Method for constructing a mouse model of down syndrome with condition-specific genetic correction and application thereof
By inserting the LoxP fragment into a mouse model and utilizing the spatiotemporal specific expression of Cre recombinase, a conditionally genetically corrected Down syndrome mouse model was constructed. This overcame the limitations of traditional models in multi-gene and multi-cell interactions, and enabled the validation of genetic correction and gene therapy intervention for the target cell type.
Patent Information
- Application Number
- CN202410444842.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-12
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-04-12
AI Technical Summary
Existing technologies are insufficient to elucidate the specific molecular mechanisms of intellectual developmental disorders in Down syndrome (DS), and traditional mouse models have limitations in understanding multi-gene and multi-cell interactions, making them unable to effectively intervene in the clinical symptoms of DS, especially since the effects of postnatal genetic intervention are unclear.
The Zbtb21-LoxP mouse model was constructed by inserting a LoxP fragment into the end of the homologous region of chromosome 21 on chromosome 16 using CRISPR/Cas9 or homologous recombination technology. The model was then hybridized with a Down syndrome model to screen out Dp16;Zbtb21-LoxP/+ double-positive mice. The spatiotemporal specific expression of Cre recombinase was used to achieve genetic correction of target tissue cells.
A research model was established that can completely correct DS genetic defects in target cell types, revealing the interaction relationships between various DS systems, tissues, and cell types. This provides a theoretical basis and in vivo research data for gene therapy intervention and verifies the effect of genetic intervention at specific developmental stages on improving DS symptoms.
Smart Images

Figure CN118370276B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of animal model construction, in particular to a construction method of a mouse model capable of realizing conditional specific genetic correction of Down syndrome and application thereof. BACKGROUND
[0002] Down syndrome (DS), also known as Trisomy 21, is caused by trisomy of human chromosome 21 (Hsa21) and has a high natural incidence of 1 / 400-1 / 2000. Although prenatal DS screening and education are widely promoted, due to the defects of existing screening technology, individual knowledge and economic level restrictions, the opening of the two-child and three-child policy in recent years and the rapid development of society leading to an increase in older pregnant women, personal choices and other real reasons, tens of thousands of DS children are still born every year. DS affects multiple systems in the body, and the average life expectancy of patients has been significantly improved with the development of medical technology. However, many clinical symptoms, including the most prominent intellectual disability of patients and their families, currently still lack effective intervention methods, causing serious physical and mental burden and economic loss to the families of children with DS and society. In order to develop treatment methods that can effectively improve the intellectual disability of children with DS, it is necessary to further understand the specific molecular mechanisms of various clinical symptoms of DS.
[0003] Hsa21 contains more than 200 protein-coding genes and 5 known miRNA genes. Based on some 21 trisomy cases found in clinical practice and mouse model research, it is believed that there is one or more major genes, and trisomy is a sufficient or necessary condition for causing a specific disease phenotype of DS. However, taking intellectual disability as an example, although we and others have identified some key pathogenic genes located on Hsa21 that cause intellectual disability, such as DYRK1A, APP, RCAN1, IFNAR, etc., through genetic research methods, on the one hand, the expression of these genes in various cell types of the nervous system is significantly increased, and how the copy number variation of these genes causes DS intellectual disability still needs to be answered, on the other hand, we have also observed complex interactions between 21 trisomy genes, some genes have mutual compensation, and the simultaneous intervention of multiple key pathogenic genes has offset the improvement effect of single gene independent correction. The existing technical system has great limitations in analyzing the multi-gene and multi-cell interactions of DS.
[0004] In addition, 21 trisomy runs through the entire life cycle of an individual, and the developmental abnormalities caused by it begin in the embryonic period, but some characteristic phenotypes such as nervous system dysfunction are generally not obvious at birth, and become more severe with age. Combined with the actual clinical intervention needs in China, whether genetic intervention after birth can still improve clinical symptoms such as intellectual disability? This still needs to be researched and answered. SUMMARY
[0005] Therefore, an embodiment of the present application provides a Down syndrome mouse model capable of conditional genetic correction, which realizes genetic correction in target tissue cells by regulating the time and space specific expression of Cre recombinase, realizes precise regulation of 21 trisomy cells and normal cells coexisting in vivo, analyzes the direct and indirect effects of 21 trisomy on specific tissue cells, and provides theoretical basis and in vivo research data for the treatment strategy of targeting specific tissue cell abnormalities to improve the corresponding clinical symptoms of DS; or genetic correction is performed at a specific development stage, the effects of 21 trisomy genes at different development stages are analyzed, and the concept verification of postnatal genetic intervention treatment effect is performed.
