Gene regulating rice blast resistance extension factor complex subunit oselp4 and application thereof
By cloning and regulating the rice OsELP4 gene, the shortcomings in rice blast resistance research have been addressed, achieving efficient regulation of rice resistance to rice blast and providing a breeding program for new disease-resistant varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUBEI UNIV
- Filing Date
- 2024-04-29
- Publication Date
- 2026-05-15
AI Technical Summary
Current research on rice blast resistance is not in-depth, especially the function of the elongation factor complex subunit OsELP4 in rice blast resistance has not been reported, which has led to a significant impact on rice yield and quality.
By cloning the OsELP4 gene in the rice genome and using Agrobacterium-mediated genetic transformation to overexpress or knock out the gene in rice, it was found that OsELP4 is a positive regulator of rice blast resistance. Overexpressed materials showed enhanced resistance to rice blast, while knockout materials were more susceptible to rice blast.
By regulating the expression level of the OsELP4 gene, the resistance of rice to rice blast was significantly improved, the disease resistance of rice was enhanced, and new rice blast resistant lines and breeding materials were provided.
Smart Images

Figure BDA0004818854440000091 
Figure BDA0004818854440000092 
Figure BDA0004818854440000093
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the function and application of the sub-OsELP4 gene of the elongation factor complex in regulating rice resistance to rice blast. Background Technology
[0002] Rice is a plant belonging to the genus Oryza of the Poaceae family. It is widely cultivated and is a major food source for approximately 100 countries worldwide (Giri J., Parida SK, Raghuvanshi S., et al. Emerging Molecular Strategies for Improving Rice Drought Tolerance[J]. Curr Genomics, 2021, 22(1): 16-25). In my country, more than 65% of the population relies on rice as their staple food. However, with the continuous growth of the population and the improvement of people's living standards, the contradiction between rice production and demand has become increasingly prominent. One of the reasons for insufficient rice production is that rice growth is affected by a variety of complex biological stresses (Qian Chunjian. Isolation and preliminary identification and analysis of NAC genes related to tomato ripening[D]. Huazhong Agricultural University, 2007). Rice blast is a biological stress that has a long-term impact on rice yield and quality. Caused by the ascomycete *Magnaporthe oryzae*, it is one of the three major diseases affecting rice. Due to rice blast, global rice production is reduced by 10%-30% annually (Luo Y.-H., Jiang P., Xie K., et al. Research on optimal predicting model for the grading detection of rice blast[J]. Optical Review, 2019, 26(1):118-123). Chemical control methods for rice blast are not only costly but also pose health hazards and environmental pollution problems. Therefore, addressing the harm of rice blast to rice has become an urgent and necessary task for rice-growing countries worldwide. Scientists have learned through years of practical application that breeding disease-resistant rice varieties is the most economically efficient strategy to improve rice’s resistance to rice blast. The breeding of disease-resistant varieties requires the discovery and functional analysis of disease-resistant genes. The discovery of disease-resistant genes provides theoretical guidance for the selection and breeding of disease-resistant varieties and has important reference value for ensuring global food security and cultivating high-quality rice.
[0003] When plants are infected by pathogens, cells receive instructions to reprogram the transcriptome, shifting from normal development to a disease-resistant pathway. The strength of disease resistance is related to the degree of transcriptome reprogramming. In this process, the elongator complex (ELP) plays a very important role (An C., Ding Y., Zhang X., et al. Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis[J]. Molecular plant-microbe interactions:MPMI,2016,29(5):396-404). The Elongator complex has been identified as an interactor of hyperphosphorylated RNAPII in yeast. Initially, it was identified as three proteins, ELP1, ELP2, and ELP3, in Saccharomyces cerevisiae. Subsequently, ELP4, ELP5, and ELP6 proteins were also identified as part of the elongator complex (Otero G., Fellows J., Li Y., et al. Elongator, a multisubunit component of anovel RNA polymerase IIholoenzyme for transcriptional elongation[J]. Mol Cell, 1999, 3(1):109-118).The complete elongator complex consists of a core complex composed of ELP1, ELP2, and ELP3, and an accessory complex composed of ELP4, ELP5, and ELP6 (Krogan NJ, Greenblatt JF, Characterization of a six-subunit holo-elongator complex required for the regulated expression of a group of genes in Saccharomyces cerevisiae [J]. Mol Cell Biol, 2001, 21(23): 8203-8212). ELP1, ELP2, and ELP3 form a symmetrical dimer that binds to the hexamers ELP4, ELP5, and ELP6 (Dauden MI, Kosinski J., Kolaj-Robin O., et al. Architecture of the yeast Elongator complex [J]. EMBORep, 2017, 18(2): 264-279).
