Application of Beauveria bassiana in the prevention and treatment of banana wilt

Abstract

The invention discloses a Beauveria bassiana with a deposit number of CCTCC NO: M 2024178 ( Beauveria caledonian ) in the prevention and treatment of banana wilt. The Beauveria bassiana Cs-2 of the present invention belongs to the genus Beauveria and is a typical insect pathogenic fungus. Studies have found that the Beauveria bassiana Cs-2 can colonize in banana plants and prevent banana wilt, providing a new strain source for the prevention and treatment of banana wilt, and has high research value.

Description

Technical Field

[0001] The invention relates to the technical field of biotechnology, and in particular to application of Beauveria bassiana in preventing and controlling banana wilt. Background Art

[0002] The pathogen of banana wilt was first isolated and identified by Smith in 1910 from Cuban banana tissue. Fusariumcubense In 1913, Ashby first F.cubense Described in detail, and subsequently confirmed for the first time by Brande in 1919 F.cubense In 1940, Snyder & Hansen named the pathogen causing banana wilt as Fusarium oxysporum Cubanum. Fusariumoxysporumf.sp.cubense (EF Smith) Snyder et Hasen, Foc]. The pathogen belongs to the subdivision Deuteromycotina, class Hyphomycetes, order Tuberculariales, family Tuberculariaceae, genus Fusarium. Fusarium Link), Beauty Group ( Elegans Wu.), Oxysporium Oxysporum Sch1.).

[0003] There are four physiological subspecies of Foc. The first physiological subspecies (R1) is distributed worldwide and once caused the extinction of the cultivated banana variety "Big Miha"; the second physiological subspecies (R2) is distributed in Central America and only infects the hybrid triploid "Rhombus" ( Bluggoe , ABB) and other cooking varieties; Physiological race 3 (R3) only infects ornamental plants of the genus Musa of the family Musa ( Heliconia spp.), currently, the pathogens that infect the genus Fusarium no longer belong to Foc (Ploetz, 2019); Physiological race 4 (R4) can infect all banana varieties and is the most serious. Mua According to the pathogenicity of AAA, R4 is divided into tropical race 4 (TR4) and subtropical race 4 (STR4). STR4 often occurs in subtropical areas, while TR4 can occur in both tropical and subtropical areas and is more toxic.

[0004] At present, the main control methods for TR4 include: application of chemical pesticides, crop rotation, breeding of disease-resistant varieties and biological control, etc. Among them, biological control is safe and ecologically sustainable, and is a research hotspot for the control of banana wilt disease. Summary of the invention

[0005] In view of the above technical problems, the object of the present invention is to provide an application of Beauveria bassiana in preventing and treating banana wilt.

[0006] In order to achieve the above-mentioned object, the present invention provides, in a first aspect, Beauveria bassiana with a deposit number of CCTCC NO: M 2024178 ( Beauveriacaledonica ) in the prevention and treatment of banana wilt.

[0007] The second aspect of the present invention provides a method for controlling banana wilt disease using the above-mentioned Beauveria bassiana.

[0008] In summary, the present invention has the following beneficial effects:

[0009] 1. Beauveria bassiana Cs-2 is isolated from the adult of banana pseudostem weevil and can colonize in banana plants. It is an endophytic insect pathogenic fungus and can colonize better in the natural environment than engineered bacteria.

[0010] 2. The long-term colonization of Beauveria bassiana Cs-2 has little effect on the normal growth of banana tissue culture seedlings and can prevent and control banana wilt disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is a morphological characteristic diagram of Beauveria bassiana Cs-2 on PDA culture medium in the present invention, in which the left side is the front side of the culture medium, the middle side is the back side of the culture medium, and the right side is the culture morphology after 30 days;

[0012] Figure 2 This is a morphological diagram of the Scottish Beauveria bassiana Cs-2 under an optical microscope, in which the left side is hyphae and the right side is spores;

[0013] Figure 3 The phylogenetic tree of Beauveria bassiana Cs-2 in the present invention;

[0014] Figure 4 Figure 1 of the plate confrontation experiment of Beauveria bassiana Cs-2 and TR4 in the present invention;

[0015] Figure 5 A longitudinal section of the bulb of the seedling of Beauveria bassiana Cs-2 potted plant verification experiment in the present invention.

