Application of SNX19 gene in regulating porcine deltavirus replication

Abstract

The present invention discloses the application of the SNX19 gene in regulating the replication of porcine deltavirus, and belongs to the field of biotechnology. The present invention uses shRNA interference, overexpression, and the construction of an SNX19 knockout cell line in LLC-PK1 cells to confirm for the first time that knocking out the SNX19 gene or inhibiting the expression of the SNX19 gene can significantly inhibit the proliferation of PDCoV in host cells; overexpression of the SNX19 gene can promote the proliferation of PDCoV in host cells, indicating that SNX19 in host cells is an important host factor related to the proliferation of PDCoV and plays an important role in the development of cell vaccines. The improvement of viral proliferation efficiency can directly improve the economic benefits of vaccine manufacturers. On the other hand, using SNX19 as a drug target can further screen drugs that target and inhibit SNX19, and using it as a candidate drug can develop effective anti-porcine deltavirus drugs.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the application of the SNX19 gene in regulating the replication of porcine deltavirus. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is a novel porcine enteric coronavirus, an enveloped, single-stranded, positive-sense RNA virus. PDCoV can cause diarrhea and vomiting in suckling piglets, and can also infect growing and adult pigs, as well as sows, causing significant economic losses to the global swine industry. In December 2021, the journal Nature reported that PDCoV was detected and isolated from serum samples of three febrile children in Haiti, indicating that PDCoV carries the risk of infecting humans and poses a potential threat of cross-species transmission. The rapid spread and potential cross-species transmission of PDCoV pose a significant threat to animal and human health and safety. To date, there is no commercially available vaccine for PDCoV, nor is there a specific treatment for PDCoV infection. This complicates the prevention and control of PDCoV, necessitating an urgent need to identify new antiviral targets. Furthermore, in the development of cell-cultured vaccines, whether attenuated or inactivated, the viral proliferation efficiency directly impacts both vaccine potency and the economic benefits of the company. Therefore, identifying key host factors that influence viral proliferation and regulating viral proliferation efficiency at the cellular level are key priorities for vaccine manufacturers.

[0003] Catabolic endosomes and autophagic clearance pathways are innate cellular defenses against pathogen invasion. Consequently, many intracellular pathogens subvert host endosomal sorting pathways to circumvent lysosomal degradation and promote intracellular survival and proliferation. For example, many viruses are internalized into cells via the endocytic pathway after binding to host receptors. Endocytic maturation and acidification trigger uncoating and genome release, thereby preventing the genome from being exposed to degradation in mature lysosomes. SNXs are a core protein family within the endosomal sorting system. Recent studies have revealed that multiple SNX family proteins are involved in regulating pathogen replication and play crucial roles in pathogen infection. SNX19, a member of the PXA-RGS-PX-PXC subfamily of SNX family proteins, restricts endolysosomal movement by interacting with the endoplasmic reticulum. This restriction may occur by altering the connectivity between endolysosomes and the endoplasmic reticulum. This discovery highlights the important role of SNX19 in regulating endolysosomal movement. Importantly, because many viruses utilize similar endolysosomal pathways, targeted inhibition of SNX19 may allow the development of new broad-spectrum antiviral drugs.

[0004] While extensive research has examined the role of SNXs in viral infection, many questions remain. For example, the specific mechanism of action of SNX19 in viral infection remains unclear. Therefore, further investigation is needed into the interactions of SNX19 with other proteins and the potential application of SNX19 in PDCoV infection. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the SNX19 gene in regulating the replication of porcine deltavirus to solve the problems existing in the above-mentioned prior art. The present invention uses shRNA interference, overexpression and the method of constructing a SNX19 knockout cell line in LLC-PK1 cells to confirm for the first time that knocking out the SNX19 gene or inhibiting the expression of the SNX19 gene can significantly inhibit the proliferation of PDCoV in host cells, indicating that SNX19 in host cells is an important host factor related to the proliferation of PDCoV.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of the SNX19 gene in regulating the replication of porcine deltavirus, overexpressing the SNX19 gene in host cells to promote the replication of porcine deltavirus; inhibiting the expression of the SNX19 gene in host cells to inhibit the replication of porcine deltavirus;

[0008] The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.15.

