A co-dominant molecular marker of potato long-day adaptation gene StCDF1.4 and application thereof

By developing codominant molecular markers and CAPS markers, the problem of difficulty in identifying the potato StCDF1.4 genotype in existing technologies has been solved, enabling rapid and accurate genotype identification and simplifying the breeding process, reducing breeding costs, and making it suitable for potato breeding and germplasm resource screening.

CN118374627BActive Publication Date: 2025-11-11AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410589473.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-13
Publication Date
2025-11-11
Estimated Expiration
2044-05-13

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately identify the StCDF1.4 genotype in potato germplasm, and the breeding process is affected by environmental factors and lacks efficient molecular markers, resulting in high breeding costs and long cycles.

Method used

A pair of codominant molecular marker primers (CDF1.4-prom F/R) were developed to distinguish StCDF1.4 from other StCDF1 alleles. Combined with CAPS markers, the StCDF1.6 genotype was detected. By utilizing promoter sequence deletion features and enzyme digestion analysis, rapid and accurate genotype identification was achieved.

Benefits of technology

This method enables efficient and accurate identification of the potato StCDF1.4 genotype, simplifies the breeding process, reduces costs, and is suitable for large-scale commercial breeding and germplasm resource screening, thus shortening the breeding cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118374627B_ABST
    Figure CN118374627B_ABST
Patent Text Reader

Abstract

The application relates to a co-dominant molecular marker of a potato long-day adaptation gene StCDF1.4 and application thereof. The molecular marker can identify a StCDF1.4 homozygous or heterozygous genotype alone, and makes up the shortcoming that an existing molecular marker can distinguish StCDF1.4 genotype types only by combining multiple pairs of primers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to a codominant molecular marker of the potato long-day adaptation gene StCDF1.4 and its application, belonging to the field of molecular biology technology. Background Technology

[0002] Seasonal fluctuations in day length are the most important environmental factor affecting potato tuber formation. Originating in low-latitude regions near the equator, the wild type of potato is extremely sensitive to photoperiod, producing tubers under strict short-day conditions but not under long-day conditions. StCDF1 is a key gene regulating tuber formation and growth period in potatoes under long-day conditions. Four StCDF1 alleles have been identified in potatoes: StCDF1.1, StCDF1.2, StCDF1.3, and StCDF1.4. Among them, the StCDF1.4 genotype is the most widely distributed in long-day adapted potato cultivars, suggesting that StCDF1.4 has extremely high breeding value.

[0003] However, because alleles StCDF1.1, StCDF1.2, StCDF1.3 and StCDF1.4 are very similar, especially StCDF1.2 and StCDF1.4 which insert the same number of bases at the same position (7 bases each), it is currently only possible to determine whether a potato variety contains the StCDF1.4 genotype through multiple primer combinations and tedious analysis. There has been a lack of effective molecular markers for identifying the StCDF1.4 genotype.

[0004] Furthermore, different StCDF1 genotypes exhibit varying latitudinal ecological adaptability and growth periods. Discovering new natural variations and identifying new StCDF1 genotypes would enrich potato breeding resources and better address the challenges of rapidly changing climate environments. Summary of the Invention

[0005] To address the shortcomings of existing molecular markers, this application provides a co-dominant molecular marker for the potato long-day adaptation and growth period gene StCDF1.4. Only a single pair of primers is needed to quickly identify and screen potato germplasm with the StCDF1.4 allele. The identification work is time-saving and labor-saving, and is not affected by environmental factors, and is accurate and reliable.

[0006] In addition, this application also provides a novel gene, StCDF1.6, whose mutant genotype was found in the potato cultivar Omasu 5 and is a natural variation. Specifically:

[0007] First, this application provides the promoter sequence of StCDF1.4, and then develops a pair of efficient and stable codominant molecular markers to distinguish StCDF1.4 from other StCDF1 alleles. This molecular marker overcomes the limitation of existing molecular markers that require multiple primer pairs to distinguish StCDF1.4 genotypes.

[0008] (1) This application provides the promoter sequence of StCDF1.4 for the first time, and discovers for the first time that the promoter of StCDF1.4 is missing 623bp compared with the promoters of StCDF1.1, StCDF1.2 and StCDF1.3.

[0009] (2) This application developed a pair of efficient and stable codominant molecular markers (marker primers are CDF1.4-prom F / R) that can distinguish StCDF1.4 from other StCDF1 alleles. This molecular marker can identify the homozygous or heterozygous genotype of StCDF1.4, which overcomes the shortcomings of existing molecular markers that require multiple primer pairs to distinguish the genotype of StCDF1.4.

