.5 cm above the rupture of the sural, common peroneal and tibial branches; the uninjured sciatic nerve of the right hind limb was used as a control.

[0013] Preferably, the crushing method in S3 is as follows: the sciatic nerve is compressed for 30 seconds using a straight-tipped serrated 5.0 fine forceps until an obvious translucent area appears.

[0014] The present application also provides a verification method for the application of TAK1 in the preparation of drugs for treating peripheral nerve injury, including the following experiments: rotating rod test, gait test, transmission electron microscopy morphological analysis, and total RNA extraction and gene expression detection of sciatic nerve tissue.

[0015] The present application provides the use of transforming growth factor-βactivated kinase 1 (TAK1) in the preparation of drugs for treating sciatic nerve myelin damage diseases; by constructing a sciatic nerve crush model mouse, and conducting behavioral, morphological, and molecular biological tests. The results showed that compared with wild-type model mice, TAK1 treatment promoted the regeneration and repair of sciatic nerve myelin in mice after crush. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 In one embodiment of the present invention, wild-type sciatic nerve crush mice and TAK1 - / - Comparison of rotarod test in mice with sciatic nerve crush;

[0017] Figure 2 This is a comparison diagram of the rotarod test between wild-type sciatic nerve crush mice and TAK1 overexpressing sciatic nerve crush mice in one embodiment of the present invention;

[0018] Figure 3 In one embodiment of the present invention, wild-type sciatic nerve crush mice and TAK1 - / - Comparison of the microstructure of the sciatic nerve myelin sheath in mice with sciatic nerve crush;

[0019] Figure 4 A comparison diagram of the microstructure of the sciatic nerve myelin sheath of a wild-type sciatic nerve crush mouse and a TAK1-overexpressing sciatic nerve crush mouse in one embodiment of the present invention;

[0020] Figure 5 In one embodiment of the present invention, wild-type sciatic nerve crush mice and TAK1 - / -Comparison of the expression of myelin-related genes PMP22 and MPZ detected by real-time quantitative PCR in mice with sciatic nerve crush;

[0021] Figure 6 This is a comparison diagram of the expression of myelin-related genes PMP22 and MPZ detected by real-time quantitative PCR experiment between wild-type sciatic nerve crush mice and TAK1 overexpressing sciatic nerve crush mice in one embodiment of the present invention;

[0022] Figure 7 In one embodiment of the present invention, wild-type sciatic nerve crush mice and TAK1 - / - Comparison of the expression changes of pro-inflammatory factors Cd68, IL-1a, IL-1b, IL-12a, and Tnf-a detected by real-time quantitative PCR experiment in mice with sciatic nerve crush;

[0023] Figure 8 This is a comparison chart of the expression changes of pro-inflammatory factors Cd68, IL-1a, IL-1b, IL-12a, and Tnf-a detected by real-time quantitative PCR experiment between wild-type sciatic nerve crush mice and TAK1 overexpressing sciatic nerve crush mice in one embodiment of the present invention. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below in conjunction with specific embodiments.

[0025] Application of TAK1 in the preparation of drugs for treating peripheral nerve injury.

[0026] The TAK1 is a member of the MAPKKK family, a serine-threonine protein kinase, also known as MAP3K7 or MEKK7. The TAK1 gene is located at the chromosome 6q15 locus, and its NP number is 033342.1.

[0027] The peripheral nerve injury includes sciatic nerve myelin injury; through the overexpression of TAK1, the expression of inflammation-related genes is inhibited, and the repair of sciatic nerve myelin is promoted, thereby promoting the ability of movement balance.

[0028] The present application also provides a method for constructing a sciatic nerve myelin injury model, which is used to verify the application of TAK1 in the preparation of drugs for treating peripheral nerve injury. The construction method comprises the following steps:

[0029] S1: The mice were anesthetized by subcutaneous injection of 3% sodium pentobarbital (1 ml / kg)

[0030] S2: Cut the skin below the buttocks and bluntly cut the muscle with fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh

[0031] S3: The sciatic nerve of mice was crushed 0.5 cm above the rupture of the sural, common peroneal and tibial branches. The uninjured sciatic nerve of the right hind limb was used as a control.

[0032] The crushing method was as follows: the sciatic nerve was compressed for 30 seconds using a straight-tipped serrated 5.0 fine forceps until a distinct translucent area appeared.

[0033] In order to verify the application of TAK1 in the preparation of drugs for the treatment of peripheral nerve injury, the present application also proposes the following verification experiments to prove its application effect, including rotating rod test, gait test, transmission electron microscopy morphological analysis, and total RNA extraction and gene expression detection of sciatic nerve tissue.

[0034] The above contents of this application are described below in combination with specific verification experiments:

[0035] Example 1: Construction of an in vivo sciatic nerve myelin injury model:

[0036] Eight-week-old TAK1 knockout mice and TAK1 gene overexpression mice were selected. In the present application, the above mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.