[0009] Furthermore, inhibiting the expression of the SNX19 gene in the host cell includes knocking out the SNX19 gene.

[0010] Furthermore, the host cells include porcine kidney epithelial cells.

[0011] The present invention also provides a method for inhibiting the replication of porcine deltavirus for non-disease diagnosis and treatment purposes, comprising silencing the SNX19 gene of the host cell using a molecular biological method;

[0012] The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.15.

[0013] Furthermore, the host cells include porcine kidney epithelial cells.

[0014] The present invention also provides use of a preparation for inhibiting SNX19 gene expression in the preparation of a drug for resisting porcine deltavirus.

[0015] Furthermore, the preparation comprises any one of naked DNA, liposome-encapsulated DNA, plasmid DNA carried by reproduction-defective bacteria, target DNA carried by replication-defective adenovirus, liposome-encapsulated protein or protein microsphere preparation.

[0016] The present invention also provides an application of the SNX19 gene in screening anti-swine deltavirus drugs, wherein the SNX19 gene is used as a drug target, and whether the drug is an anti-swine deltavirus drug is determined based on the expression level of the SNX19 gene after administration;

[0017] The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.15.

[0018] The present invention also provides a method for screening anti-swine deltavirus drugs, comprising:

[0019] contacting the candidate drug with test cells infected with porcine deltavirus, and detecting the expression level of the SNX19 gene in the test cells;

[0020] If the expression level of the SNX19 gene is significantly decreased, the candidate drug is determined to be an anti-swine deltavirus drug;

[0021] The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.15.

[0022] The present invention also provides a method for constructing a high-efficiency cell line for culturing porcine deltavirus, comprising overexpressing the SNX19 gene of the cell line using molecular biological methods to promote the replication of porcine deltavirus in the cell line;

[0023] The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.15.

[0024] The present invention discloses the following technical effects:

[0025] The present invention uses shRNA interference, overexpression and the construction of an SNX19 knockout cell line in LLC-PK1 cells to confirm for the first time that knocking out the SNX19 gene or inhibiting the expression of the SNX19 gene significantly inhibits the proliferation of PDCoV in host cells, indicating that SNX19 in host cells is an important host factor related to the proliferation of PDCoV.

[0026] According to the records of the present invention, using SNX19 as a drug target, it is possible to further screen drugs that target and inhibit SNX19, and use them as candidate drugs to develop effective anti-swine deltavirus drugs. At the same time, the SNX19 gene is modified at the cellular level to promote the function of SNX19 and enhance the efficiency of virus proliferation in cells. An efficient cell system for cultivating viruses can be further developed, thereby improving the economic benefits of vaccine production companies. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 This is the map of the pSpCas9(BB)-2A-Puro(PX459)V2.0 vector;

[0029] Figure 2 Western-blot electrophoresis (A) and TCID analysis of shRNA interference with endogenous SNX19 to inhibit PDCoV proliferation 50 Statistical chart (B);

[0030] Figure 3 Western-blot electrophoresis (A) and TCID analysis of SNX19-overexpressing cells promoting PDCoV proliferation 50 Statistical chart (B);

[0031] Figure 4 Figure 2 shows the construction process and identification of the SNX19 knockout cell line, where a is the genomic location of the knockout target, b is the sequencing result of the SNX19 knockout cell line, c is the amino acid sequence comparison of the corresponding protein before and after SNX19 knockout, d is a schematic diagram of the construction of the SNX19 knockout cell line based on the CRISPR-Cas9 method, and e is the PCR identification of the SNX19 knockout cell line;

[0032] Figure 5 Indirect immunofluorescence (A), TCID 50 (C) and Western-blot (B) verified that knockout of SNX19 inhibited the proliferation of PDCoV in KO-3-13 cells. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] The cell line used in the present invention is pig kidney passage cells (LLC-PK1), purchased from ATCC; the eukaryotic expression plasmid overexpressing the SNX19 gene was pcDNA3. TM 4 / TO as the basic vector; the eukaryotic expression plasmid for knocking out the SNX19 gene is based on pSpCas9(BB)-2A-Puro(PX459)V2.0 (PX-459 for short), which contains a 3×Flag tag and a BbsΙ restriction site for inserting double-stranded gRNA, and can simultaneously express Cas9 protein. The vector map is shown in FIG. Figure 1 When constructing SNX19 knockout cell lines, the specific gRNA sequences and detection primers are shown in Table 1.

