tRF associated with breast cancer with diabetes and uses thereof

Abstract

The present application belongs to the technical field of molecular diagnosis, and particularly relates to a tRF related to breast cancer combined with diabetes and application thereof. The tRF has a significantly decreased expression level in tumor tissues of breast cancer patients combined with diabetes, and has a significant difference from breast cancer not combined with diabetes, so that a detection reagent of the tRF can be prepared to prepare a kit for diagnosing and / or prognosticating breast cancer combined with diabetes. Further research results show that the tRF has a significant ability of inhibiting tumor activity of breast cancer cells combined with diabetes, so that a nucleotide sequence of the tRF and a promoter for promoting expression of the tRF can be used to prepare a medicine for preventing and / or treating breast cancer combined with diabetes, and have anticancer value.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and in particular relates to a tRF related to breast cancer combined with diabetes and its application. Background Art

[0002] The incidence of breast cancer (BC) has surpassed that of lung cancer (LC) to become the most common malignant tumor worldwide. Diabetes mellitus (DM) and cancer are two complex and increasingly prevalent chronic metabolic diseases, with growing evidence linking diabetes to cancer risk, treatment, and prognosis. Numerous clinical epidemiological studies have shown that diabetes is not only associated with an increased risk of breast cancer but also significantly correlated with poor breast cancer prognosis. Among breast cancer patients, those with a history of diabetes have a poorer prognosis.

[0003] Currently, breast cancer treatment options primarily depend on tumor type, lymph node stage, and hormone receptor expression. Treatment options include surgical resection, endocrine therapy, targeted therapies such as anti-HER2 (Human epidermal growth factor receptor-2), and chemotherapy. However, efficacy is still limited by chemotherapy resistance and distant metastasis, and the rate of recurrence remains high. Further exploration of the molecular mechanisms by which diabetes regulates breast cancer will hopefully lead to the discovery of effective biomarkers and new therapeutic targets, which are crucial for early diagnosis, treatment, and prognosis of the disease and represent a pressing goal in the field of research on breast cancer and diabetes.

[0004] tRNA-derived fragments (tRFs) are a new class of regulatory noncoding RNAs (sncRNAs) generated by the specific cleavage of mature or precursor transfer RNAs (tRNAs). Studies have shown that tRFs are broadly classified into five subtypes based on their length, cleavage site, and tRNA sequence alignment: tRF-5, tRF-3, tRF-2, tRF-1, and tRNA halves (tiRNAs). tRFs can influence breast cancer cell proliferation, migration, and invasion through signaling pathways such as FZD3 / Wnt / β-catenin and TGF-β1 / Smad3. However, research on the molecular mechanisms of tRFs is still in its infancy, and little is known about the target genes they act on. The potential therapeutic effects of tRFs, particularly for breast cancer and diabetes, remain to be further explored. Summary of the Invention

[0005] The present application aims to provide a tRF related to breast cancer combined with diabetes and an application thereof, and aims to solve the technical problem of providing a molecular marker related to breast cancer combined with diabetes.

[0006] To achieve the above-mentioned application purposes, the technical solutions adopted by the present application are as follows:

[0007] In a first aspect, the present application provides a tRF related to breast cancer combined with diabetes, wherein the nucleotide sequence of the tRF is shown as SEQ ID No. 1.

[0008] In a second aspect, the present application provides an application of a reagent for detecting tRF expression in the preparation of a kit for diagnosing and / or prognostic evaluation of breast cancer combined with diabetes; wherein the nucleotide sequence of the tRF is shown as SEQ ID No. 1.

[0009] In some embodiments, the reagent includes a primer pair for amplifying the tRF, and the nucleotide sequences of the primer pair are shown as SEQ ID No. 2 and SEQ ID No. 3.

[0010] In some embodiments, the kit includes an RNA extraction reagent, an RNA reverse transcription reagent, and a PCR amplification reagent; and / or,

[0011] The kit includes a negative control shown as SEQ ID No. 4.

[0012] In a third aspect, the present application provides a kit for diagnosing and / or prognostic evaluation of breast cancer combined with diabetes, wherein the kit contains a reagent for detecting tRF expression, and the nucleotide sequence of the tRF is shown as SEQ ID No. 1.

[0013] In some embodiments, the reagent includes a primer pair for amplifying the tRF, and the nucleotide sequences of the primer pair are shown as SEQ ID No. 2 and SEQ ID No. 3.

[0014] In some embodiments, the kit includes an RNA extraction reagent, an RNA reverse transcription reagent, and a PCR amplification reagent; and / or,

[0015] The kit includes a negative control shown as SEQ ID No. 4.

[0016] In a fourth aspect, the present application provides an application of a nucleotide sequence of a tRF and / or a promoter for promoting the expression of the tRF in the preparation of a drug for preventing and / or treating breast cancer combined with diabetes; wherein the nucleotide sequence of the tRF is shown as SEQ ID No. 1.

[0017] In a fifth aspect, the present application provides a drug for preventing and / or treating breast cancer complicated with diabetes, wherein the drug contains the nucleotide sequence of tRF and / or a promoter that promotes the expression of the tRF, and the nucleotide sequence of the tRF is shown in SEQ ID No. 1.

[0018] In some embodiments, the medicament further comprises a pharmaceutically acceptable carrier.