[0037] Model construction: Anesthesia was performed by subcutaneous injection of 3% sodium pentobarbital (1ml / kg). The skin below the buttocks was cut open, and the muscle was bluntly incised with fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh. The sciatic nerves of transgenic mice and wild-type mice were crushed 0.5 cm above the fracture of the sural, common peroneal and tibial branches. First, the sciatic nerve was compressed for 30s with straight-tip serrated 5.0 fine forceps until a clear translucent area appeared. The uninjured sciatic nerve of the right hind limb was used as a control. All animal experimental protocols in this application were approved by the Animal Protection and Utilization Committee of Nantong University and the Animal Protection Ethics Committee of Jiangsu Province. The establishment of the mouse sciatic nerve injury model was carried out in accordance with the approved guidelines.

[0038] Example 2: Behavioral analysis of model mice:

[0039] In order to further clarify the effect of TAK1 on sciatic nerve myelin regeneration and motor recovery, the present application conducted rotarod test and gait test on wild-type mice, TAK1 overexpression mice and TAK1 knockout mice.

[0040] Rotarod test: The accelerating rotarod apparatus (model LE8500, Pan Laboratory) was used. Before the experiment, wild-type mice, TAK1 overexpression and knockout mice were placed in the laboratory for 30 minutes. The mice were gently placed on the rotarod by gently shaking the mice, and trained in the accelerating mode (4-40 rpm) on the rotarod for 3 days at intervals of 3 minutes and 5 minutes. The training was repeated at a constant speed (16 rpm) until the mice were able to stay on the rod for at least 300 seconds. For the formal test, the mice were placed on a rotating drum and the rotarod was set to the accelerating mode, i.e., accelerated at a speed of 4 to 40 rpm within 5 minutes. The time moving on the rotarod was recorded before measuring the fall.

[0041] Gait experiment: The gait dynamics of quadrupeds were evaluated by footprint analysis of mice using the Digigait imaging system, and the stride length of the hind limbs was evaluated at a speed of 8 cm / s. The footprints were analyzed by the following four measurements: distance to the contralateral foot, footprint length, maximum toe extension between the first and fifth toes, and paw extension between the center of the second and fourth toes. The recovery of the injured sciatic nerve was reflected by the sciatic nerve function index.

[0042] See also Figure 1 and Figure 2 , gait experiment was used to detect the recovery of the damaged sciatic nerve. The results showed that compared with wild-type mice, 14 days after sciatic nerve injury, the rotarod time of TAK1 knockout mice was reduced and the sciatic nerve function index became worse, that is, the motor recovery ability was worse; the rotarod time of TAK1 overexpression mice was increased, and the sciatic nerve function index improved, that is, the motor recovery was better. Therefore, TAK1 kinase can significantly alleviate the motor dysfunction of mice with sciatic nerve myelin injury model, and is beneficial to the motor recovery of mice with sciatic nerve injury, that is, 1. The motor behavior recovery ability of sciatic nerve crush mice after TAK1 knockout is reduced, while TAK1 overexpression promotes the recovery of motor function in nerve-damaged mice.

[0043] Example 3: Transmission electron microscopy morphological analysis:

[0044] Three mice with sciatic nerve crush were randomly selected from different groups (wild control group, TAK1 gene knockout group and TAK1 gene overexpression group) (14 days after injury). Under deep anesthesia, the sciatic nerve tissue at the distal end of the injury was taken and cut into electron microscope specimen size (1.2mm x1 mmx1 mm), immersed in 4% glutaraldehyde solution for 24 hours, fixed with 1% osmium acid for secondary fixation, stained with uranyl acetate, dehydrated with gradient ethanol, embedded in epoxy resin, positioned on semi-thin sections, counterstained with lead citrate on ultra-thin sections, and finally observed under a transmission electron microscope at 80KV (Japan, JEO Co., Ltd.). The obtained photos were used to measure the myelinated nerve diameter and axon diameter on the instrument's built-in image analysis system, and the myelin thickness was measured by the axon diameter / myelinated nerve diameter value (G ratio). The larger the G ratio, the thinner the myelin thickness, thus inferring the effect of TAK1 kinase on the myelin regeneration process.

[0045] See also Figure 3 and Figure 4 , transmission electron microscopy results showed that 14 days after injury, compared with wild-type mice, TAK1 knockout mice had thinner myelin sheaths and more unmyelinated nerves in the regenerated sciatic nerve tissue; TAK1 overexpression mice had thicker new myelin sheaths and fewer unmyelinated nerves, which promoted the growth of new myelin sheaths. Therefore, TAK1 kinase is beneficial to maintaining the integrity of the myelin sheath structure of the regenerated sciatic nerve tissue, that is, TAK1 kinase is beneficial to the recovery of the tissue structure of mice with damaged sciatic nerves. That is, the myelin sheath thickness of the regenerated tissue of sciatic nerve crush mice after TAK1 knockout was thinner and there were more unmyelinated nerves, while the myelin sheath thickness of the regenerated nerve tissue increased after TAK1 overexpression, and there were fewer unmyelinated nerves.