[0039] Table 1 gRNA, PCR detection and amplification primer sequences

[0040]

[0041] Interference plasmids (shRNA) targeting porcine SNX19 include SNX19-Sus-990 and SNX19-Sus-728, which were designed and synthesized by Jiangsu Jima Company. The specific sequences are shown in Table 2.

[0042] Table 2 Interference plasmids and sequences targeting porcine SNX19

[0043]

[0044] The relevant reagents used in the construction of eukaryotic expression plasmids are as follows:

[0045] Primers for plasmid construction were synthesized by Sangon Biotech (Shanghai) Co., Ltd. PrimeSTAR high-fidelity DNA polymerase and DNA marker were purchased from TakaRa. Trizol used for RNA extraction was purchased from Omega Biotech. A reverse transcription kit was purchased from Roche. Nuclease-free sterile water was purchased from Hyclone. Restriction endonucleases (RE) required for plasmid construction were purchased from TakaRa. An endotoxin-free plasmid extraction kit was purchased from Omega. Agar, tryptone, and yeast extract were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0046] Example 1

[0047] 1. Experimental Methods

[0048] 1. Construction of eukaryotic expression plasmid

[0049] 1.1 PCR amplification of porcine SNX19

[0050] Based on the porcine SNX19 coding region (cds) sequence in GenBank (GenBank accession number: XM_003130084.4), primers for amplifying the gene sequence were designed, and appropriate restriction sites were designed at both ends of the primers. The designed primer sequences are as follows:

[0051] Upstream primer F: TAGTCCAGTGTGGTGGAATTCATGGAGGCAGAGGCCGCAG (SEQ ID NO. 13);

[0052] Downstream primer R: GGCCGCCACTGTGCTGGATATCTGCAAGGGGAGACGCCCATCTTC (SEQ ID NO. 14).

[0053] Total RNA from LLC-PK1 cells was extracted and reverse-transcribed into cDNA. PCR amplification was performed using cDNA from LLC-PK1 cell line total RNA as a template. The total amplification volume was 25 μL, including 12.5 μL of 2× PCR Master Mix, 1 μL each of forward and reverse primers, 2 μL of cDNA template, and 8.5 μL of ddH2O. Amplification conditions included a 5-min initial denaturation at 95°C followed by cycling with the following parameters: 98°C for 10 s, 58°C for 30 s, and 72°C for 3 min. After 35 cycles, an extension at 72°C for 10 min was performed.

[0054] 1.2 Electrophoresis detection of PCR amplification products or enzyme digestion products

[0055] After PCR amplification or enzyme digestion, dilute with 50×TAE electrophoresis buffer to prepare a 0.8wt%-1.2wt% agarose gel solution. Heat until the agarose is completely dissolved. Cool to 50°C and add EB solution (10mg / mL) to a final concentration of 0.5μg / mL. Mix thoroughly and pour into the selected gel mold. Insert the corresponding comb. The gel thickness should be 3mm-5mm. After the gel is completely solidified, carefully remove the comb and place the gel in an electrophoresis tank filled with 1×TAE electrophoresis buffer, ensuring that the electrophoresis solution just covers the gel surface (approximately 1mm). Add 1 / 10 volume of 10× loading buffer to the PCR product or enzyme digestion product sample to be electrophoresed and mix thoroughly. Use a micropipette to add an appropriate amount of sample to the comb hole. At the same time, add a DNA marker as a control. Electrophoresis is carried out at a voltage of 5V / cm. When bromophenol blue electrophoresis reaches the appropriate position, observe or photograph the gel under long-wave ultraviolet light using a gel imaging system. Refer to the instructions of the common agarose gel DNA recovery kit to recover and purify the amplified product or enzyme digestion product.

