Application of OsMATE2-YY gene in regulating rice grain shape

Abstract

The present invention provides an application of OsMATE2-YY gene in regulating rice grain shape, and belongs to the technical field of plant genetic engineering. The present invention uses Yunyin, a japonica rice variety with broad-spectrum resistance to rice blast, as a research material. In the early stage, the gene expression spectrum of Yunyin after being induced by rice blast fungus was constructed using Affymetrix full gene expression spectrum chip, and a transcript numbered AK073902 was screened out. Through the comparison of the NCBI website, it was found that the transcript encodes a MATE gene, which was named OsMATE2-YY. Then, a transgenic experiment was used to systematically study and analyze its function. As a result, it was found that no matter whether the OsMATE2-YY gene was up-regulated or down-regulated in rice, the length of rice grains became longer, the width became wider, and the thickness became smaller. The present invention has important theoretical and practical significance for further clarifying the molecular mechanism of plant grain development and cultivating high-quality and high-yield new crop varieties through genetic engineering.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of OsMATE2-YY gene in regulating rice grain shape. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important staple foods, providing food for half of the world's population. With the improvement of people's living standards, in addition to nutritional requirements and yield requirements, people's requirements for the appearance quality of rice are getting higher and higher. For example, the Guangdong region generally recognizes the long and slender rice, so the improvement of grain shape is becoming more and more important in rice production.

[0003] Multidrug resistance transporters (MRTs) are important drug resistance pumps that can expel structurally and chemically different drugs or toxins from cells. Existing studies have shown that the MRT families involved in plant detoxification processes are mainly divided into the following five categories: (1) ATP-binding cassette superfamily (ABC); (2) major facilitator superfamily (MFS); (3) small gene multidrug resistant family (SMR); (4) resistance / nodulation / division family (RND); (5) multidrug and toxic compounds (MATE) protein family. Recent genetic and biochemical studies have shown that MATE transporters play a role in the compartmentalization of flavonoid compounds. As a flavonoid / H+ antiporter, MATE transporters show preference for flavonoid compound molecules with different specific chemical structures, such as the Arabidopsis TT12 transporter that transports flavan-3-ols to the vacuole of the seed coat using an H+ antiport mechanism. In addition to the transport of flavonoids, MATE proteins are also involved in the transport of a variety of molecules, including salicylic acid, aluminum tolerance, heavy metal detoxification, alkaloid accumulation, iron homeostasis, and plant development.

[0004] However, there is no report that MATE transporters can affect plant grain shape, especially rice grain shape. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides for the first time the application of OsMATE2-YY gene in regulating rice grain shape. Specifically: The present invention uses Yunyin, a japonica rice variety with broad-spectrum resistance to rice blast, as the research material. In the early stage, the gene expression spectrum of Yunyin after being induced by rice blast fungus was constructed using Affymetrix whole gene expression spectrum chip, and the transcript numbered AK073902 was screened out. Through the comparison of the NCBI website, it was found that the transcript encodes an OsMATE gene, which was named OsMATE2-YY. Then, its function was systematically studied and analyzed using transgenic experiments. The results showed that no matter whether the OsMATE2-YY gene was up-regulated or down-regulated in rice, the rice grains became longer, wider, and thinner. The present invention has important theoretical and practical significance for further clarifying the molecular mechanism of plant grain development and cultivating high-quality and high-yield new crop varieties through genetic engineering.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] One of the purposes of the present invention is to provide an application of the OsMATE2-YY gene in regulating rice grain shape, wherein the regulation of rice grain shape is to make the rice grain length longer, the grain width wider, and the grain thickness smaller; the nucleotide sequence of the OsMATE2-YY gene is shown in SEQ ID No.1.

[0008] Furthermore, the specific embodiment of the application is as follows: no matter whether the expression of the OsMATE2-YY gene in rice is up-regulated or down-regulated, the rice grains become longer, wider, and thinner.

[0009] The second object of the present invention is to provide an application of a biological material in regulating rice grain length, grain width and grain thickness, wherein the biological material is a kit, a recombinant vector, a recombinant bacterium or a transgenic cell line capable of up-regulating or down-regulating the expression of the OsMATE2-YY gene.