[0019] This application discovered a tRF (nucleotide sequence as shown in SEQ ID No. 1) related to the characteristics of breast cancer combined with diabetes through experimental analysis, thus providing a new target for a new program of personalized precision treatment of breast cancer combined with diabetes. The expression level of this tRF is significantly reduced in the tumor tissue of breast cancer patients with diabetes, which is significantly different from that of breast cancer without diabetes. Therefore, the detection reagent of this tRF can be used to prepare a kit for diagnosis and / or prognosis evaluation of breast cancer combined with diabetes; further research results show that this tRF has the ability to significantly inhibit the tumor activity of breast cancer cells combined with diabetes. Therefore, the nucleotide sequence of this tRF and the corresponding promoter that promotes the expression of this tRF can be used to prepare drugs for the prevention and / or treatment of breast cancer combined with diabetes, which has anti-cancer value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0021] Figure 1 This is a graph showing the expression of tRF-Cys-GCA-029 in breast cancer tissues with diabetes and breast cancer tissues without diabetes in Example 1 of the present application;

[0022] Figure 2 This is a graph showing the expression results of tRF-Cys-GCA-029 in breast cancer cell lines MDA-MB-231, MCF-7, BT-549, and T47D under different sugar concentration environments in Example 2 of the present application;

[0023] Figure 3 This is a graph showing the experimental results of tRF-Cys-GCA-029 overexpression inhibiting proliferation of MDA-MB-231 and MCF-7 cells at different glucose concentrations in Example 3 of the present application;

[0024] Figure 4This is a graph showing the experimental results of tRF-Cys-GCA-029 overexpression inhibiting the migration of MDA-MB-231 and BT-549 cells at different glucose concentrations in Example 3 of the present application;

[0025] Figure 5 This is a graph showing the results of overexpression of tRF-Cys-GCA-029 in MDA-MB-231 and MCF-7 cells inhibiting PRKCG expression in Example 4 of the present application;

[0026] Figure 6 This is a graph showing the results of re-promoting cellular lactate and pyruvate production after tRF-Cys-GCA-029 and PRKCG transfection into MDA-MB-231 and MCF-7 cells in Example 5 of the present application;

[0027] Figure 7 This is a graph showing the results of tRF-Cys-GCA-029 reducing PRKCG expression in Example 6 of the present application;

[0028] Figure 8 This is a graph showing the results of Example 7 of the present application showing that local injection of tRF-Cys-GCA-029 into the tumor reduced the growth of 4T1 mouse breast cancer cells in vivo in a mouse model of hyperglycemia combined with breast tumors. DETAILED DESCRIPTION

[0029] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0030] In this application, the term "and / or" describes the relationship between associated objects, indicating that three possible relationships exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0031] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. Some or all of the steps can be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0032] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The singular forms "a", "an", "the" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms unless the context clearly indicates otherwise.

[0033] The weight of the related components mentioned in the embodiment specification of the present application can not only refer to the specific content of each component, but also represent the weight ratio relationship between each component. Therefore, as long as the content of the related components in the embodiment specification of the present application is enlarged or reduced in proportion, it is within the scope disclosed in the embodiment specification of the present application. Specifically, the mass mentioned in the embodiment specification of the present application can be μg, mg, g, kg and other mass units commonly known in the chemical industry.

[0034] The terms "first", "second" are only for descriptive purposes and are used to distinguish the objects such as substances from each other, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. For example, without departing from the scope of the present application, the first XX can also be referred to as the second XX, and similarly, the second XX can also be referred to as the first XX. Therefore, the features defined with "first", "second" can explicitly or implicitly include one or more of the features.

[0035] In the embodiment of the present application, breast cancer with diabetes (BC-with DM, referred to as BC-DM) refers to the simultaneous occurrence of breast cancer and diabetes, and the corresponding patient is a breast cancer patient with diabetes; breast cancer without diabetes (BC-without DM) refers to the occurrence of breast cancer without diabetes, and the corresponding patient is a breast cancer patient without diabetes. As for breast cancer and diabetes, the commonly used clinical symptoms in medicine can be used for identification.

[0036] In-depth exploration of the molecular mechanism of diabetes regulating breast cancer is expected to discover effective biomarkers and new diagnosis and treatment targets, which is crucial for early diagnosis, treatment and prognosis of the disease, and is also an urgent goal in the field of breast cancer with diabetes. At present, the molecular mechanism of tRFs is still in its infancy, and the target genes of tRFs are poorly understood, and the potential therapeutic effect of tRFs needs to be further explored. Whether tRFs can regulate BC-DM and its mechanism have not been reported.

[0037] Warburg Effect enhances the conversion of pyruvate to lactate, and cells secrete lactate to the extracellular environment, which is the driving force for cell proliferation (enhancing glycolysis and cell cycle progression) and tumor invasiveness (invasiveness, anti-hypoxia, apoptosis, cytotoxicity drug resistance and tolerance to immune response). The regulatory mechanism of glycolysis is mainly limited to the influence of glycolytic enzyme metabolism genes on metabolism. Although glycolysis has been confirmed to be involved in the occurrence and development of breast cancer, the glucose metabolism of breast cancer patients with diabetes is still unknown, and the research on how high glucose concentration affects glycolytic effect is still less, and whether the glycolytic pathway regulates the mechanism of BC-DM needs further study.

[0038] Based on this, the present application embodiment discovered a tRF related to breast cancer combined with diabetes and its application, and the specific technical solution is as follows.

[0039] In a first aspect, an embodiment of the present application provides a tRF associated with breast cancer combined with diabetes. The tRF is named tRF-Cys-GCA-029, and the nucleotide sequence of tRF is shown in SEQ ID No. 1.

[0040] SEQ ID No. 1: 5'-CTGTGCTCCGGAGTTACCTCGTTTT-3'.