[0004] Currently, only the functions of ELP proteins (AtELP1-6) in the model plant Arabidopsis thaliana have been reported, indicating that ELPs play a positive regulatory role in plant immunity. Elongation factors have been found to play a key role in non-host resistance in Arabidopsis and tomato, suggesting that the ELP family can positively regulate plant immunity. However, research on the disease resistance function of ELPs is still limited, and there are few reports on the functions of ELPs in other plants, especially crops. For instance, whether OsELP4 mediates resistance to rice blast in rice remains unreported. Summary of the Invention
[0005] The purpose of this invention is to provide a subunit gene of the rice blast resistance-related elongation factor complex, OsELP4. This gene was cloned from the rice genome based on Arabidopsis homology sequence alignment and differential expression analysis of rice inoculated with rice blast fungus. The nucleotide sequence of the OsELP4 gene is shown in SEQ ID NO: 1.
[0006] Another object of this invention is to provide the application of the elongation factor complex subunit gene OsELP4 in rice blast resistance. Through genetic transformation, the sequence shown in SEQ ID NO: 1 or a functionally equivalent homologous gene is overexpressed in rice plants. The protein sequence encoded by the gene of this invention is shown in SEQ ID NO: 2.
[0007] This invention analyzes the expression patterns of the rice elongation factor family induced by *O. rice blast fungus*, identifying a gene, OsELP4, whose expression is significantly upregulated by *O. rice blast fungus*. Using *Agrobacterium*-mediated genetic transformation, overexpression or knockout of this gene in rice revealed that transgenic materials overexpressing the gene exhibited enhanced resistance to rice blast, while mutant materials were more susceptible. This indicates that OsELP4 is a positive regulator of rice resistance to rice blast. Furthermore, this invention relates to vectors containing this gene or its homologous gene fragments, and the design of this gene or its functional analogs to enhance plant resistance to rice blast in agricultural breeding.
[0008] The technical solution of the present invention is as follows:
[0009] The applicant cloned an extension factor OsELP4 gene that regulates rice blast resistance, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0010] The protein sequence encoded by the rice elongation factor OsELP4 gene, which regulates rice blast resistance, is shown in SEQ ID NO:2.
[0011] The present invention relates to the application of the OsELP4 gene in regulating rice blast resistance.
[0012] The more detailed technical solution is as follows:
[0013] The expression patterns of the rice ELP gene family induced by rice blast fungus were analyzed using RT-qPCR. Based on the gene expression patterns, the target gene OsELP4 (see [link to study]) was finally identified. Figure 1 (Figure A in the text).
[0014] RNA was extracted from leaves of the japonica rice variety Nipponbare and synthesized into cDNA using reverse transcriptase Superscript III (purchased from Invitrogen, USA). Reaction conditions: 65℃ for 5 min, 50℃ for 60 min, and 70℃ for 10 min. Using rice genome information, amplification primers OsELP4-full-F (5'ATGGCCGCCGCCGCCGGAGG 3') and OsELP4-full-R (5'GAAATCAAGCTGTGAACCTTG 3') were synthesized to amplify the full-length cDNA of the OsELP4 gene (1134 bp). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 2 min 50 sec, 28 cycles; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced to obtain the desired gene ORF, whose sequence is the nucleotide sequence shown in SEQ ID NO:1, encoding a 378-amino acid sequence (the sequence shown in SEQ ID NO:2). Homology alignment analysis of the amino acid sequence revealed that OsELP4 had the highest homology with the ELP4 gene derived from *Smilax glabra*, followed by the ELP4 gene derived from *Brachys pubescens*. Figure 1 (Figure B in the diagram).
[0015] This invention constructed the overexpression vector pU1301-OsELP4-Flag for this gene (see...). Figure 2 Figure A in the diagram) and the CRISPR / Cas9-OsELP4 gene knockout vector ( Figure 2 (Figure B in the figure) The applicant used Agrobacterium-mediated transformation to transform the two vectors into the japonica rice variety Nipponbare, obtaining positive lines for overexpression of the gene and CRISPR / Cas9 positive lines. The expression levels were detected, and two T1 generation overexpression lines with matching expression levels (numbered OE-ELP4-10 and OE-ELP4-45, see Figure B) were selected. Figure 3 Figure A in the diagram) and two CRISPR / Cas9 transformed lines (detection primers were designed upstream and downstream of the target site to amplify the corresponding fragments and perform sequencing; materials that underwent gene editing at the target site, resulting in large fragment deletions or premature translation termination, were screened for subsequent experiments; finally, two lines numbered elp4-5 and elp4-16 that terminated prematurely were selected (see Figure A in the diagram)). Figure 3 Figure B in the diagram is used as the material for subsequent experiments.