[0010] The third object of the present invention is to provide a method for cultivating a rice variety with longer grain length, wider grain width and smaller grain thickness, the method comprising the step of up-regulating or down-regulating the expression of the OsMATE2-YY gene in the recipient rice.

[0011] A fourth object of the present invention is to provide the application of the OsMATE2-YY gene, the biological material or the method in rice breeding.

[0012] Furthermore, the purpose of the breeding is to select rice with longer grains, wider grains and smaller grain thickness.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention first discovered that no matter whether the OsMATE2-YY gene is up-regulated or down-regulated in rice, the rice grain length becomes longer, the grain width becomes wider, and the grain thickness becomes smaller. The present invention has important theoretical and practical significance for further clarifying the molecular mechanism of plant grain development and cultivating high-quality and high-yield new crop varieties through genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The comparison result of the CDS of the OsMATE2-YY gene of Yunyin and its encoded amino acid sequence with Nipponbare in Example 1 of the present invention;

[0016] Figure 2 The process of obtaining the OsMATE2-YY over-expression and knock-out expression transgenic strains by Agrobacterium-mediated transformation in Example 1 of the present invention;

[0017] Figure 3 This is the detection result of the OsMATE2-YY overexpression strain in Example 1 of the present invention;

[0018] Figure 4 This is the detection result of the OsMATE2-YY knockout strain in Example 1 of the present invention;

[0019] Figure 5 This is the specific effect of OsMATE2-YY on seed shape in Example 2 of the present invention. DETAILED DESCRIPTION

[0020] The following examples will further illustrate the specific steps and features of the invention, which are for illustrative purposes only and are not intended to limit the present invention. The methods used in the present invention are conventional methods in the art unless otherwise specified. The reagents, materials, and instruments involved in the present invention are commercially available unless otherwise specified.

[0021] The present invention takes Yunyin, a japonica rice variety with broad-spectrum resistance to rice blast, as the research material, and uses Affymetrix whole gene expression profile chip to construct the gene expression profile of Yunyin after being induced by rice blast fungus, and screens out the transcript numbered AK073902. The NCBI database (https: / / www.ncbi.nlm.nih.gov / ) and rice gene annotation (https: / / rapdb.dna.affrc.go.jp / ) show that AK073902 corresponds to the rice MATE gene Os05t0554000-01 transcript, with a total length of 1227bp. The primary structure of the protein encoded by the Os05t0554000-01 transcript contains 409aa, with a predicted pI of 6.11 and a molecular weight of 43.5kDa. There is a MATE eukaryotic domain at amino acids 39 to 407, and there are 7 conserved cation binding sites. The secondary structure of AK073902 polypeptide was predicted by PredictProtein (https: / / predictprotein.org / ), and it was found that it had 12 α helices and 3 β links. The protein topology was predicted by TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM / ), and it was found that there were 9 transmembrane helical structures in AK073902 polypeptide. The amino acid sequence similarity of AK073902 with other members of the plant MATE family was 56.78-81.92%, with the highest homology to HvMATE9 of barley (81.92%) and the lowest homology to CsDTX12 of dicotyledonous wild tea tree (56.78%). Since Os05t0554000-03 has been reported and named OsMATE2, the present invention named the transcript AK073902 (Os05t0554000-01) obtained in Yunyin as OsMATE2-YY.

[0022] The present invention is further described in detail below with reference to the embodiments and drawings:

[0023] Example 1 Cloning of Yunyin OsMATE2-YY and Construction of Its Overexpression and Knockout Strains

[0024] 1. Cloud-based cloning of OsMATE2-YY

[0025] The complete coding sequence of gene OsMATE2-YY was successfully cloned from Yunyin using RT-PCR technique. DNA extraction was basically carried out according to the method of Sambrook et al. The cloned sequence is shown in SEQ ID No. 1. The primers used to clone OsMATE2-YYCDS, ORF and Promoter are shown in Table 1. The comparison results of OsMATE2-YYCDS sequence with Nipponbare are shown in Figure 1 as shown

[0026] SEQ ID No.1:

[0027] ACAGACACCAAAGCCGTCTCTGAGAAGAAGAGAGGGAGAGAGAGAGAGAGAGAGAG

[0028] AGCTCGGTCGGTGGAGGCGACGACGACGACGCGCGCACTGCGGCCGCCATGGAGGAG

[0029] AGAATACCTCTGCTCTCGAAACGATTCCCGGCGGACGGCACCGCCGGAGTGGGAGGAG

[0030] GGAGGGAGGAGGAGGGCGGAGATAGGTGGTGGAGCGGGCTGGCGCGGGAGGCAGGG

[0031] AAGGTGGGGTCCATGGCGCTGCCCATGGCCGCGATGAGCGTGGCGCAGAACGCCGTGC

[0032] AGGTGGCGTCCAACATGATGGTGGGGCACCTCCCCGGCGTCCTCCCGCTCTCCGCCTCC

[0033] GCCATCGCCACCTCCCTCGCCAGCGTCTCCGGCTTCAGCCTCCTCGTACGTCGTCATCG

[0034] CATATCCTGATTTCCCCACTCGTTCACGCGTCCTCGATTTGCTTATATCCATATTTGTTG

[0035] CCTGCGTGATTTGGTCTCATTGGATTAACTGTTTAGCACTTTAGCCAGAGAGGCACGTT

[0036] TCACGGTTTCAGATATTGTTCAATGTGGCGTTCAAATTTAGCAGTAGGAGGACAGGCA

[0037] AAAAGTTTAGCCGTACAAGCGGCTGGTTAGTTTGGAAGGGGGATTTTGATTGGAACAG

[0038] TGCCTAAAATTTTTGCTGGAATACTGTTTGAACATTTGGCGTGTTCCAAACATTCTGAA

[0039] ATAAATCATGGATATAGCATAGTAAGTAGCAGATTTTTTTTTTTTGGGTATACAAGTAG

[0040] CAGTTTGCAAACCTACAAAATTTAAAATCAACGTTCTCCTAAATATAGAGATAAATAA

[0041] CAAGTTACACTACTAGTCTACTACTCCACGCTGAATGCTTTTCTAGGATGAATTTTAAA

[0042] TTGCCTGCACAGATGGTGAGCTAGTCAATTGTCACGATTTCAACTAGCTTTCAGAATCT

[0043] GCGAAGTGTGTACAGCCTAGAGGACTACTTCGATACTCTGGCGAAATATTCTGTAGGA

[0044] TTTTTTTTTTTTACTTTTCTCTTCAGTTGTACACGGATTGCCTTTTTAGTTTGTGATCTTA

[0045] ATTTTGAAACCACCCATAATTTGAATTTTGAACTTGTAAAACAGGTTGGAATGGCAAGT

[0046] GGATTAGAAACTCTATGCGGTCAAGCTTATGGGGCAAAACAGTATGACAAGTTAGGAG

[0047] TGCAAACCTACAGAGCAATAGTCACACTAACAGTAGTCACAATTCCCATCTCACTTCTA

[0048] TGGGTATTCATAGGCAAACTCTTGACCCTAATAGGTCAGGACCCCGTGATCTCACATGA

[0049] AGCTGGAAGATACATAGTGTGGTTGATTCCAGGACTCTTCGCATACGCGGTCTGCCAG

[0050] CCTCTCACAAAATTTCTGCAGTCTCAGAGTCTAATATTTCCCATGCTCTGGTCCTCCATT

[0051] GCAACTCTGCTCCTGCACATCCCTCTGTCTTGGCTGTTGGTGTTCAAGACCAGCATGGG

[0052] ATTTACTGGAGCTGCTTTAGCAATTAGCATATCTTACTGGTTGAATACATTCATGCTCG

[0053] CTGCATACATCAGATTCTCATGTTCTTGTAAGGTGACTCGCTCGCCTCCTACAATCGAG

[0054] GCATTCAGAGGAGTCGGTTTGTTTCTGCGAATAGCACTACCATCTGCACTAATGTTATG

[0055] GTAATTACAGTAGCTTCAGAATCTCCTTGTTTTATATGTAAGTATTTCTTATTTCCTGTT

[0056] AAAAAATTCCCACTTATTGGATTAATGGATTTTCTTCTATTATTTTGTAGTTTTGAATGG

[0057] TGGTCATTTGAGATCCTTGTTCTCCTGTCAGGACTTCTACCCAACCCAGAGCTTGAAAG

[0058] TTCAGTTCTTTCCATATGGTAAGAAAATAAGAGTCCTCAATGTCGCACTTAACAATATA

[0059] TTCTCTTATAGCTGCACCTTTTGTTATTTTATAAGCACTCCATTTATGCAGCTTGACGAC

[0060] TACCTCTTTGATGTATACTATACCATATGGTCTTGGAGGCGCTGCAAGGTAGAAGCCAA

[0061] ACCACTACTGTGAATGATTATTTTTTCTCAGAGAATAATCATGTGTTAACAGCCTTGTG

[0062] AATTTTGTTTTAATGAACAGCACTCGAGTAGCAAATGAGTTAGGCGCTGGGAATCCTG

[0063] AAGGAGCTCGATCGGCTGTTCACCTTGTAATGTCTATTGCTGGACAGAGGCAGTTCTTT

[0064] GTTACTGGGATGCTGTTTGCAGCACAGCGCATCTTGGGCTATGCTTACAGCAGTGATGA

[0065] GGAGGTTGTCACATATTTCACCTCAATGGTTCCTTTTGTGTGCATCTCAGTTGCTGCTGA

[0066] TAGCCTACAAGGAGTTTATCAGGTTACATTTCCTAACATTTGATTTATCTGTTAATTAT