[0010] (3) The amplification products of the molecular marker (marker primer is CDF1.4-prom F / R) provided in this application have large differences in the size of the characteristic bands. The presence of the StCDF1.4 gene and its genotype can be determined by agarose gel electrophoresis. The identification cost is low, the efficiency is high, no enzyme digestion is required, the operation is simple, and the breeding cycle of potato germplasm for long-day adaptation and growth period traits can be shortened, effectively reducing the breeding cost.

[0011] (4) When using the molecular markers (marker primers are CDF1.4-prom F / R) provided in this application for assisted breeding, it is possible to achieve accurate and efficient detection of the StCDF1.4 genotype of the progeny, and at the same time achieve non-destructive detection of potato seedlings. It is suitable for large-scale screening of the StCDF1.4 genotype in commercial large-scale breeding and identification of the StCDF1.4 allele in potato germplasm resources.

[0012] Secondly, this application provides a novel mutant allele of potato StCDF1, StCDF1.6, and its sequence, and further develops a CAPS marker to identify StCDF1.6.

[0013] (1) This application is the first to discover a new allele StCDF1.6 for potato long-day adaptation and growth period, which adds to the StCDF1 genotype polymorphism adapted to different latitudes in this field.

[0014] (2) This application is the first to verify the function of StCDF1.6 in promoting tuber formation under long-day conditions through transgenic experiments, which enriches the breeding selection of long-day adaptability genes.

[0015] (3) This application developed a pair of CAPS molecular markers for detecting the StCDF1.6 genotype. The markers are highly accurate and specific, and can quickly screen and genotype the materials to be tested. They have broad application prospects in potato photoperiod breeding and molecular marker-assisted breeding.

[0016] Finally, this application provides a kit that can simultaneously detect StCDF1.4 and StCDF1.6, which can greatly facilitate the selection of long-day adapted potato germplasm and molecular marker-assisted breeding. Attached Figure Description

[0017] Figure 1 Alignment diagram of StCDF1.1-1.4 promoter sequences in Example 1.

[0018] Figure 2 Agarose gel electrophoresis detection image of PCR amplification products in Example 3.

[0019] Figure 3 Image of StCDF1.4 transgenic positive seedling in Example 5.

[0020] Figure 4 The StCDF1 allele sequence alignment diagram in Example 6.

[0021] Figure 5 Image of StCDF1.6 transgenic positive seedling in Example 7.

[0022] Figure 6 Example 8 shows the yeast double hybridization experiment of StCDF1.6 with StFKF1 and StGI.

[0023] Figure 7 The polyacrylamide gel electrophoresis detection image of the enzyme digestion product in Example 10. Detailed Implementation

[0024] This application provides a reagent or kit, including a formulation for detecting whether there is a large fragment deletion in the promoter of potato StCDF1.

[0025] In some implementations, potato StCDF1 is StCDF1.1, StCDF1.2, StCDF1.3, StCDF1.4 and / or StCDF1.6.

[0026] In some implementations, the agent used to detect whether the potato StCDF1 promoter has a large deletion is primer pair A:

[0027] CDF1.4-prom F:TGATATTATCATTTTGCCT;

[0028] CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT.

[0029] In some embodiments, the reagent or kit further includes primer pair B for detecting StCDF1.6:

[0030] StCDF1.6-CAPS F:TCACAATCACGGAGAAGAGA;

[0031] StCDF1.6-CAPS R: CTAGTGTTGACCATATAGAG.

[0032] This application provides a promoter, characterized in that the sequence of the promoter is shown in SEQ ID NO 1.

[0033] This application provides a molecular marker primer pair, the sequence of which is:

[0034] CDF1.4-prom F:TGATATTATCATTTTGCCT;

[0035] CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT.

[0036] This application provides the use of the aforementioned reagents or kits, promoters, or molecular marker primer pairs in the identification of potato StCDF1.4.

[0037] In some implementations, identifying potato StCDF1.4 includes determining whether the potato contains the StCDF1.4 gene, or identifying the StCDF1.4 homozygous or heterozygous genotype.

[0038] This application provides the use of the aforementioned reagents or kits, promoters, or molecular marker primer pairs in potato-assisted breeding or variety improvement.