[0016] This invention evaluated OsELP4 transgenic materials (overexpression lines and CRISPR / Cas9 mutant lines) against rice blast. The results showed that, compared to the control materials, the OsELP4 overexpression materials exhibited significantly increased resistance to rice blast, while the ELP4 mutant was more susceptible to rice blast fungus. Figure 4 72 hours after inoculation with rice blast fungus, the expression levels of disease resistance-related genes OsAOS1, OsAOS2, OsLOX6, OsCKP10, OsMYB30, and OsMYB55 were significantly higher in the OsELP4 overexpression material than in the control material. Figure 5 This shows that OsELP4 positively regulates rice resistance to rice blast.
[0017] Advantages of this invention:
[0018] (1) This invention analyzes the expression pattern of rice elongation factor complex genes induced by rice blast, screens and identifies the OsELP4 gene, and finds that OsELP4 is a positive regulatory factor for rice resistance to rice blast. Through genetic transformation, overexpression of this gene yields new rice lines resistant to rice blast, and it can also serve as a potential marker gene for rice resistance materials.
[0019] (2) Rice overexpressing OsELP4 showed significantly enhanced resistance to rice blast, while the elp4 mutant was more susceptible to rice blast. This indicates that the OsELP4 gene is involved in the rice resistance response to rice blast and plays an important role. Increasing the expression level of the OsELP4 gene can regulate the accumulation of resistance factors OsAOS1, OsAOS2, OsLOX6, OsCKP10, OsMYB30, and OsMYB55 in rice, thereby improving the rice's resistance to rice blast. Attached Figure Description
[0020] Figure 1 OsELP4 induced expression pattern and phylogenetic tree analysis diagram. Figure label explanation: Figure 1 Figure A shows that OsELP4 expression was significantly induced in wild-type Nipponbare rice after inoculation with rice blast fungus at 0, 24, 48, 72, 96, 120, and 144 hours, compared to the control. Figure 1 Figure B in the diagram represents the phylogenetic analysis of OsELP4. Phylogenetic and bioinformatics analyses were performed on other representative plants. The results showed that the OsELP4 sequence had the highest homology with the PmELP4 sequence of *Panicum miliaceum*, followed by the ELP4 amino acid sequence of *Brachypodium distachyon*.
[0021] Figure 2Construction of OsELP4 overexpression vector and CRISPR / Cas9 gene knockout vector. (Figure labels are explained below.) Figure 2 Figure A in the diagram is a schematic diagram of the construction of the pU1301-OsELP4-3*Flag overexpression vector. Figure 2 Figure B in the diagram is a schematic diagram of the construction of the CRISPR / Cas9-OsELP4 gene knockout vector.
[0022] Figure 3 : Test results of genetically modified offspring. (See attached image for labeling information.) Figure 3 Figure A in the figure shows the detection results of OsELP4 overexpression material (T1 generation). Figure labeling explanation: Two transgenic rice lines, OE-ELP4-10 (intermediate expression level) and OE-ELP4-45 (high expression level), were selected for subsequent research. Figure 3 Figure B in the diagram shows the gene editing type detection of the elp4 mutant. Two mutant lines, elp4-5 and elp4-16, which exhibited premature translation termination, were selected for further research.
[0023] Figure 4 : Identification of rice blast resistance in control materials and transgenic materials. Figure labeling explanation: Figure 4 Figure A shows the phenotypic observation of the control material (WT) and transgenic materials (ELP4-10, ELP4-45, elp4-5, elp4-16) 5 days after inoculation with rice blast fungus. Figure 4 Figure C shows the phenotypic observation of detached leaves of the control material (WT) and transgenic materials (ELP4-10, ELP4-45, elp4-5, elp4-16) after 5 days of inoculation with rice blast fungus. Figure 4 Figure B shows the statistical results of bacterial plaque area on detached leaves. The results indicate that, compared with the control material, OsELP4 overexpression is more resistant to rice blast, while the elp4 mutant is more susceptible to rice blast.
[0024] Figure 5 Analysis of the expression of disease resistance-related genes in control and transgenic materials 72 hours after inoculation with rice blast fungus. Figure labeling explanation: Figure 5 This is the result of detecting the expression levels of disease resistance-related genes OsAOS1, OsAOS2, OsLOX6, OsCKP10, OsMYB30, and OsMYB55 in control materials (WT) and transgenic materials (OE-10, OE-45, elp4-5, and elp4-16) 72 hours after inoculation with rice blast fungus. Detailed Implementation
[0025] Description of sequences in a sequence list
[0026] SEQ ID NO: 1 is the nucleotide sequence of the OsELP4 gene cloned in this invention.