[0006] The technical solution is as follows:
[0007] The present application provides a method for constructing a Down syndrome mouse model capable of conditional genetic correction, comprising the following steps:
[0008] A Zbtb21-LoxP / + F0 generation mouse is obtained by inserting a LoxP fragment into the distal centromere end of the Zbtb21 gene at the end of the human chromosome 21 homologous region of mouse chromosome 16 through CRISPR / Cas9 or homologous recombination technology;
[0009] The Zbtb21-LoxP / + F0 generation mouse is crossed with a wild type mouse to screen a Zbtb21-LoxP / + F1 generation mouse;
[0010] The Zbtb21-LoxP / + F1 generation mouse is crossed with a Down syndrome model Dp16 / + mouse to obtain a Dp16 / Zbtb21-LoxP double positive mouse; wherein the Dp16 / + mouse contains a large repeated fragment of linear homologous chromosomes from human chromosome 21 long arm, and the repeated chromosome fragment contains a LoxP fragment; the Dp16 / Zbtb21-LoxP double positive mouse contains two LoxP fragments, which are located on two homologous chromosomes from the parents; and,
[0011] The Dp16 / Zbtb21-LoxP double positive mouse is crossed with a wild type mouse to screen a Dp16; Zbtb21-LoxP / + double positive mouse, which is a Down syndrome mouse model capable of conditional genetic correction; wherein the Dp16; Zbtb21-LoxP / + double positive mouse contains two LoxP fragments, which are located in the middle of the repeated chromosome segment and the distal centromere end of the same chromosome.
[0012] In one embodiment, the targeting vector, gRNA and Cas9 are injected into mouse zygote cells, and the zygote is transplanted into a pseudopregnant mouse, and the Zbtb21-LoxP / + F0 generation mouse is screened from the produced young mice.
[0013] In one embodiment, the targeting vector comprises, in order, a 5' homology arm, the LoxP fragment, and the SA-IRES-tdTomato-BGpA segment, and a 3' homology arm.
[0014] Optionally, the 5' homology arm is as set forth in bases 663 to 2448 of SEQ ID NO: 2; the LoxP fragment is as set forth in bases 2449 to 2482 of SEQ ID NO: 2; the SA-IRES-tdTomato-BGpA segment is as set forth in bases 2483 to 5092 of SEQ ID NO: 2; and the 3' homology arm is as set forth in bases 5093 to 6893 of SEQ ID NO: 2.
[0015] Optionally, the recognition region of the gRNA comprises a region as set forth in SEQ ID NO: 1.
[0016] In one embodiment, the Cas9 comprises a Cas9 mRNA.
[0017] In one embodiment, the method further comprises a step of genotyping the Zbtb21-LoxP / + F0 generation mice, the Zbtb21-LoxP / + F1 generation mice, the Dp16 / Zbtb21-LoxP double positive mice, and the Dp16; Zbtb21-LoxP / + double positive mice.
[0018] In one embodiment, the genotyping method comprises one or more of a PCR method, a sequencing method, and a Southern blot method.
[0019] In one embodiment, the Zbtb21-LoxP / + F0 generation mice are genotyped using a PCR method, and the PCR primers for genotyping comprise a primer pair as set forth in SEQ ID NO: 3 and SEQ ID NO: 4 and / or a primer pair as set forth in SEQ ID NO: 5 and SEQ ID NO: 6.
[0020] In one embodiment, the Zbtb21-LoxP / + F0 generation mice are genotyped using a sequencing method, and the sequencing primers for genotyping comprise a primer pair as set forth in SEQ ID NO: 7 and SEQ ID NO: 8.
[0021] In one embodiment, the genotypes of the Dp16 / Zbtb21-LoxP double positive mice and the Dp16; Zbtb21-LoxP / + double positive mice are identified by PCR, and the PCR primers for the genotype identification include the primer pair of SEQ ID NO: 9-10 and the primer pair of SEQ ID NO: 7 and 11.
[0022] The second aspect of the present application provides cells or tissues of the Down syndrome mouse model that can achieve conditional genetic correction, which are constructed by the construction method.