[0039] In some implementations, potato-assisted breeding or variety improvement includes marker-assisted breeding of potato long-day adapted or early, mid, and late-maturing varieties; screening of potato long-day adapted or early, mid, and late-maturing germplasm resources; or identification of potato long-day adapted or growth period traits.

[0040] This application provides a reagent or kit, including primer pair A for detecting StCDF1.4 and / or primer pair B for detecting StCDF1.6; wherein primer pair A for detecting StCDF1.4 is:

[0041] CDF1.4-prom F:TGATATTATCATTTTGCCT;

[0042] CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT;

[0043] The primer pair B for detecting StCDF1.6 is:

[0044] StCDF1.6-CAPS F:TCACAATCACGGAGAAGAGA;

[0045] StCDF1.6-CAPS R: CTAGTGTTGACCATATAGAG.

[0046] This application provides a StCDF1.6 gene, characterized in that the nucleic acid sequence of the gene is shown in SEQ ID NO.2.

[0047] This application provides a StCDF1.6 protein, characterized in that the amino acid sequence of the protein is shown in SEQ ID NO.4.

[0048] This application provides a coding sequence for the StCDF1.6 protein of claim 12. In some embodiments, the sequence is as shown in SEQ ID NO.3.

[0049] This application provides a molecular marker primer pair, the sequence of which is:

[0050] StCDF1.6-CAPS F:TCACAATCACGGAGAAGAGA;

[0051] StCDF1.6-CAPS R: CTAGTGTTGACCATATAGAG.

[0052] This application provides the use of the above primer pairs in identifying the StCDF1.6 gene or StCDF1.6 protein.

[0053] This application provides the use of the above primer pairs in screening or identifying potato germplasm containing StCDF1.6.

[0054] This application provides the use of the above primer pairs in potato-assisted breeding or variety improvement.

[0055] In some implementations, potato-assisted breeding involves marker-assisted breeding of potato varieties adapted to long-day conditions or early, mid, and late maturing varieties.

[0056] This application provides a method for producing potatoes with long-day adaptation and a long growth period by overexpressing the StCDF1.6 protein in potatoes.

[0057] This application further illustrates the invention through the following embodiments, but any embodiment or combination thereof should not be construed as limiting the scope or implementation of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available.

[0058] Example 1: Cloning of the potato StCDF1.4 gene and development of codominant molecular markers located in the promoter region

[0059] The inventors performed genome resequencing (100X) on 18 potato cultivars with large cultivation areas in China to identify the StCDF1 alleles and their copy numbers. The results are shown in Table 1. We found that among the 18 identified potato cultivars, the mutant allele StCDF1.4 was present in 14 cultivars (77.8%), StCDF1.3 in 8 cultivars (44.4%), and StCDF1.2 in 2 cultivars (11.1%). We collected the growth periods of the 18 cultivars and found that StCDF1.3 was prevalent in early-maturing cultivars, while StCDF1.4 was present in both early- and late-maturing cultivars (see Table 1).

[0060] Table 1. StCDF1 allele identification of potato cultivars with the largest planting area in China.

[0061]

[0062] Subsequently, we cloned the full-length gene sequence (including promoter, exons, introns, and terminator) of StCDF1.4 from diploid potato germplasm C342 (StCDF1.1 / 1.4) for sequence analysis. The selected upstream primer sequence was located 2 kb upstream of the start codon (ATG), and the downstream primer sequence was located 855 bp downstream of the stop codon (TGA). The results showed that, in addition to a 7 bp insertion in the second exon (as previously reported), StCDF1.4's promoter region also contained a large chromosomal substitution (629 bp → 6 bp) at a position 672 bp from the start codon, a substitution that had never been previously reported. The promoter sequence of StCDF1.4 is shown in SEQ ID NO.1.

[0063] To determine whether this large chromosomal substitution in the promoter region was unique to StCDF1.4, the inventors cloned the promoter sequence of StCDF1.1 from diploid potato germplasm C342 (StCDF1.1 / 1.4), and the promoter sequences of StCDF1.2 and StCDF1.3 from diploid potato germplasms C894 (StCDF1.1 / 1.2) and C337 (StCDF1.1 / 1.3), respectively. The promoter sequence of StCDF1.4 was then compared with those of StCDF1.1, StCDF1.2, and StCDF1.3. The results showed that the large chromosomal substitution at a position 672 bp from the start codon in the promoter region was unique to StCDF1.4. This substitution resulted in a 623 bp deletion in the StCDF1.4 promoter compared to the promoters of StCDF1.1, StCDF1.2, and StCDF1.3 (e.g., ...). Figure 1 (As shown).