[0041] The tRF provided in the examples of this application has a significantly decreased expression level in tumor tissues of breast cancer patients with diabetes, which is significantly different from that of breast cancer without diabetes. Further analysis of the expression level of the tRF in cells cultured at 25mmol / L and 5mmol / L sugar concentrations showed that the expression of the tRF was upregulated at 5mmol / L sugar concentration compared to 25mmol / L sugar concentration. Therefore, the detection reagent of the tRF can be used to prepare a kit for the diagnosis and / or prognosis of breast cancer with diabetes. Moreover, based on the ability of the tRF to significantly inhibit the tumor activity of breast cancer cells with diabetes, the nucleotide sequence of the tRF and the corresponding promoter that promotes the expression of the tRF can be used to prepare a drug for the prevention and / or treatment of breast cancer with diabetes.

[0042] In a second aspect, an embodiment of the present application provides a use of a reagent for detecting tRF expression in the preparation of a kit for diagnosing and / or prognostic evaluation of breast cancer combined with diabetes; wherein the nucleotide sequence of tRF is shown as SEQ ID No. 1.

[0043] In some embodiments, the reagents include a primer pair for amplifying tRF, which can detect the expression level of tRF-Cys-GCA-029 in a biological specimen to diagnose and / or prognose breast cancer with diabetes; at the same time, it provides a basis for further studying the function of tRF-Cys-GCA-029 in breast cancer with diabetes and the development of drugs targeting tRF-Cys-GCA-029.

[0044] The nucleotide sequences of the primer pair for amplifying tRF are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0045] SEQ ID No.2:GCTGTGCTCCGGAGTTACCT;

[0046] SEQ ID No. 3: AGTGCAGGGTCCGAGGTATT.

[0047] In some embodiments, the kit includes an RNA extraction reagent, an RNA reverse transcription reagent, and a PCR amplification reagent; the RNA extraction reagent is used to extract RNA from a sample of tumor tissue of the patient to be tested, the RNA reverse transcription reagent is used to reverse transcribe the extracted RNA into cDNA, and the PCR amplification reagent is used to amplify its expression for quantitative analysis, such as some real-time fluorescence quantitative PCR reagents; the above reagents can be related reagents commonly used in this technical field, and can all be obtained by conventional technology or on the market.

[0048] Furthermore, the kit includes a negative control as shown in SEQ ID No. 4. The negative control can better reflect the relative expression level of tRF-Cys-GCA-029 detected by the kit. In the examples of this application, the negative control in the kit is represented by tRF-Cys-GCA-029-NC, and the sequence is as follows:

[0049] SEQ ID No. 4: 5'-UCUCGGUCCAUUCUAAGGUUCGUUGC-3'.

[0050] In one embodiment, the present application used qRT-PCR to verify the differential expression of tRFs in breast cancer tissues from patients with and without diabetes. The analysis results showed that tRF-Cys-GCA-029 expression levels were significantly decreased in breast cancer tissues from patients with and without diabetes, while it was highly expressed in breast cancer tissues from patients without and with diabetes. This suggests that tRF-Cys-GCA-029 is highly correlated with breast cancer tissues from patients with and without diabetes.

[0051] In one embodiment, the present application used real-time fluorescence quantitative PCR technology to analyze the differential expression of tRF-Cys-GCA-029 in human triple-negative breast cancer MDA-MB-231, BT-549, Luminal A breast cancer MCF-7, and T47D cells cultured at different glucose concentrations. The results showed that the expression of tRF-Cys-GCA-029 in cells cultured at 5 mmol / L was significantly higher than that in breast cancer tissues with diabetes and cells cultured at 25 mmol / L, and the differential expression was most obvious in MDA-MB-231 cells and MCF-7 cells.

[0052] In a third aspect, an embodiment of the present application provides a kit for diagnosing and / or prognosticating breast cancer complicated with diabetes, the kit comprising a reagent for detecting the expression of tRF as shown in SEQ ID No. 1.

[0053] Specifically, the reagents in the kit include a primer pair for amplifying tRF (shown in SEQ ID No. 2 and SEQ ID No. 3).

[0054] Specifically, the kit includes an RNA extraction reagent, an RNA reverse transcription reagent, and a PCR amplification reagent. Further, the kit also includes a negative control as shown in SEQ ID No. 4.

[0055] In a fourth aspect, an embodiment of the present application provides an application of a tRF nucleotide sequence and / or a promoter for promoting tRF expression in the preparation of a drug for preventing and / or treating breast cancer combined with diabetes; wherein the tRF nucleotide sequence is shown in SEQ ID No. 1.

[0056] In one embodiment, the present invention transfected tRF-Cys-GCA-029 into MDA-MB-231 and MCF-7 cell lines cultured at glucose concentrations of 25 mmol / L and 5 mmol / L, respectively, and found that overexpression of tRF-Cys-GCA-029 significantly inhibited the proliferation of breast cancer cells. These results indicate that tRF-Cys-GCA-029 provided in the present embodiment has a significant ability to inhibit the growth of breast cancer cells, and therefore tRF-Cys-GCA-029 is a newly discovered tRNA active fragment that inhibits tumor growth.

[0057] Specifically, the nucleotide sequence of tRF can be used to treat breast cancer combined with diabetes, and thus can be used to prepare drugs for preventing and / or treating breast cancer combined with diabetes. Furthermore, by promoting tRF expression in patients with breast cancer combined with diabetes, it can reduce the activity of breast cancer tumor cells in patients with diabetes, thereby indirectly reflecting that the corresponding promoter can also prevent and / or treat patients with breast cancer combined with diabetes. Therefore, promoters that promote tRF expression can also be used to prepare drugs for preventing and / or treating breast cancer combined with diabetes.