[0023] The third aspect of the present application provides the use of the Down syndrome mouse model that can achieve conditional genetic correction, which is constructed by the construction method, in constructing a conditional genetic correction Down syndrome mouse model.
[0024] The fourth aspect of the present application provides a method for achieving conditional genetic correction of a Down syndrome mouse model, which comprises the following steps:
[0025] constructing a Down syndrome mouse model that can achieve conditional genetic correction by the construction method; and
[0026] crossing a cell lineage-specific Cre mouse with the Down syndrome mouse model, or
[0027] injecting a Cre-containing AAV vector into the Down syndrome mouse model to achieve conditional genetic correction of specific tissues and cells or specific developmental stages of the Down syndrome mouse model.
[0028] In one embodiment, the specific tissues and cells of the conditional genetic correction are genetically identified.
[0029] In one embodiment, the specific tissues and cells of the conditional genetic correction are genetically identified by PCR, and the PCR primers for the genotype identification include the primer pair of SEQ ID NO: 11-12.
[0030] Compared with the prior art, the present application has the following beneficial effects:
[0031] The application uses CRISPR / Cas9 or homologous recombination technology and the LoxP site left at the junction of the repeated chromosomal segment in the construction process of Dp16 / + mice to innovatively establish a research model that can completely correct the genetic defects of DS in the target cell type or at a specific development stage. The model is crossed with a tool mouse in which a Cre gene is inserted into various tissue-specific targets, which can achieve complete correction of the genetic defects of DS in the target tissue cells, can reveal the interaction between various systems and cell types of DS at the in vivo level, and can be used to study key pathological driving factors, find intervention targets, etc. Or by injecting Cre into the model through AAV, the therapeutic effect of gene therapy intervention using a specific AAV serotype at a specific development stage is tested. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 DS-Flox mouse model for achieving conditional genetic correction of Down syndrome is constructed by the strategy shown in the figure; wherein, Figure 1 A in the figure is the linear homologous region of human chromosome 21 and mouse chromosome 16 and the genetic structure of Dp16 mouse; Figure 1 B in the figure is a schematic diagram of Dp16 mouse, DS-Flox mouse and conditional genetic correction; Figure 1 C in the figure is a schematic diagram of the construction strategy of DS-Flox mouse;
[0033] Figure 2 The detailed schematic diagram of the construction and identification of Zbtb21-LoxP mouse is shown in the figure; blue arrow on Targeting Vector: LoxP sequence; SA: splicing acceptor; IRES: internal ribosome entry site; tdTomato: reporter gene; BGpA: transcription and translation regulatory element, beta-globin poly(A) signal; M, MfeI; K, KpnI;
[0034] Figure 3 Zbtb21-LoxP F0 generation mouse screening and identification; wherein, Figure 3 A in the figure is the PCR screening result; Figure 3 B in the figure is the sequencing result; wherein KI is knock-in, i.e. inserted vector sequence;
[0035] Figure 4 DS-Flox mouse identification; wherein, Figure 4 A in the figure is the Southern Blot identification of F1 generation Zbtb21 mouse; Figure 4 B in the figure is the screening result of DS-Flox mouse;
[0036] Figure 5 Conditional genetic correction feasibility test; Figure 5 A in FIG. 1 is a schematic diagram of Cre recombinase-mediated genetic correction; Figure 5 B in FIG. 1 is detected by Dp-KO-F / R primer pair whether genetic correction occurs in lung tissue DNA;
[0037] Figure 6 DS-Flox in vivo large fragment chromosomal deletion correction feasibility test results. DETAILED DESCRIPTION
[0038] In order to make the above purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application are described in detail below. In the following description, a large number of specific details are set forth in order to facilitate a thorough understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the spirit of the present application, so the present application is not limited by the specific embodiments disclosed below.
[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the specification of the present application is only for the purpose of describing specific embodiments and is not intended to limit the present application.
[0040] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0041] More than 60% of the homologous genes of human chromosome 21 (Hsa21) are linearly and conservedly distributed at the distal telomere of the long arm of mouse chromosome 16 (Mmu16). The Down syndrome model mouse Dp(16Lipi-Zfp295)1Yey (referred to as Dp16 / + mouse or Dp16 mouse, JAX stock #013530, https: / / www.jax.org / strain / 013530) contains all the Hsa21 homologous genes located on Mmu16 and is triploid. During the construction of Dp16 / + mouse, a LoxP site was left at the junction of the repeated chromosomal fragment (A-B in FIG. 1). Figure 1 The Dp16 / + mouse not only better simulates the genetic cause of DS at the DNA level, but also exhibits similar heart and intestinal malformations, skull and upper respiratory tract structural changes, postnatal growth and neural functional development retardation, learning and cognitive and motor dysfunction, and abnormal hematopoietic stem cell differentiation as DS patients.