[0064] The potato genome sequence has been published. Although many genes have been annotated, the start and end positions and functions of a large number of genes, either in their full or partial sequences, remain undetermined, such as hypothetical proteins in genome annotation. Regarding the four alleles of StCDF1, the currently known information is as follows: StCDF1.1 encodes a full-length protein; StCDF1.2 has a 7 bp (CCACTAG) insertion in the coding region of exon 2; StCDF1.4 also has a 7 bp insertion (GTATCCC) at the same position; and StCDF1.3 has an 865 bp transposon insertion. These variations result in frameshift mutations in StCDF1.2-1.4. Existing research has mainly focused on the aforementioned known mutations, but has never found a significant difference between StCDF1.4 and StCDF1.1, StCDF1.2, and StCDF1.3 in the promoter region. Moreover, this difference is not just a difference or deletion of a few bases, but rather a large segment deletion. Based on this unexpected discovery, the inventors developed a pair of codominant molecular markers that can distinguish StCDF1.4 from other StCDF1 alleles. The primer sequence of the marker (CDF1.4-promF / R) is as follows:

[0065] CDF1.4-prom F:TGATATTATCATTTTGCCT

[0066] CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT.

[0067] Example 2: Genotyping method of the potato long-day adaptation and growth period gene StCDF1.4

[0068] (1) Extract genomic DNA from the potato to be tested;

[0069] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed on the template using StCDF1.4 primers; the primer sequences are as follows:

[0070] CDF1.4-prom F:TGATATTATCATTTTGCCT

[0071] CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT

[0072] (3) PCR reaction system (10 μL): 5 μL Green Mix, 2 primers (10 μL each)

[0073] Each of the following was added: 0.5 μL of DNA template (μM) and 0.5 μL of ddH2O.

[0074] (4) The PCR reaction conditions are as follows: pre-denaturation at 94-98℃ for 3-10 minutes; denaturation at 94-98℃ for 10-30 seconds, annealing at 52-60℃ for 10-30 seconds, extension at 72℃ for 30-60 seconds, for a total of 25-35 cycles; extension at 72℃ for 3-10 minutes. Preferably, pre-denaturation at 95℃ for 3 minutes, denaturation at 95℃ for 30 seconds, annealing at 55℃ for 15 seconds, extension at 72℃ for 30 seconds, for a total of 30 cycles; extension at 72℃ for 5 minutes.

[0075] (5) The amplification products were analyzed by agarose gel electrophoresis. If the amplification products showed a characteristic band of 173bp and no band of 796bp, the potato to be tested was determined to be a homozygous genotype of StCDF1.4. If the amplification products showed a characteristic band of 796bp and no band of 173bp, the potato to be tested was determined to be a non-StCDF1.4 genotype. If both 173bp and 796bp bands were observed, the potato to be tested was determined to be a heterozygous genotype of StCDF1.4.

[0076] Example 3: Identification of StCDF1.4 codominant molecular markers in potato germplasm

[0077] The codominant molecular marker StCDF1.4 (CDF1.4-prom F / R) is located in the StCDF1 promoter region on potato chromosome 5. The characteristic band for amplification of StCDF1.1, StCDF1.2, and StCDF1.3 was 796 bp, while the characteristic band for amplification of StCDF1.4 was 173 bp. To verify the prevalence of the 623 bp deletion of the StCDF1.4 promoter in potato germplasm, 16 potato cultivars were selected for detection of the StCDF1.4 codominant molecular marker. Of these, 14 cultivars contained StCDF1.4, and 2 did not (see Table 2). The identification results are as follows: Figure 2 As shown, all materials containing StCDF1.4 exhibit a 173bp characteristic band, while materials not containing StCDF1.4 only exhibit a 796bp characteristic band. Heterozygous StCDF1.4 materials contain both 173bp and 796bp bands. This demonstrates that the 623bp deletion of the StCDF1.4 promoter is prevalent in various potato germplasm resources, meaning that the molecular marker or molecular marker primers described in this application can be widely applied to the identification of the StCDF1.4 genotype in potatoes.

[0078] Table 2 shows the cultivars used to validate the CDF1.4-prom F / R molecular marker.

[0079]

[0080]

[0081] Example 4: Application of StCDF1.4 co-dominant molecular markers in marker-assisted breeding and variety improvement of potatoes.