[0056] 1.3 Restriction enzyme digestion reaction

[0057] Add restriction endonuclease and corresponding 10× restriction endonuclease reaction buffer to the PCR recovered product or empty plasmid, gently tap the tube wall to mix, and gently centrifuge to the bottom of the tube. Incubate the tube at 37°C for 1-2 hours, and confirm the enzyme digestion effect by 0.8% agarose gel electrophoresis.

[0058] 1.4 Ligation reaction between exogenous DNA fragment and plasmid vector

[0059] The recovered enzyme-digested products or PCR products are connected to the target vector and transformed into plating plates. The next day, single colonies are selected for PCR identification and sent to the company for sequencing.

[0060] 2. Construction of gene knockout cell lines based on CRISPR-Cas9 technology

[0061] (1) Design of gRNA sequence: Based on the SNX19 gene sequence information, guide RNA (gRNA) was designed for the first exon of SNX19. The corresponding sequence was imported into the website (https: / / zlab.bio / guide-design-resources), and two pairs of gRNAs were screened for subsequent experiments. gRNA1 corresponds to SEQ ID NO. 1-2 in Table 1, and gRNA2 corresponds to SEQ ID NO. 3-4 in Table 1.

[0062] (2) Construction of PX-459-gRNA eukaryotic expression plasmid: The obtained gRNA1 and gRNA2 were constructed into the PX-459 plasmid to obtain the PX-459-gRNA eukaryotic expression plasmid.

[0063] (3) Determine the optimal drug screening concentration for LLC-PK1 cells: LLC-PK1 cells were plated onto 24-well plates. When the cells grew to 70-80%, the culture medium was replaced with one containing puromycin at different concentrations of 0 μg / mL, 1 μg / mL, 2 μg / mL, 3 μg / mL, 4 μg / mL, and 5 μg / mL. A blank control without drug addition was also set up. After 3-4 days, the concentration at which all cells died was the optimal drug screening concentration for LLC-PK1 cells.

[0064] (4) Transfection of PX-459-gRNA recombinant plasmid and cell screening: The obtained recombinant plasmids were transfected into LLC-PK1 cells. After 24 hours, the cell maintenance medium was replaced and the drug was added for screening. After about 3 days of screening, when all cells in the control group died, the remaining cells were cultured with drug-free cell culture medium for expansion.

[0065] (5) Subcloning by limiting dilution method: When the selected cells are expanded and cultured until they grow into a full monolayer, a monoclonal cell colony is obtained, and the cell colony with the best condition is selected for expansion.

[0066] (6) Sequencing to identify the knockout effect: After trypsin digestion, a portion of the cells was taken for whole-genome DNA extraction. SEQ ID NOs. 5-6, 7-8, and 9-10 in Table 1 were used as primers to amplify the DNA sequence of the edited portion by PCR. The amplified PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis.

[0067] 3. Indirect Immunofluorescence Experiment

[0068] (1) LLC-PK1 cells were transferred to a 24-well cell culture plate with a cell slide in advance. After the cells grew into a monolayer, they were inoculated with porcine deltavirus (PDCoV) and cultured in a 37°C, 5% CO2 incubator.

[0069] (2) 24 h after PDCoV infection, the supernatant was discarded with a pipette and the cells were washed twice with pre-cooled PBS.

[0070] (3) Fixation: Add 400 μL of 4% paraformaldehyde to each well to fix the cells for 10 min.

[0071] (4) Permeabilization: Add 1 mL of pre-cooled methanol to each well to permeabilize the cells for 15 min, and then wash three times with PBS.

[0072] (5) Blocking: Add 500 μL of 5% BSA (diluted with PBS) to each well for blocking at room temperature for 1 hour, and then wash three times with pre-cooled PBS.