[0042] The application targets and inserts a LoxP site at the distal centromere end of the Zbtb21 gene at the end of the homologous region of chromosome 21 (Hsa21) of mouse chromosome 16 (Mmu16) by CRISPR / Cas9 or homologous recombination technology, and constructs a Dp16; Zbtb21-LoxP / + double positive mouse by using the original LoxP site in the Dp16 / + mouse.
[0043] An embodiment of the application provides a construction method of a Down syndrome mouse model (named DS-Flox) capable of realizing conditional genetic correction, comprising the following steps a-d:
[0044] Step a: inserting a LoxP sequence at the distal centromere end of the Zbtb21 gene at the end of the homologous region of chromosome 21 (Hsa21) of mouse chromosome 16 (Mmu16) by CRISPR / Cas9 or homologous recombination technology to obtain Zbtb21-LoxP / + F0 generation mice.
[0045] In a specific example, the targeting vector, gRNA and Cas9 are injected into mouse zygote cells, and the zygote is transplanted into a pseudopregnant mouse to obtain Zbtb21-LoxP / + F0 generation mice.
[0046] In a specific example, the targeting vector sequentially contains a 5' homologous arm, a LoxP and a SA-IRES-tdTomato-BGpA segment, and a 3' homologous arm.
[0047] In a specific example, the sequence of the targeting vector comprises the sequence shown from the 663th base to the 6893th base in SEQ ID NO: 2, wherein the 5' homologous arm is located from the 663th base to the 2448th base in SEQ ID NO: 2, the LoxP is located from the 2449th base to the 2482th base in SEQ ID NO: 2, the SA-IRES-tdTomato-BGpA is located from the 2483th base to the 5092th base in SEQ ID NO: 2, and the 3' homologous arm is located from the 5093th base to the 6893th base in SEQ ID NO: 2.
[0048] In a specific example, the sequence of the targeting vector is SEQ ID NO: 2.
[0049] In a specific example, the recognition region of the gRNA comprises the region shown in SEQ ID NO: 1.
[0050] In a specific example, the Cas9 comprises Cas9 mRNA.
[0051] In a specific example, the mouse of the zygote cell and the pseudopregnant mouse are of the C57BL / 6 strain.
[0052] In one specific example, the method further comprises a step of genotyping the Zbtb21-LoxP / + F0 generation mice.
[0053] In one specific example, the genotyping method comprises one or more of a PCR method, a sequencing method and a Southern blot method.
[0054] In one specific example, the genotyping method is a PCR method, and the PCR primers for genotyping the Zbtb21-LoxP / + F0 generation mice comprise a primer pair as shown in SEQ ID NO: 3-SEQ ID NO: 4 and / or a primer pair as shown in SEQ ID NO: 5-SEQ ID NO: 6.
[0055] In one specific example, the genotyping method is a sequencing method, and the sequencing primers for genotyping the Zbtb21-LoxP / + F0 generation mice comprise a primer pair as shown in SEQ ID NO: 7-SEQ ID NO: 8.
[0056] Step b, crossing the Zbtb21-LoxP / + F0 generation mice with wild type mice to obtain Zbtb21-LoxP / + F1 generation mice.
[0057] In one specific example, the method further comprises a step of genotyping the Zbtb21-LoxP / + F1 generation mice.
[0058] In one specific example, the genotyping method is as described above.
[0059] Step c, crossing the Zbtb21-LoxP / + F1 mice with stable inheritance with Dp16 / + mice to obtain Dp16 / Zbtb21-LoxP double positive mice.
[0060] The Dp16 / + mice contain a large fragment of a linear homologous chromosome to human chromosome 21 long arm repeat, and the connection of the repeated chromosome fragment contains a LoxP site.
[0061] The obtained Dp16 / Zbtb21-LoxP double positive mice contain two LoxP sites, respectively located on two homologous chromosomes from the parents.
[0062] In one specific example, the method further comprises a step of genotyping the Dp16 / Zbtb21-LoxP double positive mice.