[0082] Marker-assisted breeding and variety improvement of potatoes are routine methods in this field. Potato diploid D6 is a highly homozygous inbred line with advantages such as a long dormancy period and good fertility. However, it does not produce tubers under long-day conditions (StCDF1.1 / 1.1), limiting its widespread adoption in the main potato-producing areas of northern my country. As an example, to select varieties with superior traits such as long-day tuber formation, long dormancy period, and good fertility, the inventors used C342 (StCDF1.1 / 1.4) as the male parent and potato diploid D6 as the female parent for hybridization. The F1 generation and backcross populations were screened for the StCDF1.4 genotype using the StCDF1.4 co-dominant molecular marker, resulting in accelerated breeding cycles and variety improvement of the D6 inbred line.

[0083] Example 5: StCDF1.4 promotes tuber formation under long-day conditions

[0084] We constructed a recombinant plasmid using the full-length StCDF1.4 gene (including promoter, exons, introns, and terminator) and the PCAMBIA2300 vector, and transformed it into a Qingshu No. 9 background. We then initiated StCDF1.4 expression using the StCDF1.4 promoter. Transgenic positive seedlings and the control Qingshu No. 9 were grown under induced long-day conditions (16h light / 8h dark). After 36 days of growth under supplemental lighting in a greenhouse, the StCDF1.4 transgenic positive seedlings had clearly formed tubers, while the control Qingshu No. 9 had not yet formed tubers. Figure 3 As shown, this indicates that StCDF1.4 can promote tuber formation in potatoes under long-day conditions.

[0085] Example 6: Discovery of the StCDF1.6 allele

[0086] The commercial potato variety E'ma shu 5 is a mid-to-late maturing variety with a growth period of 94 days. DNA was extracted from the leaves of E'ma shu 5 and subjected to genome resequencing at a sequencing depth of 100x. Three StCDF1 haplotypes were found in E'ma shu 5. Haplotype 1 is StCDF1.1, which exists in two copies in E'ma shu 5; haplotype 2 is StCDF1.4 (an insertion of 7 bases GTATCCC was identified); haplotype 3 has a deletion of one base C at the second exon, and this haplotype has never been reported before. Therefore, we named the allele containing the C base deletion StCDF1.6.

[0087] StCDF1.6 undergoes a frameshift mutation due to the deletion of the C base in its coding region, resulting in a truncated protein and the absence of the domain binding to StFKF1. Therefore, the inventors hypothesize that StCDF1.6 possesses the function of tuber formation under long-day conditions. The gene sequence of StCDF1.6 is shown in SEQ ID NO.2, the CDS sequence is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4. The nucleic acid sequence alignment of StCDF1.6 with other StCDF1 alleles is shown in the figure below. Figure 4 As shown.

[0088] Example 7: Verification of the long-day adaptability of StCDF1.6

[0089] The full-length gene sequence of the potato variety StCDF1.6 (Emashan No. 5), including the promoter (2229 bp), exons, introns, and terminator (1019 bp), was cloned and used to construct a recombinant plasmid with the pCAMBIA2300 vector. This plasmid was then transformed into the genetic background of the Qingshu No. 9 variety. After 39 days of growth under artificial long-day conditions (16h light / 8h dark), the StCDF1.6 transgenic seedlings produced tubers, while the Qingshu No. 9 plants did not. Figure 5As shown, this indicates that StCDF1.6 can promote tuber formation under long-day conditions.

[0090] Example 8: StCDF1.6 lost the domain that was bound to StFKF1.

[0091] StCDF1.6 undergoes a frameshift mutation due to the deletion of a C base, leading to premature protein termination and the loss of its binding domain to StFKF1. The inventors further hypothesized that StCDF1.6 cannot interact with StFKF1. To verify this, recombinant vectors were constructed using StCDF1.1 and StCDF1.6 with pGADT7, and recombinant vectors were constructed using StFKF1, StGI, and pGBKT7, which were then transformed into yeast. The results showed that StCDF1.6 cannot interact with StFKF1 but can interact with StGI (see...). Figure 6 ).