[0058] In one embodiment, the present application uses Western Blot experiments and centrifugation of polyribosomes in a sugar density gradient of 10%, 20%, 30%, 40%, and 50%, and qRT-PCR experimental analysis after sensitive separation of each component shows that tRF-Cys-GCA-029 increases the expression of PRKCG (i.e., PKCγ kinase) in monomers (Monosomes) and reduces the expression of PRKCG in polymers (Polysomes), thereby affecting the expression level of PRKCG protein. The experiment confirmed that the interaction between tRF-Cys-GCA-029 and PRKCG affects the sugar metabolism of breast cancer cells. In the qRT-PCR experiment, the primer pair sequences of PRKCG used for amplification are shown in SEQ ID No.5 and SEQ ID No.6:

[0059] SEQ ID No.5, F: 5'-AGCCACAAGTTCACCGCTC-3';

[0060] SEQ ID No. 6, R: 5'-GGACACTCGAAGGTCACAAAT-3'.

[0061] In one embodiment, the present application establishes a mouse diabetes model by using a high-fat diet and STZ, and then injects 4T1 mouse breast cancer cells to establish a breast cancer mouse transplant tumor model combined with diabetes. The model is then treated with tRF-Cys-GCA-029-NC and tRF-Cys-GCA-029, respectively. The final experimental results demonstrate that tRF-Cys-GCA-029 in the present application embodiment can inhibit the growth of breast tumors combined with diabetes in vivo.

[0062] In one embodiment, the nucleotide sequence of tRF can be used to prepare a drug for preventing and / or treating breast cancer combined with diabetes, and at the same time, a promoter that promotes tRF expression in the patient's body can reduce the tumor activity of breast cancer combined with diabetes cells, thereby also preventing and / or treating breast cancer combined with diabetes patients. Specifically, the promoter that promotes tRF expression in the embodiment of the present application can be an overexpression recombinant vector, based on a vector commonly used on the market for overexpressing a target gene, for example, the promoter can be a recombinant vector that can overexpress the tRF shown in SEQ ID No.1 in vivo after recombination with a commonly used overexpression plasmid vector.

[0063] In a fifth aspect, an embodiment of the present application provides a drug for preventing and / or treating breast cancer combined with diabetes, the drug containing the nucleotide sequence of tRF and / or a promoter that promotes tRF expression, and the nucleotide sequence of tRF is shown in SEQ ID No. 1.

[0064] In some embodiments, the medicament further comprises a pharmaceutically acceptable carrier.

[0065] Specifically, the drug provided in the embodiments of the present application may be a composition comprising the nucleotide sequence of tRF-Cys-GCA-029, a promoter for promoting its expression, and / or other drugs in combination therewith and a pharmaceutically acceptable carrier.

[0066] In the examples of this application, the nucleotide sequence of tRF-Cys-GCA-029 is used to prepare a drug for preventing and / or treating breast cancer complicated by diabetes. An "effective amount" of tRF-Cys-GCA-029 refers to an amount that produces a function or activity in humans and / or animals and is acceptable to humans and / or animals. A "pharmaceutically acceptable carrier" refers to a carrier used for administering a therapeutic agent, including various excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients and are not unduly toxic upon administration. Suitable carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in compositions may include liquids such as water, saline, and buffers. Furthermore, these carriers may contain auxiliary substances such as fillers, lubricants, glidants, wetting agents or emulsifiers, and pH buffering substances. The carriers may also contain cell transfection reagents. In the examples of this application, tRF-Cys-GCA-029, its transcript, or pharmaceutical compositions thereof can be administered to mammals using a variety of methods well known in the art. Including but not limited to: subcutaneous injection, intramuscular injection, transdermal administration, local administration, implantation, sustained-release administration, etc.; For example, the administration method is parenteral administration.

[0067] This application has been tested many times. Some of the test results are cited as reference to further describe the application in detail. The following is a detailed description with reference to specific embodiments.

[0068] In the experiments of the present application, normal temperature refers to 25-30°C.

[0069] Example 1: Differences in the expression of tRF-Cys-GCA-029 in breast cancer tissues with and without diabetes

[0070] 1. RNA extraction from breast cancer tissue

[0071] (1) The case specimens (from Peking University Shenzhen Hospital) were taken out of the -80°C freezer and placed on ice. Approximately 0.1 g of the specimens were cut with surgical scissors and placed in a mortar. Liquid nitrogen was added to grind until it became powdery. 1 mL of Trizol reagent was added to lyse the specimens and the samples were transferred to 1.5 mL EP tubes and stored in a -80°C freezer until ready for use.

[0072] (2) Thaw the sample lysed with Trizol reagent in the EP tube, add 200uL chloroform, shake for 30 seconds, place at room temperature for 10 minutes, and then centrifuge. The centrifugation conditions are: 4℃, 12000 rpm, and centrifuge for 20 minutes.

[0073] (3) After centrifugation, take 400uL of supernatant into a new EP tube, add 600uL of isopropanol, invert 10 times, place at room temperature for 10 minutes, and then centrifuge. The centrifugation conditions are: 4°C, 12,000 rpm, and centrifuge for 10 minutes.

[0074] (3) After centrifugation, discard the supernatant and add 1 ml of 75% ethanol to wash the lower RNA layer. Centrifuge at 4°C, 7500 rpm, and centrifuge for 5 minutes. Aspirate the supernatant, invert and dry for 5 minutes. Add 40 μL of DEPC water (i.e., ultrapure water treated with diethyl pyrocarbonate and sterilized at high temperature and high pressure) to obtain an RNA solution.