[0016] Biological Deposit

[0017] The Beauveria bassiana provided by the present invention ( Beauveriacaledonica), classified and named: Beauveria caledonica Cs-2, which was deposited in the China Center for Type Culture Collection on January 23, 2024, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with the deposit number of CCTCC NO: M 2024178. DETAILED DESCRIPTION

[0018] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0019] In the present invention, Beauveria bassiana Cs-2 and Beauveria bassiana CCTCC NO: M 2024178 are the same strain, have the same meaning, and their names (numbers) can be used interchangeably.

[0020] The inventors of the present invention isolated and obtained a strain of Beauveria bassiana during the research process, named: Beauveria bassiana Cs-2, which was deposited in the China Center for Type Culture Collection on January 23, 2024, at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with a deposit number of CCTCC NO: M 2024178.

[0021] Banana tissue culture seedlings were inoculated with Beauveria bassiana Cs-2 under sterile conditions, and samples were taken from the banana plants (leaves and stems) 45 days later. After thorough surface sterilization, the Beauveria bassiana Cs-2 strain was re-isolated, thus confirming that Beauveria bassiana Cs-2 can colonize in banana plants.

[0022] Further research found that Beauveria bassiana Cs-2 can be used to prevent and control banana wilt.

[0023] Based on this, the first aspect of the present invention provides the use of the above-mentioned Beauveria bassiana Cs-2 in the prevention and treatment of banana wilt.

[0024] In the present invention, there is no particular restriction on the specific dosage of Beauveria bassiana Cs-2, as long as it can prevent and treat banana wilt disease.

[0025] According to a preferred embodiment of the present invention, when the Beauveria bassiana Cs-2 is used to control banana wilt, the amount of Beauveria bassiana Cs-2 is not less than 1×10 6 cfu / strain.

[0026] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by technicians.

[0027] Example 1 Isolation and identification of strains

[0028] 1. Isolation of strains

[0029] On July 18, 2022, a strain of entomogenous fungus was collected and isolated from the adult banana pseudostem weevil in Manjinlong Village, Gasa Town, Jinghong City, Yunnan Province (N21°54′13″, E100°48′25″, 623.5m above sea level), and was named: Beauveria bassiana Cs-2.

[0030] 2. Identification of strains

[0031] 2.1 Inoculate the strain on PDA medium. Figure 1 As shown, the colony is powdery, with white mycelium at first, and spores begin to form around 7 days later, and most of the spores are powdery. Around 15 days, the center of the colony begins to turn pink and cream, and cracks begin to appear in the spore layer. Around 30 days, the colony is basically completely discolored, and the back is light brown ( Figure 1 Left: front of the culture medium; middle: back of the culture medium; right: 30-day culture morphology).

[0032] 2.2 Morphological observation of mycelium and spores of the strain under an optical microscope

[0033] As attached Figure 2 As shown, the hyphae of the strain are colorless and smooth, with a diameter of 1.5-2.0 μm. The conidial cells are densely clustered on the hyphae, conidiophores or swollen vesicles, spherical to bottle-shaped, and the conidial cells are 2.4-5.7 μm × 1.9-3.3 μm in size. The conidial axis is about 14 μm long, with small teeth on the axis, and is bent in a knee-like shape. The conidial cells and vesicles often multiply and gather into quite dense spore heads on the conidiophores or hyphae. Conidia are colorless, smooth, single-celled, mostly short cylindrical, rarely elliptical, and usually blunt at both ends. The conidia are 2.5-6.5 μm × 1.3-2.2 μm ( Figure 2 Left: mycelium image; right: spore image).

[0034] 2.3 Molecular identification

[0035] Fungal DNA was extracted, and the genomic DNA of the strain was used as a template. The universal primers for fungi ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') were used to amplify the rDNA-ITS sequence of the strain by PCR. The PCR amplification product was detected by 1% agarose gel electrophoresis and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing result is shown in SEQ ID NO.1. The ITS sequence results of the target strain were submitted to the NCBI website (https:llblast.ncbi.nlm.nih.gov / Blast.cgi). After BLAST comparison, the sequences with high homology to the target strain were screened and downloaded. Then, MEGA7.0 software was used to run 1000 bootstrap verifications through the neighbor-joining method (NJ) to construct a phylogenetic tree, as shown in the attached figure. Figure 3 shown.