[0063] In one specific example, the genotyping method is as described above.
[0064] Optionally, the method for genotyping is PCR, and the PCR primers for genotyping the Dp16 / Zbtb21-LoxP double positive mouse comprise the primer pair of SEQ ID NO: 9-10 and the primer pair of SEQ ID NO: 7 and 11.
[0065] Step d: crossing the Dp16 / Zbtb21-LoxP double positive mouse with a wild type mouse to obtain a Dp16; Zbtb21-LoxP / + double positive mouse, i.e. a DS-Flox mouse model. Generally, based on Mendelian segregation, the two LoxP sites segregate, and the LoxP site contained in Dp16 and the LoxP site contained in Zbtb21-LoxP do not appear in the same offspring at the same time, but random homologous recombination occurs during gametogenesis, and there is a certain probability that the two LoxP sites are homologously recombined to the same chromosome. Through screening of a certain scale of offspring, the offspring formed by gametes with homologous recombination can be detected for the LoxP site contained in Dp16 and the LoxP site contained in Zbtb21-LoxP in the same individual.
[0066] At this time, the LoxP site contained in Dp16 and the LoxP site contained in Zbtb21-LoxP are located in the middle of the duplicated chromosome segment and the distal centromere end of the same chromosome, respectively. Conditional (time or space control) expression of the recombinase Cre makes it possible to ensure deletion of DNA sequences at a specific site (for example, in a specific cell type or tissue) and at a specific time (at a specific stage of development of mouse cells and tissues). When the recombinase Cre is expressed, recombination between the LoxP sites can delete the Hsa21 homologous chromosome segment on Dp16. By regulating the spatiotemporal expression of Cre, it can be used to analyze the direct and indirect effects of 21 trisomy homologous genes on specific cell lineages, or to study the improvement of specific clinical symptoms of Down syndrome at a specific developmental stage for genetic intervention, in order to conduct conceptual verification of target intervention of Down syndrome.
[0067] In a specific example, the method further comprises a step of genotyping the DS-Flox mouse model, and the method for genotyping is PCR, and the PCR primers for genotyping the DS-Flox mouse model comprise the primer pair of SEQ ID NO: 9-10 and the primer pair of SEQ ID NO: 7 and 11.
[0068] The DS-Flox mouse model constructed by the method is also provided.
[0069] The DS-Flox mouse model is also provided for use in constructing a conditional genetic correction DS mouse model.
[0070] In a specific example, the conditional genetic correction DS mouse model is constructed by crossing a cell lineage-specific Cre mouse with the DS-Flox mouse model, or by injecting a Cre-containing AAV vector into the DS-Flox mouse model.
[0071] The conditional genetic correction DS mouse model constructed by the method and the specific tissue or cell genetically corrected in the conditional genetic correction DS mouse model are also provided.
[0072] The method for achieving conditional genetic correction of the Down syndrome mouse model is also provided, comprising the following steps (1) and (2):
[0073] Step (1), constructing the DS-Flox mouse model by the method;
[0074] Step (2), crossing a cell lineage-specific Cre mouse with the DS-Flox mouse model to achieve conditional genetic correction of specific tissues and cells of the Down syndrome mouse model, or
[0075] injecting a Cre-containing AAV vector into the DS-Flox mouse model to achieve conditional genetic correction of specific developmental stages of the Down syndrome mouse model.
[0076] The cell lineage-specific Cre mouse can express Cre recombinase in specific tissues or cells by using different tissue or cell-specific promoters upstream of the Cre recombinase expression system, thereby achieving spatial specificity of conditional gene knockout.
[0077] According to the purpose, a person skilled in the art can select different tissue or cell-specific Cre mice to cross with the DS-Flox mouse to achieve tissue or cell-specific genetic correction.
[0078] In a specific example, the specific tissues and cells of the conditional genetic correction are also genetically identified.
[0079] In one specific example, the genetically identified PCR primers for the genetically corrected specific tissues and cells include the primer pair of SEQ ID NO: 11-SEQ ID NO: 12.
[0080] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that the examples are only used to illustrate but not to limit the scope of the present application. The experimental methods in the following examples without specific conditions are preferably referred to the guidance given in the present application, and can also be according to the experimental manual or conventional conditions in the art, or according to the conditions suggested by the manufacturer, or according to the known experimental methods in the art.