[0075] 2. Reverse transcription PCR (RT-PCR)

[0076] A reverse transcription kit (RR047A, Takara) was used. Mix according to the system in Table 1 and incubate at 37°C for 5 min to eliminate gDNA. Reverse transcription was then performed according to the system in Table 2. The reverse transcription program for the PCR instrument is shown in Table 3. After the reverse transcription program, the samples were stored in a refrigerator at -20°C.

[0077] Table 1

[0078] Reagents Dosage 5x gDNA Eraser Buffer 2 μl gDNA Eraser 1 μl Total RNA 1 μg <![CDATA[RNase Free dH2O]]> Up to 10ul

[0079] Table 2

[0080] Reagents Dosage Table 1 Reaction solution of the system 10ul PrimeScript RT Enzyme MixI 1ul RT Primer Mix / Specific Primer 1ul 5xPrimeScript Buffer2 4ul <![CDATA[RNase Free dH2O]]> 4ul Total 20ul

[0081] Table 3

[0082] temperature time Step 1 37℃ 15min Step 2 85℃ 5s Step 3 4℃ -

[0083] 3. Real-time quantitative PCR (qRT-PCR)

[0084] (1) Use Takara kit RR820A for detection. Perform three replicates for each sample. Select the internal reference gene U6 according to the target gene. Select the corresponding amplification primers and amplification reagents to prepare the fluorescence quantitative PCR system shown in Table 4. The PCR instrument detection program is shown in Table 5.

[0085] Table 4

[0086] Reagents Dosage TB Green Premix Ex Taq II 10ul cDNA solution 2ul Forward Primer 0.8ul Reverse Primer 0.8ul <![CDATA[ddH2O]]> 6.4ul Total 20ul

[0087] Table 5

[0088] temperature time 1 95 10 minutes 40 2 95 15 seconds Follow 3 60 15 seconds ring 4 72 30 seconds 5 65 6 seconds

[0089] (2) After the real-time fluorescence quantitative PCR is completed, the calculation is performed according to the following formula:

[0090] ΔCt=Ct 目的基因 -Ct 内参基因 ;

[0091] ΔΔCt=ΔCt 实验组 -ΔCt 对照组 ;

[0092] Target gene amount = 2 -ΔΔCt ;

[0093] The final result is as follows Figure 1 As shown in the figure, BC-DM represents breast cancer with diabetes (N=9, representing 9 case specimens), and BC-without DM represents breast cancer without diabetes (N=7, representing 7 case specimens). The results showed that the relative expression of tRF-Cys-GCA-029 was significantly downregulated in breast cancer tissues with diabetes compared with breast cancer tissues without diabetes.

[0094] Example 2 Differential Expression of tRF-Cys-GCA-029 in Breast Cancer Cells Cultured at Different Sugar Concentrations

[0095] 1. Human breast cancer cells MDA-MB-231 and MCF-7 were cultured in DMEM medium containing 5mmol / L, 10mmol / L, 15mmol / L, 20mmol / L, and 25mmol / L glucose, respectively. The cells were cultured at a rate of 1.5X10 5 Each well was inoculated into a 6-well plate, and qRT-PCR experiments were performed according to the steps of Example 1 after 24 hours.

[0096] The results are as follows Figure 2 As shown in Figures A and B, tRF-Cys-GCA-029 is differentially expressed in gradient sugar concentrations, and compared with the concentration of 5 mmol / L, the down-regulated expression difference is the largest at 25 mmol / L. Based on comprehensive consideration of the literature and clinical samples, this experiment selected 25 mmol / L (high sugar concentration) to simulate the diabetic environment and 5 mmol / L (low sugar concentration) to simulate the non-diabetic environment.

[0097] 2. MDA-MB-231 cells, MCF-7 cells, BT-549 cells, and T47D cells were cultured in DMEM and 1640 medium containing 5 mmol / L and 25 mmol / L glucose, respectively. The cells were cultured at a rate of 1.5 × 10 5 Each well was inoculated into a 6-well plate, and qRT-PCR experiments were performed according to the steps of Example 1 after 24 hours.

[0098] The results are as follows Figure 2 As shown in Figure C, the expression difference of tRF-Cys-GCA-029 between high glucose and low glucose was the greatest in MDA-MB-231 cells and MCF-7 cells. Considering these two cell lines, subsequent experiments were carried out.

[0099] Example 3tRF-Cys-GCA-029 high expression inhibits breast cancer cell proliferation, migration

[0100] 1. Cell transfection

[0101] In the embodiments of the present application, cells were seeded in 6-well plates at 1.5x10 5 When the cell density reached 70%-80% after 24h, transfection was performed.

[0102] The synthesized tRFs (tRF-Cys-GCA-029 and tRF-Cys-GCA-029-NC) were dissolved with DEPC water to a final concentration of 20uM; the seeded cells were removed, the supernatant was aspirated, and PBS was washed twice; 1.75mL of DMEM complete medium (high / low sugar) was added; tRF-Cys-GCA-029 and its negative control tRF-Cys-GCA-029-NC were transfected into cells according to the Lipo3000 instruction manual; the cells were incubated at 37°C, 5% CO2 in a cell incubator for 20min; the cells were collected after 24h for downstream detection.