[0067] TCATTCCCTTCAAAAGAATGGAAAAATGGAGTATTCAGCTATGCCTGAAGTTTTCGA

[0068] AAATTTGATCTAACTGGCCTTGCCTCTCTCTTATTTCATTTTTTTTATATAACTGGTTCTT

[0069] ATAGTTTTGGGGCCATTACATTTACACCATTCAGTATCTTTAGCCTGTTAGCCCAACGG

[0070] TATCTTTTACCCCTTAGTTTGATTGCTTAATTCAATGTGTGCGCTGTTGTCAAATCTCTTA

[0071] CCAAGACCTCAGGTAGCAAGTTAATTTCAGTCACTCCGGTATCGTAAAGACATACCAG

[0072] GTAACTTGCCGCTTCTTGTTTTTCCTTTGTCAATGAAACTAATGCTATTTTGTGTTGTG

[0073] GAGGCCGACATTGTTACTCGGGGAGTTACCTGTTTGTTCCTTCAAACATGTGCTCTTAC

[0074] GTGAACATGGATATGGTGGTGTTTACAATCAACACGCATCTATCAGCGATGTCGTCTTA

[0075] AGTGTGGACTCCACTTCACTAAGTATGCAATTACACCTTTCCCCTGGCTAGTGGTAGAC

[0076] TGGTAGTGTGGCACTGGTGTTTGCTTCACAGGTCTATTTCATTGTTTGTGCTTCTGAGCA

[0077] GTTGTGGACATGCCAAAAACAATGAACTGAACTTGCGAAAACACACATCTCATTCAGC

[0078] TCCAGCACGGAAACATACTATTGTTTCTCCTCTCTAGAAGATTATATCAAGATAGATGC

[0079] ACCACACGTCATTGCTTAACACTGACAGATATTACTTGTTATCAGGTATTGCTCGGGGT

[0080] TGCGGATGGCAGCACCTGGGAGCCTATGTAAACCTCGGTTCATTCTACCTGGTTGGCAT

[0081] TCCGGTAGCCCTACTTCTTGGCTTTGGTTTCAAGATGGAAGGCAAAGGGCTTTGGCTGG

[0082] GCATCGCCTGTGGTTCCGTATTACAATTCTTGCTTCTCGCCGTCATTGCATTCTTCAGCA

[0083] ACTGGCAAAAGATGGTTTGTTTCTTTATCTGAAACTCCAAGCCTTCTCCCCAACATCAT

[0084] CAAATCTTGATCACTCGAAAACTGAATCATGTTTCTCCCGCCTACTGACCTGATGCTGC

[0085] TTCTGCAGGCCGAGAAAGCGAGGGAGAGAATTTTCGGCGAGACACCGTCAGAGAAGC

[0086] AACATTTGGTGCTTGATGCAACGAATTCGGTCTGATTCTGCATCCTGATCCGTTGACGC

[0087] GAACTGAAGCGGATGATCGGATCATGTGGAGGAGACTGGCTCCTCTGGATGTGTAGGG

[0088] AATCTGCTGAAGAAGTAAAGCAGTGTGCATAGTTGTACTGTTGCATTTGTTGGATCCGG

[0089] GAGAATGTATCAAGAACTCTATGTGAAATGTATGATGGCGATATGTATGTACGAGATC

[0090] GAGGTTCCGAATACTTCCAGCCTATAGAAGTATAGATAAATTTTCCACTCTTCGTGGAC

[0091] AGAAAGAATAAAAGGCTAATCTTCTCTCGGAAAATGAGGCTAACCTCTTCTGAATGAC

[0092] TTATCATAACTTCGCCAAATACCAAAAAAGGCTTTTTTTTTTTACATCATACAGCGTAA

[0093] TTACATATTTACATGTAATTGATGCATGATCAGGCATTCCAAGGATCACACTCCTTTTG

[0094] GCAAA

[0095] Table 1 Primer sequences for PCR amplification of OsMATE2 - YYCDS, ORF and Promoter

[0096]

[0097] The full length of the OsMATE2-YY CDS sequence is 1226 bp. Sequence alignment analysis revealed that there were two single nucleotide polymorphisms (SNPs) in the CDS sequence of OsMATE2-YY compared with Nipponbare. Figure 1 A), but the amino acid sequence is consistent with Nipponbare ( Figure 1 B).

[0098] 2 Construction of OsMATE2-YY overexpression and knockout strains

[0099] 2.1 Construction of overexpression vector and knockout vector