[0081] In the following specific examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range, unless otherwise specified. The temperature and time parameters allow for acceptable deviations caused by instrument testing accuracy or operation accuracy.
[0082] The main methods involved in the following examples include the following:
[0083] Example 1
[0084] This example provides a method for constructing a Down syndrome mouse model that can achieve conditional genetic correction, and the construction strategy is as follows Figure 1As shown in A-C, a LoxP site was targeted and inserted into the end of the syntenic region of chromosome 21 (Hsa21) distal to the Zbtb21 gene on mouse chromosome 16 (Mmu16) by CRISPR / Cas9 or homologous recombination technology to construct Zbtb21-LoxP mice. Then the Zbtb21-LoxP mice were mated with Dp16 mice (JAX stock #013530, https: / / www.jax.org / strain / 013530, Li Z., Yu T., Morishima M., Pao A., Laduca J., Conroy J., Nowak N., Matsui S., Shiraishi I. & Yu Y.E. Duplication of the entire 22.9Mb human chromosome 21 syntenic region on mouse chromosome 16 causes cardiovascular and gastrointestinal abnormalities. Human Molecular Genetics, 2007, 16(11), 1359-1366.) to obtain Dp16 / Zbtb21-LoxP mice. Homologous recombination between homologous chromosomes during gametogenesis of Dp16 / Zbtb21-LoxP mice was used to screen for Dp16 mice in which the original LoxP of Zbtb21-LoxP and Dp16 were located on the same chromosome; Zbtb21-LoxP / + mice, i.e., a conditional genetic correction of Down syndrome mouse model (DS-Flox mice) was achieved. In cells of tissues in which Cre recombinase was expressed, recombination between the two LoxP sites occurred, thereby deleting the duplicated segment of the chromosome of Dp16 mice. By regulating the time- and space-specific expression of Cre recombinase, genetic correction can be achieved in specific cell lineages and at specific developmental stages.
[0085] Specifically, the method comprises the following steps:
[0086] (1) Design a gRNA targeting the end of the syntenic region of chromosome 21 (Hsa21) distal to the Zbtb21 gene on mouse chromosome 16 (Mmu16): AAGAGGTCATTATCTTAGACTGG, SEQ ID NO: 1.
[0087] (2) Construct a targeting vector comprising a 5' homologous arm (1.786 kb), a LoxP segment, SA-IRES-tdTomato-BGpA, and a 3' homologous arm (1.801 kb), as shown in Figure 2
[0088] (3) Inject gRNA, Cas9 mRNA and targeting vector into C57BL / 6 mouse zygotes by CRISPR / Cas9 DNA editing technology, and transplant into pseudopregnant female mice to produce F0 generation mice.
[0089] (4) First, use F1 / R1 and F2 / R2 primers to perform PCR screening on the tail sample DNA of F0 generation mice, and then use F3 / R3 primers to sequence the PCR product to verify the F0 generation positive mice (F0 generation Zbtb21-LoxP mice) inserted with the targeting vector. The primers used are shown in Table 1.
[0090] Table 1
[0091]
[0092] PCR results are shown in Figure 3 A: PCR reaction of F0 generation mice No. 6, 7, 8 and 9 can obtain a single amplification band (4.4 kb) using F1 and R1 primers, and wild-type mice have no amplification band; PCR reaction of F0 generation mice No. 6, 7, 8 and 9 can obtain a single amplification band (5 kb) using F2 and R2 primers, and wild-type mice have no amplification band. Sequencing results are shown in Figure 3 B: These mice successfully inserted the targeting vector, which are F0 generation positive mice.
[0093] (5) F0 generation positive mice are mated with wild-type C57BL / 6 mice to obtain F1 generation positive mice (F1 generation Zbtb21-LoxP mice) with stable inheritance. Southern blot technology is used to further verify the correctness of the F1 generation positive mice inserted with the targeting vector, as shown in Figure 4 A.
[0094] Among them, Southern blot technology: extract high-quality tail sample DNA, digest the DNA with restriction endonuclease MfeI and KpnI, separate the DNA fragments by gel electrophoresis, hybridize the target fragments with the vector probe Figure 2 , and develop the band.
[0095] (6) After the F1 generation positive mice mature, they are mated with Dp16 to obtain Dp16 / Zbtp21-LoxP double positive mice. Genotype identification is performed by PCR method, and the primers used are shown in Table 2. Dp16 / Zbtp21-LoxP double positive mice are double positive bands of Dp16 (351 bp) and Zbtb21-LoxP (464 bp).