[0103] 2. Cell proliferation

[0104] According to the above steps, tRF-Cys-GCA-029 and its negative control were transfected into breast cancer MDA-MB-231 cells and MCF-7 cells; after 24h, the cells were digested and centrifuged; after counting, the cell density was adjusted to 2.5x10 4 6 time points of day 0, day 1, day 2, day 3, day 4, and day 5; 5000 cells were seeded per well, with a total of 5 replicate wells; after 4h of incubation in the incubator, detection was started; the time point was recorded as D0; every 24h was recorded, and the same was recorded as D1, D2, D3, D4, and D5; according to the CCK8 kit instruction manual, cell proliferation was determined, with 20 experimental wells and 5 blank control wells per plate; the cell plate at the corresponding time point was removed, and the old culture medium in the wells was aspirated with a 200uL gun head; 110uL of detection solution was added to each well, and the detection solution was prepared according to the high / low sugar complete medium and CCK-8 reagent at a volume ratio of 10:1; the plate was incubated in the incubator for 2h; the OD450nm was detected by a microplate reader.

[0105] The results are as follows Figure 3As shown in A and B, 25mmol / l-GCA-029 indicates the group in which cells cultured in a medium with a glucose concentration of 25mmol / l were transfected with tRF-Cys-GCA-029, 5mmol / l-GCA-029 indicates the group in which cells cultured in a medium with a glucose concentration of 5mmol / l were transfected with tRF-Cys-GCA-029, 25mmol / l-GCA-029-NC indicates the group in which cells cultured in a medium with a glucose concentration of 25mmol / l were transfected with tRF-Cys-GCA-029-NC, and 5mmol / l-GCA-029-NC indicates the group in which cells cultured in a medium with a glucose concentration of 5mmol / l were transfected with tRF-Cys-GCA-029-NC. The relative cell growth curves showed that tRF-Cys-GCA-029 inhibited the proliferation of MDA-MB-231 cells and MCF-7 cells regardless of whether the cells were cultured in high glucose (25 mmol / l) or low glucose (5 mmol / l) concentrations.

[0106] 3. Cell migration

[0107] Following the above steps, tRF-Cys-GCA-029 and negative control were transfected into MDA-MB-231 cells and BT-549 cells (since MCF-7 cells are not suitable for migration experiments, BT-549 cells were used instead). After 24 hours, the cells were digested, centrifuged, and resuspended in 500 μL of pure culture medium without FBS per well. The cells were counted using a BIO-RAD automatic cell counter and the cell concentration was adjusted to 1×10 6 Add 100uL of complete culture medium to each well of the lower chamber and 600uL of complete culture medium to each well of the lower chamber, and repeat 3 replicates, which is equivalent to adding 1x10 5 cells; cultured in an incubator for 24 hours; removed the cells, added 600uL of methanol to the empty wells of a 24-well plate, rinsed each chamber once with PBS and placed in it for cell fixation for 60 minutes, and then stained with crystal violet for 15 minutes; washed the chamber with water once, cleaned the cells inside the chamber with a cotton swab, observed under a microscope at 4x and 10x fields of view, selected five fields of view (upper, lower, left, middle, and right) to take pictures, and then counted and statistically analyzed using ImageJ.

[0108] The results are as follows Figure 4 As shown in Figures A and B, tRF-Cys-GCA-029 inhibited the migration of MDA-MB-231 cells and BT-549 cells regardless of whether the cells were cultured in high glucose (25 mmol / l) or low glucose (5 mmol / l) concentrations.

[0109] Example 4: Overexpression of tRF-Cys-GCA-029 inhibits the expression of the target gene PRKCG

[0110] tRF-Cys-GCA-029 and its negative control were transfected into MDA-MB-231 cells and MCF-7 cells. After 72 hours, proteins were extracted and Western blotting was performed as follows.

[0111] 1. Protein extraction

[0112] After rinsing the transfected cells with cold PBS, add 100 μL of a 100:1 mixture of Western Blotting / Immunoprecipitation (WB / IP) lysis buffer and phenylmethylsulfonyl fluoride (PMSF) and shake on ice for 10 minutes. Remove all cells using a cell scraper and transfer to a 1.5 mL EP tube. Centrifuge at 12,000 g for 15 minutes at 4°C. Collect the supernatant, discard the pellet, and store at -80°C. Determine protein concentration using the BCA assay.

[0113] 2. Gel electrophoresis

[0114] Set up a 10-well 12% SDS-PAGE gel, loading 20 μg of protein per well. Prepare an electrophoresis tank, add electrophoresis buffer, and adjust the voltage to 70V. Wait until the bromophenol blue indicator band escapes the stacking gel, then adjust the voltage to 120V until the bromophenol blue indicator band runs through the separating gel. Terminate the electrophoresis. Prepare transfer buffer (600 mL water + 200 mL anhydrous methanol + 200 mL electrotransfer buffer). Soak the transfer filter paper and sponge pad in transfer buffer and equilibrate until ready to use. Cut an 8 cm x 6 cm PVDF membrane, soak it in methanol for 2 minutes to activate the positively charged groups, and equilibrate it in transfer buffer for 15 minutes. Peel the gel and place it in the transfer chuck in the following order: sponge pad, filter paper, gel, PVDF membrane, filter paper, sponge pad, forming a sandwich. Place the chuck in an ice-cold transfer apparatus. Transfer time: 250 mA, 90 minutes. After transfer, the membrane was incubated in 5% BSA diluted in TBST for 1 hour at room temperature. The membrane was then incubated with primary antibodies (β-actin, CST, 1:1000; PRKCG, Proteintech, 1:2000) at 4°C overnight. The following day, the membrane was washed three times with TBST for 10 minutes each. The secondary antibody, Goat Anti-IgG H&L (Zhongshan Jinqiao) diluted in 5% BSA, was then added and incubated for 1 hour at room temperature. The membrane was washed three times with TBST for 10 minutes each on a shaker, then coated with developer solution and photographed using a multi-functional imager.