[0073] (6) Primary antibody: Add 200 μL of labeled monoclonal antibody (diluted to 1:200 in PBS) to each well, incubate at room temperature for 1 h, and then wash three times with PBS.

[0074] (7) Secondary antibody: Add 200 μL fluorescent secondary antibody (diluted to 1:500 in PBS) to each well and incubate in the dark for 40 min at room temperature. Then wash three times with PBS in the dark.

[0075] (8) Nuclear staining: Add DAPI staining solution (diluted to 1:2500 in PBS) and incubate in the dark for 15 min at room temperature. Wash three times with PBS in the dark.

[0076] (9) Observe under a fluorescence microscope and take photos to preserve the results.

[0077] 4. Statistical methods

[0078] The experimental data were analyzed using a two-sample t-test with equal variances. p<0.05 indicated that the experimental results were significant; "*" represents p<0.05, "**" represents p<0.01, and "***" represents p<0.001.

[0079] 2. Experimental Results

[0080] 1. Interfering with SNX19 to inhibit the proliferation of PDCoV

[0081] In order to verify whether SNX19 is involved in the proliferation of PDCoV, we first designed and synthesized SNX19 interference plasmids (shRNA, Table 2), and transfected them into LLC-PK1 cells, respectively, and recorded them as shSNX19-1 (corresponding to SNX19-Sus-990) and shSNX19-2 (corresponding to SNX19-Sus-728). Normal LLC-PK1 cells were used as controls (shNC), and PDCoV was inoculated 24 hours later. Western-blot detection showed that interfering with SNX19 inhibited the proliferation of PDCoV in LLC-PK1 cells, indicating that SNX19 is related to the proliferation of PDCoV in cells ( Figure 2 ).

[0082] 2. Overexpression of SNX19 promotes the proliferation of PDCoV

[0083] To further validate the effect of SNX19 on PDCoV proliferation, the present invention constructed a eukaryotic expression plasmid for porcine SNX19 to examine the effect of overexpressing SNX19 on PDCoV proliferation in LLC-PK1 cells. First, mRNA was extracted from LLC-PK1 cells, and a porcine SNX19 gene fragment was amplified by RT-PCR. The sequence of the porcine SNX19 gene contained in the amplified product is shown in SEQ ID NO. 15.

[0084] SEQ ID NO.15:

[0085]

[0086] The amino acid sequence encoded by the gene sequence is shown in SEQ ID NO.16.

[0087] SEQ ID NO.16:

[0088] MEAEAAALSQEPAAEPSCSLGHLFSSRKLLAVGAVLGWLLVIHLLVNVWLLCLLSALLLVLGGWLGSDAIVGASGRLHLERFIPLAICPPNPEAERQLEQEIDRTIRLIMRDFVSSWYRTVSQEPAFEEEMEAAMRGLVQELRRRMAMVDRHALAQRVLTLCGCHLQSYIQAKEATAGKQSGTVEPSQLWEAYCRTTAPHPAVQSPSTEVTYTREIVDLLLKGLVPKPHLETRTGRHVVVELITCNVILPLISKLSDPDWIHLVLVGIFSKARNNPAGTMKPLCQASTLEQPSVPTSLPLIVEVQSLPKVRAPSPAAVPVLLDCSEPDGPSHLSPEVEEGREALEGDLGVVLEERRVGNNPSHFLQPGITGPLFLSEDAELESPLSELGKETIMLMTPGNFLSDKIPNVLCVLGGSHSLEAKDAEGSEGVEEAEAEEGPGTETDSGLLVSMLNTCPEIHIDTADKEVEQGDVTSLATLLASPERTCPPRPPCLEKELTNGVSALDPSLPQVLLSSSPPGPLSAATFSFEPLSSPDGPVVIQNLRITGTITAREHSGTGFHPYTLYTVKYETALEGESSSGLQQLAYHTVNRRYREFLNLQTRLEEKSDLRKLLKNVKGPKKLFPDLPFGNMDSDRVEARKSLLESFLKQLCAIPEIANSEEVQEFLALNTDARIAFVKKPFVVSRIDKMVVSAIVDTLKTAFPRSEPQSPTEELSEAETESKPQAEGKKASKSRLRFSSSKIAPALNIAEAHEKILYCLQEGSVESEVLSMSGMESFIEKQTKLLEMQPAEAPGKDSEQISKECVDGFEAEAAVPAQDLSNNDAGAETALANTALDLLLLLLMEQWRWLCTENVQKVLHLIFGTLIQRWLEVQVANLTCPQRWVQYLRLLQESIWPGGVLPKYPRPVRTQEQKVAAEEQALQSLMGVLPDIVVEILGVNKCRLSWSLVLESLQQPLINRHLIYCLWDLILEFLDLNASVEESAMTTSASETPSNPKKMGVSP*.