[0027] SEQ ID NO: 2 is the protein sequence encoded by the OsELP4 gene.
[0028] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsELP4 gene, and for verifying the function of the OsELP4 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope.
[0029] Example 1: Isolation and Cloning of the OsELP4 Gene
[0030] 1. Rice RNA extraction and reverse transcription
[0031] Total RNA was extracted from fresh leaves of wild-type japonica rice cultivar Nipponbare (a publicly used rice material). The MiniBEST Plant RNA Extraction Kit was used, following the instructions for the TaKaRa PrimeScript TMRT reagent Kit with gDNA Eraser. The obtained RNA samples were first subjected to a genomic DNA removal reaction. The DNA removal reaction solution consisted of: 2.0 μL 5×gDNA Eraser Buffer, 1.0 μL gDNA Eraser, 1.0 μg RNA, and 6.0 μL RNase-free ddH2O. After mixing, the mixture was incubated in a dry bath at 42°C for 2 min. The digested mixture was then used for reverse transcription. The reaction solution consisted of: 1.0 μL PrimeScript RT EnzymeMix I, 4.0 μL RT Primer Mix, 4.0 μL 5×Prime Script Buffer 2, 1.0 μL RNase-Free ddH2O, and 10.0 μL of the digested mixture. Reverse transcription reaction conditions: 37℃, 15 min; 85℃, 5 sec, 4℃ storage.
[0032] 2. Analysis of the expression pattern of the OsELP4 gene induced by rice blast fungus
[0033] To investigate whether the OsELP4 gene is involved in the disease resistance process of rice, this invention used RT-qPCR to detect the relative expression level of the OsELP4 gene transcription at 0, 24, 48, 72, 96, 120, and 144 hours after inoculation with *Bacillus oryzae* in wild-type rice and rice inoculated with *Bacillus oryzae*. The results showed that the OsELP4 gene was significantly upregulated by *Bacillus oryzae*. Wild-type Nipponbare rice is a conventional japonica rice variety. When the rice reached the 4-leaf stage in a greenhouse, detached leaves were inoculated with *Bacillus oryzae*. The *Bacillus oryzae* strain Guy11 was kindly provided by Professor Huang Junbin's research team from the College of Plant Science and Technology, Huazhong Agricultural University, and is a conventional *Bacillus oryzae* pathogen. The in vivo inoculation method involved placing rice seedlings cultured to the four-leaf stage in an inoculation box, spraying the seedlings evenly with Guy11 spore solution using a spray bottle, and then placing them in a 28℃ artificial climate chamber for 24 hours in the dark, followed by a photoperiod of 14 hours of light and 10 hours of darkness. Inoculation of rice blast fungus into detached leaves was performed using the conventional leaf-cutting method, specifically inoculating the front 5 cm of leaves from rice plants at the four-leaf stage. The fungus culture followed published methods. After inoculation, total RNA was extracted from inoculated leaves at different time points and reverse transcribed into cDNA as a template. OsELP4-specific primers were designed: forward primer qOsELP4-F (5'CAGGACCTATGAAGGAACCC 3') and reverse primer qOsELP4-R (5'GCCTCTTCAACATTAGCAGAAG 3'). Rice endogenous actin Actin (gene accession number AK101613) was used as an internal control gene: Actin-F (forward primer 5'CTATCCTCAAAGCCTCGTCA-3') and Actin-R (5'ATCACCAGAGTCCAACACATTACCT3'). Real-time quantitative RT-qPCR analysis was performed using a SYBR Green kit. The Geeen PCRMaster Mix (proceded according to the kit instructions) was used in a BIO-Rad CFX Connect (manufactured by BIO-Rad) real-time PCR instrument. Results showed that OsELP4 expression was significantly upregulated in rice blast induction, suggesting that OsELP4 may be involved in rice's resistance response to rice blast fungus.
[0034] 3. Obtaining the OsELP4 gene sequence
[0035] The full-length sequence of OsELP4 was cloned using cDNA from Nipponbare japonica rice as a template, with forward primer OsELP4-full-F (5'ATGGCCGCCGCCGCCGGAGG 3') and reverse primer OsELP4-full-R (5'GAAATCAAGCTGTGAACCTTG 3'). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 30 cycles of 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 1 min followed by 330 sec; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired OsELP4 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The 378 amino acids corresponding to the open reading frame (ORF) of the OsELP4 gene were determined using BlastX (http: / / www.ncbi.nlm.nih.gov), and the protein sequence encoded by the OsELP4 gene was inferred as shown in the sequence listing SEQ ID NO: 2.