[0092] Example 9: Development of CAPS molecular markers based on StCDF1.6 and its genotyping method

[0093] The inventors discovered that the deletion of the C base in the coding region of StCDF1.6 occurs precisely at the Bcl-I restriction site, and therefore developed the CAPS molecular marker. The primer sequences are shown below:

[0094] StCDF1.6-CAPS F:TCACAATCACGGAGAAGAGA

[0095] StCDF1.6-CAPS R: CTAGTGTTGACCATATAGAG

[0096] The genotyping method is as follows:

[0097] (1) Extract genomic DNA from the potato to be tested;

[0098] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification of the template was performed using the StCDF1.6CAPS molecular marker primers (StCDF1.6-CAPS F / StCDF1.6-CAPS R);

[0099] (3) The amplification products were analyzed by agarose gel electrophoresis.

[0100] (4) The amplification product was digested with Bcl-I restriction endonuclease.

[0101] (5) Polyacrylamide gel electrophoresis was used to analyze the enzyme digestion products.

[0102] Preferably, polyacrylamide gel electrophoresis is used to analyze the enzyme digestion products, and the genotype is determined based on the band type of the enzyme digestion products detected by electrophoresis.

[0103] The PCR reaction conditions for step (2) are as follows: pre-denaturation at 94-98℃ for 3-10 minutes; denaturation at 94-98℃ for 10-30 seconds, annealing at 52-60℃ for 10-30 seconds, extension at 72℃ for 30-60 seconds, for a total of 25-35 cycles; extension at 72℃ for 3-10 minutes. Preferably, pre-denaturation at 95℃ for 3 minutes, denaturation at 95℃ for 30 seconds, annealing at 55℃ for 15 seconds, extension at 72℃ for 30 seconds, for a total of 30 cycles; extension at 72℃ for 5 minutes. PCR reaction system (10μL): 5μL Green Mix, 0.5μL each of the two primers (10μM), 1μL DNA template, 3μL ddH2O.

[0104] If a 127bp and / or 126bp band appears in step (3), then the enzyme digestion in step (4) can be performed.

[0105] The enzyme digestion system (5 μL) for step (4) consisted of: 2 μL of the PCR product from step (2), 0.5 μL of BclⅠ, 1 μL of rCut Smart, and 1.5 μL of dd H2O. The enzyme digestion reaction was carried out at 37°C for 30 minutes.

[0106] Step (5) is as follows: if two bands of 84bp and 42bp appear, the potato to be tested is determined to be of the StCDF1.6 genotype; if three bands of 127bp, 84bp and 42bp appear, it is determined to be of the StCDF1.6 heterozygous genotype; if one band of 127bp appears, it is determined to not contain the StCDF1.6 genotype.

[0107] Example 10: Application of the CAPS molecular marker StCDF1.6 in the breeding of long-day adapted diploid potato germplasm.

[0108] Using Emashan No. 5 as the female parent and PL4, an inducible line with haploid induction ability, as the male parent, haploid-induced hybridization experiments were conducted on Emashan No. 5. Leaf DNA was extracted from the F1 generation and PCR amplified using the CAPS molecular marker of StCDF1.6 (StCDF1.6-CAPS F / StCDF1.6-CAPS R). The amplified bands were digested with Bcl-I restriction endonuclease, and the digestion products were analyzed by polyacrylamide gel electrophoresis. Figure 7As shown, lane 1 represents E'malushu 5, with three bands of 127bp, 84bp, and 42bp, indicating a heterozygous StCDF1.6 genotype; lane 2 represents PL4, with only a 127bp band, and does not contain the StCDF1.6 genotype; lanes 3, 5, 6, 8, 9, and 10 represent the F1 generation containing the StCDF1.6 genotype, while lanes 4, 7, 11, and 12 represent the F1 generation not containing the StCDF1.6 genotype. The F1 generation containing the StCDF1.6 genotype was then subjected to diploid identification to screen for diploid potato germplasm containing the StCDF1.6 genotype.

[0109] This application has made every effort to describe the inventive concept and evidence of its effects. The scope of this application is defined by the appended claims, and those skilled in the art will clearly understand the scope defined by the claims based on this specification and common knowledge in the field. Without departing from the spirit and scope of this application, those skilled in the art can make any modifications or changes to the technical solution of this application, and such modifications and changes are also included within the scope of this application.

Claims

1. A reagent kit, characterized in that, This includes a formulation for detecting the presence or absence of large fragment deletions in the promoter of potato StCDF1; the formulation is primer pair A: CDF1.4-prom F:TGATATTATCATTTTGCCT; CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT; After amplifying the potato genome using the primer pair A, materials containing StCDF1.4 all had a 173bp characteristic band, materials not containing StCDF1.4 only had a 796bp characteristic band, and materials heterozygous for StCDF1.4 had both 173bp and 796bp bands; only the promoter of StCDF1.4 had a large fragment deletion.