[0089] Insert the amplified fragment into pcDNA TM The eukaryotic expression plasmid SNX19-GFP expressing porcine SNX19 was obtained from the 4 / TO vector. The plasmid was transfected into LLC-PK1 cells at different concentrations (0.4 μg / mL, 0.8 μg / mL, and 1.6 μg / mL). PDCoV (0.1 MOI) was inoculated 24 hours after transfection, and samples were collected 24 hours after infection. Western-blot detection showed that overexpression of SNX19 promoted the proliferation of PDCoV in LLC-PK1 cells, indicating that SNX19 is indeed involved in the proliferation of PDCoV in cells ( Figure 3 ).

[0090] 3. Knockout of SNX19 significantly inhibited the proliferation of PDCoV

[0091] Two pairs of gRNAs targeting exon 1 of the porcine SNX19 gene were designed and synthesized, and constructed into the PX-459 vector respectively. The constructed plasmids were transfected into LLC-PK1 cells, and puromycin was added for drug screening 24 hours after transfection. After the cells in the control group were completely detached, the surviving cells were expanded and cultured, and subclones were screened by limiting dilution. Cell colonies in good condition were selected for expansion culture. Some cells were collected, genomic DNA was extracted, the DNA sequence of the edited part was amplified by PCR, and the amplified products were sequenced and analyzed. Sequencing confirmed that a group of SNX19 fragment knockout cell lines KO-3-13 (SNX19 gene deleted 320 bases) were obtained, and PCR identification was correct ( Figure 4 ).

[0092] After obtaining the SNX19 knockout cell line, SNX19 knockout cells (SNX19KO-3-13) and wild-type cells (WT) were seeded into 12-well plates at the same cell number. After the cells grew into a full monolayer, PDCoV (0.1 MOI) was inoculated and samples were collected 12h and 24h after infection. After inoculation with 0.1 MOI PDCoV, indirect immunofluorescence, TCID 50 Western-blot analysis revealed that SNX19 knockout significantly inhibited the proliferation of PDCoV ( Figure 5 These results indicate that SNX19 is an important host factor associated with PDCoV proliferation. Knocking out host SNX19 or inhibiting host SNX19 expression can inhibit the proliferation of PDCoV in host cells.

[0093] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for inhibiting porcine deltavirus replication for non-disease diagnosis and treatment purposes, characterized in that: This includes using molecular biological methods to silence the SNX19 gene in host cells; The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.

15.

2. The method according to claim 1, characterized in that The host cells include porcine kidney epithelial cells.

3. Use of a preparation for inhibiting SNX19 gene expression in the preparation of a drug against porcine deltavirus, characterized in that: The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.

15.

4. The use according to claim 3, characterized in that The preparation comprises any one of naked DNA, liposome-encapsulated DNA, plasmid DNA carried by reproduction-defective bacteria, target DNA carried by replication-defective adenovirus, liposome-encapsulated protein or protein microsphere preparation.

5. A method for constructing an efficient cell line for culturing porcine deltavirus, characterized in that: The method comprises overexpressing the SNX19 gene of the cell line by using a molecular biological method to promote the replication of porcine deltavirus in the cell line; The nucleotide sequence of the SNX19 gene is shown in SEQ ID NO.15.

Images