[0036] Example 2: OsELP4 overexpression and CRISPR / Cas9 gene knockout vector construction
[0037] 1. Construction of overexpression vectors
[0038] To verify the gene function of OsELP4, the applicant constructed an overexpression vector to transform Nipponbare embryogenic callus. Using the plasmid of the OsELP4 positive clone obtained in Example 1 as a template, overexpression primers were designed, with homologous recombination adapter bases added to both ends of the primers. These primers were named the forward primer OsELP4-OE-F (5'GAACGATAGCCGGTACCATGGCCGCCGCCGCCGGAGG') and the reverse primer OsELP4-OE-R (5'CTTTGTAATCGGATCCGAAATCAAGCTGTGAACCTTG 3'), respectively, and PCR amplification was performed. The resulting PCR products were subjected to agarose gel electrophoresis and purified (purchased from Tiangen Biotech (Beijing) Co., Ltd.) and stored at -20℃ for later use. The pU1301-3*Flag strain was activated in liquid LB medium (with 50 mg / L kanamycin added). After plasmid extraction, the strain was double-digested with KpnI and BamHI. The digested products were purified and recovered, and stored at -20℃ for later use. The OsELP4 target fragment to be linked by the above digestion and recovery was infused with the linearized vector pU1301-3*Flag using homologous recombinase (purchased from Nanjing Novizan Biotechnology Co., Ltd.) to obtain the recombinant vector (pU1301-OsELP4-3*Flag). The specific reaction system was as follows: 1.0 μL of double-digested linearized pU1301-3*Flag vector, 1.0 μL of 5×CEⅡBuffer, 0.5 μL of ExnaseⅡ homologous recombinase, 0.8 μL of PCR purified and recovered OsELP4 with the vector linker, and the volume was made up to 5.0 μL with sterile ddH2O. After reacting at 37℃ for 0.5 h, heat shock transformation of *E. coli* was performed using *E. coli* DH5α strain. The specific transformation procedure was as follows: *E. coli* DH5α competent cells stored at -80℃ were thawed in an ice bath. 50 μL of competent cells were added to 5 μL of the ligation reaction mixture, gently mixed, and placed on ice for 15-30 min. After the ice bath, the cells were incubated in a 42℃ water bath for 90 sec, then immediately placed on ice for 3 min. 400 μL of LB liquid medium was added, and the cells were incubated at 37℃ and 200 rpm for 45 min to recover. After recovery, the cells were centrifuged at 5000 rpm for 2 min, 300 μL of supernatant was discarded, and the cells were resuspended in the remaining supernatant. The bacterial suspension was evenly spread on LB solid medium (with 50 mg / L kanamycin added) and incubated upside down at 37℃ overnight. Single clones were picked, and 2-3 positive clones were sequenced. The strain without any mutations and the corresponding plasmid were preserved and named recombinant plasmid pU1301-OsELP4-3*Flag.The correctly sequenced recombinant plasmid pU1301-OsELP4-3*Flag was transformed into competent Agrobacterium tumefaciens EHA105 cells using a freeze-thaw method. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added). The culture was shaken at 28°C for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.
[0039] 2. Construction of CRISPR / Cas9 gene knockout vector
[0040] Utilizing the CRISPR-P 2.0 developed by the State Key Laboratory of Genetic Improvement for Major Crops in Central China (Central China Agricultural University) CRISPR-P v2.0 (hzau.edu.cn) Design of guide RNA (gRNA) for OsELP4. Based on the DNA sequence and gene structure of OsELP4, two gRNAs were designed (i.e., gRNA1: 5'GAGCAGCTTCTCTCGAGCAG 3'; gRNA2: 5'CTGCTCTTCGCAGGACCTAT 3'). The adapter primer ELP4-gRNA1-U3F was synthesized.