2. The kit according to claim 1, characterized in that, Potato StCDF1 is StCDF1.1, StCDF1.2, StCDF1.3, StCDF1.4 and / or StCDF1.

6.

3. The kit according to claim 1 or 2, characterized in that, It also includes a primer pair B for detecting StCDF1.6: StCDF1.6-CAPS F:TCACAATCACGGAGAAGAGA; StCDF1.6-CAPS R: CTAGTGTTGACCATATAGAG.

4. The use of the kit according to any one of claims 1-3 in the identification of potato StCDF1.4; characterized in that, After amplifying the potato genome using the primer pair A, materials containing StCDF1.4 all had a 173bp characteristic band, materials not containing StCDF1.4 only had a 796bp characteristic band, and materials heterozygous for StCDF1.4 contained both 173bp and 796bp bands.

5. The use as described in claim 4, characterized in that, The identification of potato StCDF1.4 includes determining whether the potato contains the StCDF1.4 gene, or identifying the StCDF1.4 homozygous or heterozygous genotype.

6. The use of the kit according to any one of claims 1-3 in potato-assisted breeding or variety improvement; characterized in that, After amplifying the potato genome using the primer pair A, materials containing StCDF1.4 all had a 173bp characteristic band, materials not containing StCDF1.4 only had a 796bp characteristic band, and materials heterozygous for StCDF1.4 contained both 173bp and 796bp bands.

7. The use as claimed in claim 6, characterized in that, The potato-assisted breeding or variety improvement includes molecular marker-assisted breeding of potato long-day adapted or early, medium, and late-maturing varieties; screening of potato long-day adapted or early, medium, and late-maturing germplasm resources; or identification of potato long-day adapted or growth period traits.

8. A reagent, characterized in that, This includes a formulation for detecting the presence or absence of large fragment deletions in the promoter of potato StCDF1; the formulation is primer pair A: CDF1.4-prom F:TGATATTATCATTTTGCCT; CDF1.4-prom R:GTAGAAAGGTGGATTAGAAT; After amplifying the potato genome using the primer pair A, materials containing StCDF1.4 all had a 173bp characteristic band, materials not containing StCDF1.4 only had a 796bp characteristic band, and materials heterozygous for StCDF1.4 had both 173bp and 796bp bands; only the promoter of StCDF1.4 had a large fragment deletion.

9. The reagent as described in claim 8, characterized in that, Potato StCDF1 is StCDF1.1, StCDF1.2, StCDF1.3, StCDF1.4 and / or StCDF1.

6.

10. The reagent as described in claim 8 or 9, characterized in that, It also includes a primer pair B for detecting StCDF1.6: StCDF1.6-CAPS F:TCACAATCACGGAGAAGAGA; StCDF1.6-CAPS R:CTAGTGTTGACCATATAGAG.

11. The use of the reagent according to any one of claims 8-10 in the identification of potato StCDF1.4; characterized in that, After amplifying the potato genome using the primer pair A, materials containing StCDF1.4 all had a 173bp characteristic band, materials not containing StCDF1.4 only had a 796bp characteristic band, and materials heterozygous for StCDF1.4 contained both 173bp and 796bp bands.

12. The use as described in claim 11, characterized in that, The identification of potato StCDF1.4 includes determining whether the potato contains the StCDF1.4 gene, or identifying the StCDF1.4 homozygous or heterozygous genotype.

13. The use of the reagent according to any one of claims 8-10 in potato-assisted breeding or variety improvement; characterized in that, After amplifying the potato genome using the primer pair A, materials containing StCDF1.4 all had a 173bp characteristic band, materials not containing StCDF1.4 only had a 796bp characteristic band, and materials heterozygous for StCDF1.4 contained both 173bp and 796bp bands.

14. The use as claimed in claim 13, characterized in that, The potato-assisted breeding or variety improvement includes molecular marker-assisted breeding of potato varieties adapted to long-day conditions or early, medium, and late maturing varieties; screening of potato germplasm resources adapted to long-day conditions or early, medium, and late maturing varieties; Or to identify potato's long-day adaptation or growth period traits.

Citation Information

Patent Citations

  • Molecular marker for identifying characters of potatoes in growth period and application of molecular marker

    CN114517240A