[0046] Example 4: Total RNA extraction and gene expression detection from sciatic nerve tissue

[0047] Total RNA from sciatic nerve tissue was extracted using Invitrogen's Trizol reagent, and the first-strand cDNA was synthesized using Roche's reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix, and the instrument was Bio-Rad's iQ5 Multicolor Real-Time PCR Detection System. The analysis results were calculated using the 2-△△Ct method for mRNA levels. The 18S housekeeping gene was used to calibrate the mRNA level. The primer sequences used are as follows:

[0048] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

[0049] 18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

[0050] Pmp22 forward primer: ATCTCAAAGCCTTCGTCACTCC

[0051] Pmp22 negative primer: GGCCAATACAAGTCATCGCTAG

[0052] Mpz forward primer: GGATAAGAAATAGCGGTTAGC

[0053] Mpz negative primer: TTGAGGCTGGTTCTACTG

[0054] Tnf-α forward primer: CCTCCTCTTTTGCTTATGTTTA

[0055] Tnf-α negative primer: TATTTCTCTCAATGACCCGTA

[0056] IL-1α forward primer: GTGTTGCTGAA GGAGTTG

[0057] IL-1α negative primer: ATCTGGAAGTCTGTCATAGAG

[0058] IL-1β forward primer: GCAACTGTTCCTGAACTCAACT

[0059] IL-1β negative primer: ATCTTTTGGGGTCCGTCAACT

[0060] IL-12α forward primer: TTCTCCCATCACATCTCATC

[0061] IL-12α negative primer: TGCTCTTCTGCTAACACAT

[0062] Cd68 forward primer: CAAAGGACAAAGAGCAACTAA

[0063] Cd68 negative primer: TGAATCAAGATGGACACATTAC

[0064] See also Figure 5 and Figure 6 The expression of myelin-related genes PMP22 and MPZ was detected by real-time quantitative PCR. The results showed that compared with wild-type crush mice, the expression of myelin-related genes in sciatic nerve crush mice after TAK1 knockout was reduced, while the expression of myelin-related genes in sciatic nerve tissue of TAK1 overexpressed mice was increased, that is, the expression of myelin-related genes in sciatic nerve crush mice after TAK1 knockout was decreased, while TAK1 overexpression promoted the expression of myelin-related genes.

[0065] See also Figure 7 and Figure 8 The expression changes of pro-inflammatory factors Cd68, IL-1a, IL-1b, IL-12a, and Tnf-a were detected by real-time quantitative PCR experiments. The results showed that compared with wild-type crush mice, the expression of pro-inflammatory genes in sciatic nerve crush mice after TAK1 knockout increased, and the inflammatory response was aggravated, while the expression of pro-inflammatory genes in sciatic nerve tissues of TAK1 overexpressed mice decreased, and the inflammatory response was weakened. That is, the expression of inflammation-related genes in sciatic nerve crush mice after TAK1 knockout increased, and TAK1 overexpression inhibited the expression of inflammation-related genes.

[0066] In summary, the present application provides the application of transforming growth factor-βactivated kinase 1 (TAK1) in the preparation of drugs for treating sciatic nerve myelin injury diseases, wherein transforming growth factor-βactivated kinase 1 (TAK1) belongs to serine / threonine kinase, consists of 606 amino acids, and the encoding gene is Mitogen-activated protein kinase kinase kinase kinase 7 (Map3k7). TAK1 is a member of the mitogen-activated protein kinase family (Mitogen-activated protein kinase, MAPK), and was initially identified as a kinase activated by TGFβ and bone morphogenetic protein BMP. TAK1 kinase is widely distributed in the body and plays an important role in a variety of biological processes. TAK1 can be activated by a variety of factors (such as TLRs, IL-1, TGF-β, etc.), and the activated TAK1 phosphorylates a series of downstream kinases (IKK, MAPK, etc.) to regulate the expression of inflammatory genes and the activation of immune cells. TAK1 kinase can regulate a variety of apoptosis-related proteins (IκBα, p53 and Bcl-2 family proteins) to affect apoptosis, and can also participate in MAPK and JNK signaling pathways to regulate cell proliferation and cell differentiation. In short, TAK1 kinase plays a key role in multiple biological processes such as inflammatory response, immunity, cell proliferation, apoptosis, differentiation, tissue repair and stress response.

[0067] In this application, a sciatic nerve crush model mouse was constructed and behavioral, morphological and molecular biological tests were performed. The results showed that compared with wild-type model mice, TAK1 treatment promoted the regeneration and repair of sciatic nerve myelin in mice after crush.

Claims

1. The use of TAK1 in the preparation of a drug for treating peripheral nerve damage, characterized in that: The peripheral nerve injury is sciatic nerve myelin injury. Through the overexpression of TAK1, the expression of inflammation-related genes is inhibited, and the repair of the sciatic nerve myelin is promoted, thereby improving the motor balance ability.

Images