[0041] (5'GAGCAGCTTCTCTCGAGCAGgttttagagctagaaata 3'), ELP4-gRNA1-U3R (5'CTGCTCGAGAGAAGCTGCTCtgcaccagccgggaat 3'), ELP4-gRNA2-U3F (5'ATAGGTCCTGCGAAGAGCAGgttttagagctagaaata The following primers were used: 3'), ELP4-gRNA2-U3R (5'CTGCTCTTCGCAGGACCTATtgcaccagccgggaat3'), and adapter primers required for gRNA ligation into the expression vector pRGEB32: S5AD5-F (5'CAGATGATCCGTGGCAACAAAG3') and S5AD5-R (5'TTTCTAGCTCTAAAACAAAA3'); L5AD5-F (5'CAGATGATCCGTGGCAACAAAGCACCAGTGGTCTAG3') and L5AD5-R (5'TTTCTAGCTCTAAAACAAAAAAAAAAGCACCGACTCG3'). Using the pGTR plasmid as a template, PCR amplification was performed using three primer pairs: L5AD5-F / ELP4-gRNA1-U3R, ELP4-gRNA1-U3F / ELP4-gRNA2-U3R, and ELP4-gRNA2-U3F / L5AD5-R. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 26 cycles of 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 30 sec; extension at 72℃ for 7 min. The three obtained RCR products were diluted 20-50 times and mixed in equal volumes. 1 μL of the mixture was used as a template for amplification using the S5AD5-F / S5AD5-R primer pair. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 26 cycles of 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 45 sec; extension at 72℃ for 7 min. The obtained product (i.e., the DNA fragment with two gRNAs tandemly) was purified and its concentration determined. The CRISPR / Cas9 expression vector pRGEB32 was digested with BsaI, and the digestion product was purified and recovered to obtain the linearized pRGEB32 vector. The purified PCR product was ligated into the linearized pRGEB32 vector using infusion recombination. Specific reaction conditions: 100 ng of PCR product, 50-80 ng of linearized pRGEB32 vector, 1 μL of infusion enzyme (Takara), 1 μL of 10× infusion buffer, add ddH2O to 10 μL, react at 50℃ for 30 min.The reaction product was heat-shocked and transformed into *E. coli* DH5α. Single colonies were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmid was transformed into *Agrobacterium tumefaciens* EHA105 competent cells. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added), and cultured at 28°C with shaking for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use. The vectors pGTR and pRGEB32 involved in this example were kindly provided by Professor Xie Kabin of Huazhong Agricultural University.
[0042] Example 3: Genetic transformation of rice
[0043] 1. Callus Induction: Prepare sterile callus induction medium in advance. Pour 40-50 mL of induction medium into a 100 mL Erlenmeyer flask. Remove the husks from rice seeds (Nipponbare variety, same as above). Perform aseptic operations in a laminar flow hood. First, soak the seeds in 75% ethanol solution for 1 min, then soak them in 0.1% HgCl2 solution for 15-20 min, and finally wash them 5-10 times with sterile water. Inoculate 8-12 seeds in each flask and incubate in the dark at 28℃ for 40-50 days to induce callus formation.
[0044] 2. Subculture: Prepare the subculture medium 2-3 days in advance, using the callus induction medium formula. Sterilize the medium using standard methods to ensure it is dry (medium with excessive moisture is detrimental to callus growth). Select pale yellow, granular, dry, and highly viable callus tissue from the induced callus and transfer it to the subculture medium. Incubate in the dark at 28°C for 20 days.
[0045] 3. Pre-culture: Dispense sterile pre-culture medium into 500mL Erlenmeyer flasks in advance. Before the experiment, add 300μL of 100Mm acetylsalicylic acid and 5mL of 40% glucose to every 250mL of medium, mix well, and fill 8-10 plates of medium into each flask. From the subcultured callus, pick out pale yellow, granular, dry, and viable callus tissue and transfer it into the culture plates of pre-culture medium. Inoculate about 60-80 pieces of callus tissue the size of mung beans into each plate. If the callus tissue is too large, it can be crushed with sterile forceps. Incubate in the dark at 8℃ for 3 days.
[0046] 4. Infection and Co-culture: Two days before the experiment, Agrobacterium strains containing the target gene (OsELP4) were streaked onto Petri dishes containing antibiotics (30 mg / L rifampin and 50 mg / L kanamycin) to activate the bacteria. Prepare suspension medium (100 mL / strain), co-culture medium (250 mL / strain), large Petri dishes, small Petri dishes (lined with absorbent paper and filter paper, sterilized and dried before use), and several 250 mL sterile Erlenmeyer flasks. The streaked Agrobacterium was scraped into 1 / 2 N6 suspension medium (N6 medium is a commonly used plant tissue culture medium, with 100 μL AS + 2 mL 50% glucose added), and incubated at 28℃ and 200 rpm for 30 min. Simultaneously, the pre-cultured callus was collected into 250 mL sterile Erlenmeyer flasks while shaking the bacteria. The Agrobacterium culture was poured into the callus and soaked for 30 min. Discard the bacterial suspension. First, invert the Erlenmeyer flask containing the callus tissue onto a sterile dish to absorb the bacterial suspension. Then, spread the callus tissue onto filter paper in a sterile dish, cover it with another sheet of filter paper, and gently press the callus tissue with sterile forceps to absorb the surface bacterial suspension. Allow it to air dry for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue onto the co-culture medium (it's best not to move it after spreading to reduce contact between the medium and the callus surface and prevent excessive growth of Agrobacterium). Incubate in the dark at 19°C for 3 days.