[0096] Take Dp16 as an example:
[0097] PCR reaction system (total 20 μl): DNA 1 μl, H2O 8 μl, Dp16-F (10 μM) 0.5 μl, Dp16-R (10 μM) 0.5 μl, 2 x Master Mix 10 μl.
[0098] Reaction procedure: 95 °C 3 min; 95 °C 15 s, 56 °C 15 s, 72 °C 30 s, 35 cycles; 72 °C 5 min.
[0099] Result judgment: Dp16 positive: amplified band 351 bp; Dp16 negative: no band or weak non-specific band; Zbtb21-LoxP positive: amplified band 464 bp; Zbtb21-LoxP negative: no band or weak non-specific band.
[0100] (7) Using homologous recombination between homologous chromosomes with a certain probability during meiosis, screening Dp16 / Zbtb21-LoxP mice mated with wild type mice (WT) to obtain Dp16 and Zbtb21-LoxP double positive offspring, such as Figure 4 Figure 5, i.e. Dp16; Zbtb21-LoxP / + mouse (DS-Flox mouse). Among them, the screening is carried out by PCR method, and the primers used are shown in Table 2.
[0101] Table 2
[0102]
[0103] Example 2
[0104] This example uses Pecam1-iCre-EGFP mice to mate with DS-Flox mice to obtain vascular endothelial cell-specific conditional correction DS mice (DS-Flox / +; Pecam1-iCre-EGFP), i.e. HSA21 diploid in vascular endothelial cells, and HSA21 homologous gene triploid in other tissue cells, and the flowchart is shown in Figure 5 A in the figure.
[0105] The Cre / LoxP recombination efficiency is affected by the open state of the genome at the position of the LoxP site and the distance between the two LoxP sites. Unlike the deletion of a short distance fragment of several Kbs, the deletion of a chromosome fragment of 22.9 Mb in DS-Flox mice is a great challenge. This example provides test data for the feasibility of the system, and the principle is preliminarily speculated as follows: the consistency of the 22.9 Mb repetitive genomic sequence near the centromere side of the two LoxP sites is close, and the three-dimensional positioning in the cell nucleus is close, and the actual meeting probability of the LoxP sites is higher.
[0106] Pecam1-iCre expression in vascular endothelial cells, extraction of lung tissue DNA rich in blood vessels, PCR identification. As shown in Figure 5 DS-Flox mice, the primer pair Dp-KO-F and Dp-KO-R is about 22.9 Mb apart, no band is amplified by PCR; in the cells of the tissue with Cre expression, if the two Lox-P sites are successfully recombined, the 22.9 Mb chromosome fragment in between is successfully deleted, the primer pair Dp-KO-F and Dp-KO-R is close to the binding site, and a band can be successfully amplified. The primers used are shown in Table 3, and the results are shown in Figure 5 It can be seen that the lung tissue DNA of the DS-Flox / +; Pecam1-iCre-EGFP mouse Figure 5 No. 4 mouse) successfully amplified the target band with the successful Dp-KO primer pair, indicating the presence of large fragment chromosome deletion. The PCR product was sequenced to further confirm the correct deletion of the large fragment chromosome, as shown in Figure 6 .
[0107] Table 3
[0108]
[0109] The technical features of the above-described embodiments can be combined in any manner. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described, but as long as the combinations of the technical features do not contradict, they should be considered within the scope of the present disclosure.
[0110] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are all within the scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims, and the description can be used to explain the content of the claims.
Claims
1. A method for constructing a Down syndrome mouse model capable of conditional genetic correction, characterized in that, Includes the following steps: The LoxP fragment was inserted into the distal centromere of the Zbtb21 gene at the end of the homologous region of human chromosome 21 on mouse chromosome 16 using CRISPR / Cas9 or homologous recombination technology to obtain Zbtb21-LoxP / +F0 generation mice. The Zbtb21-LoxP / +F0 generation mice were crossed with wild-type mice to screen out the Zbtb21-LoxP / +F1 generation mice; The Zbtb21-LoxP / + F1 generation mice were crossed with the Down syndrome model Dp16 / + mice to obtain Dp16 / Zbtb21-LoxP double-positive mice. The Dp16 / + mice contain a large repeat of a linear homologous chromosome segment on the long arm of human chromosome 21, with a LoxP segment at the junction of the repeating chromosome segment. The Dp16 / Zbtb21-LoxP double-positive mice contain two LoxP segments, located on two homologous chromosomes from the parents, respectively. The Dp16 / Zbtb21-LoxP double-positive mice were crossed with wild-type mice to screen for Dp16;Zbtb21-LoxP / + double-positive mice, which are the Down syndrome mouse models that can achieve conditional genetic correction. The Dp16;Zbtb21-LoxP / + double-positive mice contain two LoxP segments, located in the middle of the repetitive chromosomal segment of the same chromosome and at the distal centromere, respectively.