[0115] The results are as follows Figure 5 As shown in Figures A and B, compared with the negative control tRF-Cys-GCA-029-NC, high expression of tRF-Cys-GCA-029 significantly inhibited the expression of PRKCG in MDA-MB-231 cells and MCF-7 cells.

[0116] Example 5 PRKCG reverses the inhibitory effect of tRF-Cys-GCA-029 on glucose metabolism in breast cancer cells

[0117] 1. Co-transfection

[0118] Cells were plated at 1.5 x 10 cells per well. 5 Cells were seeded in a six-well plate, and transfection was performed after the cell density reached 70%-80% in 24 hours. 20uM tRF-Cys-GCA-029 and 100ng / ul PRKCG plasmid (purchased from Guangzhou Shuangquan Biotechnology Co., Ltd.) prepared with DEPC water were taken out. The inoculation density (about 0.25X10 6 ) When the cells reached the required size, they were washed twice with PBS and 1.75 mL of complete culture medium was added along the wall; according to the Lipo3000 instruction manual, the co-transfection system was shown in Group A of Table 6, Group B of Table 7, and Group C of Table 8.

[0119] Table 6

[0120] Serial number Components Component dosage Opti-MEM A1 tRF-Cys-GCA-029 2.5ul 60ul A2 tRF-Cys-GCA-029-NC 2.5ul 60ul

[0121] Table 7

[0122] Serial number Components Component dosage P3000 Opti-MEM B1 Empty Vector 12.5ul 2.5ul 47.5ul B2 PRKCG 12.5ul 2.5ul 47.5ul

[0123] Table 8

[0124] Serial number Reagents Lipofectamine 3000 Opti-MEM C Dosage 2.5ul 62.5ul

[0125] Add serial numbers A1 and A2 in Table 6 to group C in Table 8, and add serial numbers B1 and B2 in Table 7 to form four groups, namely C+A1, C+A2, C+B1, and C+B2. After centrifugation, incubate at room temperature for 10 minutes. Mix according to the combinations of C+A1+B1, C+A1+B2, and C+A2+B1, centrifuge, and let stand at room temperature for 5 minutes. Add the transfection components to the corresponding cell wells, return to the incubator, and continue culturing for 48 hours.

[0126] 2. Sugar metabolism test

[0127] tRF-Cys-GCA-029 and its negative control, and PRKCG and its negative control were transfected into MDA-MB-231 cells and MCF-7 cells according to the above grouping. After 48 hours, the cell supernatant was collected and the lactate and pyruvate levels were measured using the lactate detection kit (coefficient of variation CV 1.5%, recovery test X = 101%) and the pyruvate detection kit (coefficient of variation CV 1.7%, recovery test X = 96%) from Nanjing Jiancheng Bioengineering Research Institute Co., Ltd., respectively. The experimental steps are as follows:

[0128] (1) Lactic acid detection

[0129] Prepare enzyme working solution: Mix enzyme stock solution and enzyme diluent in a volume ratio of 1:100.

[0130] Prepare the colorimetric solution: Pour Reagent No. 4 powder into Reagent No. 3, shake and vortex to dissolve the powder completely in the solution, and mix thoroughly. (The above enzyme stock solution, enzyme diluent, Reagent No. 4 powder, and Reagent No. 3 are all existing reagents in the lactic acid test kit)

[0131] Table 9

[0132] Blank tube Standard tube Assay tube Double distilled water (ml) 0.02 - - 3mmol / L standard (ml) - 0.02 - Sample to be tested (ml) - - 0.02 Enzyme working solution (ml) 1 1 1 Color development solution (ml) 0.2 0.2 0.2

[0133] Prepare the system according to Table 9, place it in a 37°C water bath for 10 minutes, add 250uL of sample to each well of the 96-well plate (corresponding to the samples in the blank tube, standard tube, and assay tube), and detect the absorbance at OD530nm using a multifunctional microplate reader.

[0134] The calculation formula of lactic acid is:

[0135]

[0136] The absolute OD value (measured OD value - blank OD value) was determined to be in the range of 0.05-0.35.

[0137] (2) Pyruvate detection

[0138] Table 10

[0139]

[0140] Prepare the system according to Table 10 (reagents 2 and 3 in the table are existing reagents in the pyruvic acid assay kit), let it stand for 5 minutes, and measure the absorbance of the sample at 505 nm.

[0141]

[0142] Glucose metabolism test results Figure 6 As shown, L-lactate indicates lactate, Pyruvate indicates pyruvate, tRF-NC+Vector indicates that tRF-Cys-GCA-029-NC and Vector are present in the cells at the same time, tRF-Cys-GCA-029+Vector indicates that tRF-Cys-GCA-029 and Vector are present in the cells at the same time, and tRF-Cys-GCA-029+PRKCG indicates that tRF-Cys-GCA-029 and PRKCG are present in the cells at the same time. Figure 6The data results in Figures A and B show that in MDA-MB-231 cells and MCF-7 cells, high expression of PRKCG can reverse the effect of tRF-Cys-GCA-029 in inhibiting lactate production in breast cancer cells. Figure 6 The data results in C and D show that in MDA-MB-231 cells and MCF-7 cells, high expression of PRKCG can reverse the effect of tRF-Cys-GCA-029 in inhibiting the production of pyruvate in breast cancer cells.