[0047] 5. Washing and Screening (S1 medium): Prepare sterile water, large and small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and screening medium. Transfer the co-cultured callus to a washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this process 2-3 times. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, then discard the sterile distilled water. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, then let stand for 10 minutes. Finally, discard the sterile distilled water, add sterile distilled water containing 500mg / L carbenicillin, and shake at 200rpm for 30 minutes. Discard the distilled water and allow the callus to air dry. Transfer the treated callus to screening medium and incubate in the dark at 28℃ for 20 days.
[0048] 6. Screening (S2 medium): Prepare screening medium S2. Add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to every 250 mL of medium. After pouring, open the lid on a clean bench and blow with sterile air for 1.5-2 hours. The surface of the screening medium should not be too wet, otherwise it will not be conducive to the inhibition of Agrobacterium and the growth of resistant callus during screening. Select dry callus that is not contaminated with Agrobacterium from S1 medium and place it on S2 medium (inoculate 25 to 30 callus pieces per plate). Incubate in the dark at 28°C for 20 days.
[0049] 7. Callus differentiation: Prepare the differentiation medium 3-4 days in advance. Select small pieces of pale yellow, dense, and dry resistant callus tissue, inoculate them into the differentiation medium, and culture them at 28℃ under light (light intensity 3000 Lux) for 40 days. Seedlings will differentiate in the later stage of culture.
[0050] 8. Rooting: Prepare the rooting medium 2-3 days in advance. Prepare 4-5 sterile empty dishes; remove the differentiated seedlings from the differentiation medium, taking only one seedling from each callus, trimming excessively long leaves and roots with scissors, and inserting them into rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000 Lux) for 15-20 days, and after the roots have grown sufficiently, harden off the seedlings for 4-7 days, and then transplant them to the greenhouse.
[0051] The specific culture medium formulation and preparation method for rice genetic transformation involved in the embodiments of the present invention are as follows:
[0052] Mother liquor formula:
[0053] 1. MSmax stock solution (10X)
[0054]
[0055] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.
[0056] 2. MSmin stock solution (100X)
[0057]
[0058] Note: Na2MoO4 must be dissolved separately before mixing with other components, and then diluted with distilled water to a final volume of 1000 mL. Store at room temperature.
[0059] 3. N6max stock solution (10X)
[0060]
[0061] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.
[0062] 4. N6min stock solution (100X)
[0063]
[0064] Dilute to 1000 mL with distilled water and store at room temperature.
[0065] 5. Fe2+-EDTA stock solution (100X)
[0066] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;
[0067] Add 300 mL of distilled water to another reagent bottle and heat to 70 °C. Then add 3.73 g of Na2EDTA·2H2O and dissolve it. Mix the solutions from the two reagent bottles and keep them at 70 °C for 2 hours. Then add distilled water to make up to 1000 mL and store at 4 °C protected from light.
[0068] 6. Vitamin stock solution (100X)
[0069]
[0070] Add distilled water to a final volume of 1000 mL and store at 4°C.
[0071] 7. AAmax stock solution (10X)
[0072]
[0073] Add distilled water to a final volume of 1000 mL and store at room temperature away from light.
[0074] 8. AAmin stock solution (100X)
[0075]
[0076] Dissolve Na2MoO4 separately, then mix it with other components and add distilled water to bring the volume to 1000 mL. Store at room temperature away from light.
[0077] 9.6-BA stock solution (1 mg / mL)
[0078] Add 100 mg of 6-BA to 1.0 mL of 1 M KOH and shake until 6-BA dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.
[0079] 10. KT stock solution (1 mg / mL)
[0080] Add 100 mg of KT to 1.0 ml of 1 M KOH and shake until KT dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.
[0081] 11.2,4-D stock solution (1 mg / mL)
[0082] Add 100 mg of 2,4-D to 1.0 mL of 1 M KOH and shake for 5 min. Then add 10 mL of distilled water and shake until the 2,4-D dissolves. Make up to 100 mL with distilled water and store at room temperature.
[0083] 12.100μM AS stock solution
[0084] AS 0.196g;
[0085] 10 mL of DMSO;
[0086] Aliquot into 1.5mL centrifuge tubes and store at 4°C.
[0087] 13. IAA stock solution (1 mg / mL)
[0088] Add 100mg of IAA to 1.0ml of 1N KOH and shake until the IAA dissolves. Then, bring the volume to 100ml with dH2O and store at room temperature away from light.
[0089] 14. NAA stock solution (1 mg / mL)
[0090] Add 100 mg of NAA to 1.0 mL of 1 M KOH and shake until the NAA dissolves. Then, bring the volume to 100 mL with distilled water and store at room temperature away from light.