[0100] The CDS sequence of OsMATE2-YY was amplified using specific primers, which contained restriction enzyme sites BspH I and BstE II. After enzyme digestion and recombination, the target gene was inserted into the plant expression vector pCAMBIA1301 to obtain the OsMATE2-YY overexpression vector pCAMBIA1301::CaMV35S-OsMATE2-YY-NOS. At the same time, the OsMATE2-YY knockout site was designed using the CRISPR 2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the knockout site was introduced into the pHUE411 vector to construct the OsMATE2-YY CRISPR / Cas9 knockout vector pHUE411::OsMATE2-YY. The construction schematics are as follows: Figure 2 A and Figure 2 As shown in B.

[0101] 2.2 Agrobacterium-mediated genetic transformation of rice

[0102] Transformation experiments were performed using mature seeds of Yunyin. The surface was disinfected with 75% ethanol solution for 2 minutes, soaked in 2.5% sodium hypochlorite solution for 10-15 minutes, and finally rinsed with sterile water for 4-5 times. The sterilized mature seeds were inoculated on NMB medium for induction and induced for 3 weeks at 28°C under light (24-h light, L). After 3 weeks, the embryo shield formed dense primary callus with a size of 0.5-1 cm. These primary callus were peeled off and inoculated into new subculture medium, subcultured once every 10-15 days. After two subcultures, granular callus with bright yellow color, dense structure and a diameter of about 2-3 mm was selected for Agrobacterium EH105 transformation. The bacteria were washed with AAM liquid medium containing 100μmol / L acetosyringone to form a suspension of Agrobacterium, with OD600=0.2. The callus tissue was fully impregnated with the bacterial solution, and after being blown dry, the callus tissue was placed in a co-culture medium with 100 μmol / L acetosyringone and cultured in the dark at 28°C for 1 day. The callus tissue was transferred to a screening medium with 400 mg / L carbenicillin and 50 mg / L hygromycin and screened under light at 28°C. Starting from the second generation, resistant callus tissue gradually grew out of the shriveled and browned callus tissue. When it was large enough, it was transferred to a pre-differentiation medium. After 1 to 2 weeks of light culture at 28°C, green spots gradually appeared on the surface of the callus tissue. It was transferred to a differentiation medium and continued to be cultured under light until emergence. When the seedlings grew to 2 to 3 cm, they were transferred to a test tube containing a rooting medium. When the root system of the seedlings was well developed, they were removed, rinsed repeatedly with clean water, and placed in a nutrient solution for seedling hardening. The Hyg gene was amplified by PCR, and the positive individual plants were moved to the field for planting, and the seeds were harvested for subsequent experiments. The process of obtaining the two transgenic lines is as follows. Figure 2 As shown in C.