2. The construction method according to claim 1, characterized in that, The targeting vector, gRNA, and Cas9 were injected into mouse zygotes, and the zygotes were transferred into pseudopregnant mice. The Zbtb21-LoxP / +F0 generation mice were obtained from the offspring. The targeting vector contains a 5' homologous arm, the LoxP fragment, the SA-IRES-tdTomato-BGpA region, and a 3' homologous arm.
3. The construction method according to claim 2, characterized in that, The 5' homologous arm is shown as bases 663 to 2448 in SEQ ID NO:2; the LoxP fragment is shown as bases 2449 to 2482 in SEQ ID NO:2; the SA-IRES-tdTomato-BGpA region is shown as bases 2483 to 5092 in SEQ ID NO:2; and the 3' homologous arm is shown as bases 5093 to 6893 in SEQ ID NO:
2.
4. The construction method according to claim 2, characterized in that, The recognition region of the gRNA includes the region shown in SEQ ID NO:
1.
5. The construction method according to claim 4, characterized in that, The Cas9 includes Cas9 mRNA.
6. The construction method according to any one of claims 2-5, characterized in that, It also includes the step of genotyping the Zbtb21-LoxP / +F0 generation mice, the Zbtb21-LoxP / +F1 generation mice, the Dp16 / Zbtb21-LoxP double-positive mice, and the Dp16;Zbtb21-LoxP / + double-positive mice.
7. The construction method according to claim 6, characterized in that, The genotype identification methods include one or more of PCR, sequencing, and Southern blot.
8. The construction method according to claim 7, characterized in that, The Zbtb21-LoxP / +F0 generation mice were genotyped using PCR. The PCR primers for genotype identification included primer pairs as shown in SEQ ID NO:3 to SEQ ID NO:4, and / or primer pairs as shown in SEQ ID NO:5 to SEQ ID NO:
6. The genotypes of the Zbtb21-LoxP / +F0 generation mice were identified by sequencing, and the sequencing primers for genotype identification included primer pairs as shown in SEQ ID NO:7 to SEQ ID NO:8; Genotyping of the Dp16 / Zbtp21-LoxP double-positive mice and the Dp16;Zbtb21-LoxP / + double-positive mice was performed using PCR. The PCR primers for genotyping included the primer pairs shown in SEQ ID NO:9 to SEQ ID NO:10 and the primer pairs shown in SEQ ID NO:7 and SEQ ID NO:
11.
9. Cells or tissues of a Down syndrome mouse model capable of conditional genetic correction, constructed using the construction method described in any one of claims 1-8.
10. The application of the Down syndrome mouse model capable of conditional genetic correction constructed by the construction method according to any one of claims 1-8 in the construction of a conditionally genetically corrected Down syndrome mouse model.
11. A method for conditional genetic correction in a mouse model of Down syndrome, characterized in that, Includes the following steps: A Down syndrome mouse model capable of conditional genetic correction was constructed using the construction method described in any one of claims 1-8; and, The mice that specifically express Cre from cell lineages were crossed with the Down syndrome mouse model, or By injecting Cre-containing AAV vector into the Down syndrome mouse model, conditional genetic correction of specific tissues and cells or specific developmental stages in the Down syndrome mouse model can be achieved.
12. The method according to claim 11, characterized in that, It also includes genetic identification of specific tissues and cells for conditional genetic correction.
13. The method according to claim 12, characterized in that, PCR was used to perform genetic identification on specific tissues and cells with conditional genetic correction. The PCR primers for genetic identification included the primer pairs shown in SEQ ID NO:11 to SEQ ID NO:12.
Citation Information
Patent Citations
Comprehensive detection of single cell genetic structural variations
CN114026647A
Method for preparing humanized RHO and / or RHO mutant mouse and application of humanized RHO and / or RHO mutant mouse
CN116716345A