[0091] Culture medium formulation:
[0092] 1. Induction medium
[0093]
[0094] Phytagel 3g
[0095] pH value: 5.9
[0096] Add distilled water to a final volume of 1000 mL.
[0097] 2. Subculture medium
[0098]
[0099]
[0100] pH value: 5.9. Add distilled water to a final volume of 1000 mL.
[0101] 3. Pre-culture medium
[0102] pH value: 5.6. Add distilled water to a final volume of 250 mL.
[0103] 4. Co-culture medium
[0104] pH value: 5.6. Add distilled water to a final volume of 250 mL.
[0105] 5. Suspension culture medium
[0106] pH value: 5.4. Add distilled water to a final volume of 100 mL.
[0107] 6. Screening culture medium
[0108] pH value: 6.0. Add distilled water to a final volume of 250 ml.
[0109] 7. Differentiation medium
[0110]
[0111] pH value: 6.0
[0112] Add distilled water to a final volume of 1000 mL.
[0113] 8. Rooting medium
[0114]
[0115] pH value: 5.8
[0116] Add distilled water to a final volume of 1000 mL.
[0117] Example 4: Identification of rice blast fungus in transgenic materials
[0118] 1. Preparation of Tomato-Oat Medium (OM): Boil water until boiling, weigh 40g of rolled oats, add to the boiling water and cook for 30 minutes, then filter to obtain the juice; add 150mL of freshly squeezed tomato juice to the oat juice, add water to make up to 1L, and add 1.6% agar; sterilize by conventional high temperature and autoclaving. For the medium used for sporulation of rice blast fungus, add 0.6g of CaCO3 to 1L of medium.
[0119] 2. Purification and Preservation of *Blastoma oryzae* Strains: In a clean bench, the conidial solution of *Blastoma oryzae* was pipetted onto a 1.6% water agar plate and incubated at 28°C for 12 hours. Under a dissecting microscope, single germinating conidia were picked up with a needle and aliquoted onto OM plates, which were then incubated at 28°C. After incubation for 2-3 days, the mycelia formed from the single conidia were transferred to new OM plates. These purified single-spore strains could be used for subsequent experiments. Mycelial blocks of the strain to be preserved were aliquoted onto OM plates lined with sterile filter paper and incubated at 28°C. After the colonies had fully colonized the petri dishes, the filter paper was removed and placed into a sterile sulfuric acid paper bag. The sulfuric acid paper bag was placed in a desiccator for one week, then transferred to a sealed container and stored at -20°C.
[0120] 3. Sporulation: Wild-type strain Guy11 was inoculated onto OM plates and incubated upside down in a 28℃ light incubator. After 5 days of growth, the mycelium was broken up completely with a smear loop and evenly spread onto a new OM plate, which was then incubated upside down in a 28℃ light incubator. After 36 hours, the newly visible aerial mycelium was gently washed off with a cotton swab, covered with double layers of gauze, and incubated at 28℃ light. After 48 hours, the conidia on the OTA plates were thoroughly washed with 30 mL of distilled water into 50 mL centrifuge tubes.
[0121] 4. Spore inoculation: Wash conidia from the OM plate cultured for 5 days with 30 mL of 0.025% Tween solution, then filter through a funnel made of three layers of lens paper into 50 mL centrifuge tubes, adjusting the conidia concentration to 2 × 10⁻⁶. 5 Specimen / mL. In vitro leaf inoculation with spore solution: Gently puncture the leaf at the four-leaf stage with a 10μL pipette tip, being careful not to puncture the leaf. Place the leaf in a petri dish containing 30mL ddH2O (containing 0.01g / L 6-BA). Then, use a pipette to add 7-10μL of spore solution to the punctured area of the leaf. Cover the petri dish after inoculation and place it in a 25℃ artificial climate chamber (14h light, 10h darkness). In vivo leaf inoculation with spore solution: Transfer conidia to a spray bottle and spray seedlings at the 3-4 leaf stage. Place the experimental and control seedlings in the same humidity chamber and then place them in a 25℃ artificial climate chamber (14h light, 10h darkness). Seal the inoculation box with sealing film to maintain temperature and humidity, and culture under a black cloth. Remove the black cloth after 36 hours and expose to light (light intensity). Continue to incubate in a moist environment for 48 hours, then remove the sealing film. Generally, the disease begins to appear 5 days after inoculation.
Claims
1. Overexpression of elongation factor complex subunits OsELP4 The application of genes in improving rice blast resistance is characterized by The OsELP4 The nucleotide sequence of the gene is shown in SEQ ID NO:1.