[0036] ITS sequence results of Beauveria bassiana Cs-2 strain: GACTGATCTCCTCCGCTTATTGATATGCCGCAAGTTCCCTACGTTACACGTCCTCCCGTTATTGATATGCCGTGCGAGTTGATTTACTACGCAGAGGTCGCCGCGGACGGGCCGCCACTCCA TTTCAGGGCCGGCGGTGTGCTGCCGATCCCCAATGCCGACTTCCACGGGCTGGGCCCAGGAAGTCGAGTGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGAT TCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTTGTTTTGCCTTGCGGCGTATTCAGAACATGCTGGTAATACAAGAGTTTG AGGGTCCCCGGCGGCCGCTGGTCCAGTCCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTTCACAAAAGGGTTTGGGAGTTGAAAACTCGGTAATGATCCCTCCGCAGGTCACCCTTACGGAAGGGATT

[0037] Strains and reference standard strains Beauveriacaledonica The similarity of BCRC was 99.35%; combined with morphological characteristics, the Cs-2 strain was identified as Beauveria bassiana Beauveriacaledonica .

[0038] Example 2: Antagonism of Beauveria bassiana Cs-2 against banana wilt

[0039] 1. Plate confrontation experiment of Beauveria bassiana Cs-2

[0040] In a 90 mm culture dish, Beauveria bassiana Cs-2 and TR4 were combined on PDA, and the antagonistic effect of Beauveria bassiana Cs-2 on TR4 was determined by the plate confrontation method. TR4 was inoculated in the center of the plate, and Beauveria bassiana Cs-2 was inoculated at the corresponding points around the plate. Then the culture was sealed and incubated in a 25±0.5℃ incubator for 15 days. The colony diameter and the presence of halo in the culture medium were measured every day. Each treatment was repeated 9 times.

[0041] Through the PDA plate confrontation experiment, it was found that Beauveria bassiana Cs-2 had a good inhibitory effect on banana wilt tropical race 4 (TR4), with an inhibition rate of 76.74%. Figure 4 shown.

[0042] The calculation method of the inhibition rate is: inhibition rate (%) = (control colony diameter - treated colony diameter) / (control colony diameter - bacterial cake diameter) × 100%.

[0043] 2. Potted plant verification experiment of Cs-2

[0044] The banana pot experiment was carried out in the solar greenhouse of the Songming Experimental Base of the Institute of Agricultural Environment and Resources, Yunnan Academy of Agricultural Sciences.

[0045] After taking out the cultured Brazilian banana seedlings, wash the culture medium at the root of the tissue culture seedlings and plant them in a 32-hole seedling tray containing a mixture of Brazilian banana and substrate. When the seedlings grow to 3-4 leaves, transplant them into plastic pots for planting (the pots contain a mixture of garden soil and substrate in a ratio of 1:1). When the banana seedlings grow to 5-6 leaves, the inoculation experiment begins. The inoculation concentration of Scottish Beauveria bassiana Cs-2 is 1×10 6 CFU / ml, 1 ml for each strain; TR4 inoculation concentration was 1×10 8CFU / mL, 1ml was inoculated per plant. For better effect, 1ml was diluted to 200ml with sterile water. Inoculation experiment CK group: water control; TR4 group: inoculated with banana wilt pathogen TR4 alone; TR4+Cs-2 group: inoculated with Cs-2 7 days in advance and then inoculated with banana wilt pathogen TR4. 63 days after the inoculation, the seedling bulb disease was collected for dissection observation, and the bulb disease incidence and epidemic index were calculated. The calculation formula and wilt disease grading table are as follows:

[0046] Incidence rate (%) = (number of diseased plants / total number of plants surveyed) × 100%

[0047] Disease index = 100 × ∑ (number of diseased plants at each level × representative value at each level) / (total number of leaves surveyed × highest representative value)

[0048] Table 1 Grading table of banana seedling wilt

[0049]

[0050] The morbidity and epidemic index of each treatment are shown in Table 2 below:

[0051] Table 2 Incidence of disease in potted plant experiment

[0052] deal with Incidence (%) Standard error Epidemic Index TR4 84.44% 1.068 46.11 Cs-2+TR4 8.89% 0.221 2.22 CK 0 0 0

[0053] The results of the potted test showed that compared with the control, the incidence of banana wilt disease was reduced by 89.47%, and the prevention and control effect reached 95.19%; the disease index decreased from 46.11 to 2.22, a decrease of 95.18%.

Claims

1. Beauveria bassiana with the deposit number of CCTCC NO: M 2024178 ( Beauveria caledonica ) in the prevention and control of pathogens: Fusarium oxysporum Cuban type [ Fusarium oxysporum f.sp.cubense (EF Smith) Snyder et Hasen, Foc] Application of tropical race 4 to banana wilt.

Images