[0103] The transgenic plants were detected by hygromycin-specific primers, and the results showed that OE1, OE2, OE3, OE4, OE5 and OE6 were transgenic positive lines ( Figure 3 A). Subsequently, the expression of overexpressed OsMATE2-YY in transgenic positive lines was detected by qRT-PCR ( Figure 3 B), the results showed that the expression levels in OE1, OE2 and OE4 were more than 10 times higher than that in WT, so the present invention selected these three groups as experimental strains in subsequent experiments.

[0104] Specific sequencing primers were designed to sequence the knockout transgenic lines. The results showed that the two target sequences of OsMATE2-YY in the five knockout lines (Cr1, Cr2, Cr3, Cr4 and Cr5) were mutated ( Figure 4 ), the present invention selected Cr1, Cr2 and Cr3 strains for further analysis.

[0105] Example 2 Exploration and analysis of the effects of particle shape on the function of OsMATE2-YY

[0106] The OsMATE2-YY transgenic plants obtained in Example 1 were cultivated. The measured traits included rice grain length, grain width, grain thickness, volume, single grain mass and density. Ten plants were selected from each line, and 10 full grains were randomly selected from each plant. The grain length, grain width and grain thickness were measured with a vernier caliper (accurate to 0.01 mm), and the average value was taken as the phenotypic value of the trait. The volume of each grain was calculated according to the following formula:

[0107] Grain volume = grain length * grain width * grain thickness.

[0108] Use an electronic balance to weigh the weight of 100 full grains of each plant, take the average value, and convert it into the mass of a single grain. Calculate the density of each grain according to the following formula and take the average value:

[0109] Grain density = grain mass / volume per grain.

[0110] The measurement results are as follows Figure 5 shown.

[0111] The results showed that the grain shapes of both OE and Cr strains changed, and the trend of change was consistent ( Figure 5 A). Compared with WT, the seed length and width of OE and Cr strains increased, and the seed thickness decreased ( Figure 5 B, C, D). It can be seen that both upregulation and downregulation of OsMATE2-YY expression can affect grain shape.

[0112] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. OsMATE2-YY The application of gene in regulating rice grain shape is characterized by: The rice grain shape is regulated to make the rice grain length longer, the grain width wider, and the grain thickness smaller; OsMATE2-YY The nucleotide sequence of the gene is shown in SEQ ID No. 1; the specific embodiment of the application is as follows: regardless of the OsMATE2-YY Whether the gene is up-regulated or down-regulated in rice, the length of rice grains becomes longer, the width becomes wider, and the thickness becomes smaller, and the rice variety is Yunyin.

2. An application of a biological material in making rice grains longer, wider and thinner, characterized in that: The biological material is capable of up-regulating or down-regulating OsMATE2-YY A recombinant vector or recombinant bacteria for gene expression; OsMATE2- YY The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the rice variety is Yunyin.

3. A method for cultivating a rice variety with longer grain length, wider grain width and smaller grain thickness, characterized in that: The method comprises: OsMATE2-YY In the step of up-regulating or down-regulating gene expression, the nucleotide sequence of the OsMATE2-YY gene is shown in SEQ ID No. 1, and the recipient rice variety is Yunyin.

4. The use according to any one of claims 1 to 2 OsMATE2-YY The application of the gene, the biological material in the application described in claim 2 or the method described in claim 3 in rice breeding, wherein the rice variety is Yunyin, and the purpose of the breeding is to breed rice with longer grains, wider grains and smaller grains.

Images