[0143] Example 6 tRF-Cys-GCA-029 reduces PRKCG expression by inhibiting its translation

[0144] Sucrose density gradient experiment

[0145] tRF-Cys-GCA-029 and its negative control were transfected into MDA-MB-231 cells. After 24 h, the cells (1×10 7 The cells were incubated in DMEM containing 100 μg / mL cycloheximide at 37°C for 10 minutes. All subsequent steps contained 100 μg / mL cycloheximide. After centrifugation, the resuspended cells were trypsinized at 37°C for 3 minutes and then lysed with polymer extraction buffer (PEB; 20 mM Tris-HCl, pH 7.5, 50 mM KCl; 10 mM MgCl; 1 mM DTT; 100 μg / mL CHX; 200 μg / mL heparin) containing 1% Triton-X100 for 30 minutes on ice. The lysate was centrifuged at 14,000 rpm at 4°C for 30 minutes. The resulting supernatant was collected and loaded onto a centrifuge tube containing a 10%-50% sucrose density gradient from top to bottom. The centrifuge tube was then centrifuged at 38,000 rpm in an Optima L-100XP rotor (Beckman Coulter) for 120 minutes. Collect 23 equal volumes of fractions and measure their absorbance. Figure 7 A) in the figure indicates that the fraction located between 6 and 15 nm is monosome, and the fraction located between 35 and 45 nm is polysome.

[0146] RNA was extracted from monosomes and polysomes using Trizol reagent (Life Technologies, Shanghai, China), reverse transcribed into cDNA using PrimeScript™ RT reagent kit (Takara, Beijing, China), and amplified by qRT-PCR analysis using TB Green Premix Ex Taq™ II kit (Takara, Beijing, China).

[0147] The results are as follows Figure 7 As shown in Figures B and C, compared with the negative control tRF-Cys-GCA-029-NC, overexpression of tRF-Cys-GCA-029 increased the expression of PRKCG in the Monosome fraction, decreased the expression of PRKCG in the Polysome fraction, and reduced the ratio of PRKCG expression in the Polysome group to the Monosome group, indicating that tRF-Cys-GCA-029 regulates the expression of PRKCG through the translation pathway.

[0148] Example 7 tRF-Cys-GCA-029 inhibits the growth of breast cancer transplanted tumors in diabetic mice

[0149] 1. Establishment of diabetic mouse model

[0150] To develop hyperglycemic conditions, mice (purchased from the Guangdong Medical Laboratory Animal Center) were acclimated to the breeding facility for 7 days and then maintained on a high-fat diet (HFD). After 7 days of HFD feeding, all mice were fasted overnight (≥12 hours) and then administered with streptozotocin (STZ). STZ was dissolved in sodium citrate buffer solution (pH = 4.5) and administered intraperitoneally at 50 mg / kg body weight within 10 minutes of STZ dissolution for 3 consecutive days. Blood glucose levels were monitored every two days using a glucometer. Random blood glucose levels exceeding 11.1 mmol / L were considered hyperglycemic conditions, and the diabetic mouse model was successfully established.

[0151] 2. Establishment of a breast cancer mouse model with diabetes

[0152] To establish the xenograft model, 16 4-6 week-old Balb / c mice (Biomice, Zhuhai, China) from the diabetic mouse model were randomly divided into two groups: (1) tRF-Cys-GCA-029-NC; (2) tRF-Cys-GCA-029; 8 mice in each group. Mouse breast cancer 4T1 cells (2.5×10 5 ) was injected subcutaneously into the right flank of the mice. Tumor volume was monitored every two days by measuring length and width and calculated using the following formula: Tumor volume = [width 2 x length] / 2;

[0153] When the average tumor volume reaches 40 mm 3 When , it indicates that the breast cancer mouse model with diabetes was successfully established.

[0154] 3. Treatment with tRF-Cys-GCA-029

[0155] When the average volume of tumor xenografts in the above diabetic breast cancer mouse model reached ∼40 mm3 tRF-Cys-GCA-029-NC (5 nmol) and tRF-Cys-GCA-029 (5 nmol) were injected locally into the tumor mass every two days. After 2 weeks of treatment (a total of 6 doses), all mice were euthanized and the xenograft tumors were excised for tumor size analysis.

[0156] The results are as follows Figure 8 As shown, the horizontal axis 50 days (day) refers to the calculation from the beginning of the diabetic model, that is, it took 28 days to create the diabetic model, and then the breast cancer combined with diabetes model was started. tRF-Cys-GCA-029 treatment was started on the 33rd day, and the drug was administered for two weeks for a total of 14 days. In the figure, tRF-mimic represents the change curve of the tumor volume of mice after tRF-Cys-GCA-029 injection, and tRF-NC represents the change curve of the tumor volume of mice after tRF-Cys-GCA-029-NC injection. The results show that compared with the negative control tRF-Cys-GCA-029-NC, high expression of tRF-Cys-GCA-029 significantly inhibited the growth of transplanted tumors in mice with breast cancer and diabetes.

[0157] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting tRF expression in the preparation of a kit for diagnosing and / or evaluating the prognosis of breast cancer complicated with diabetes; wherein: The nucleotide sequence of the tRF is shown in SEQ ID No.

1.

2. The use according to claim 1, wherein The reagents include a primer pair for amplifying the tRF, and the nucleotide sequences of the primer pair are shown as SEQ ID No. 2 and SEQ ID No.

3.

3. The use according to claim 1 or 2, characterized in that The kit includes an RNA extraction reagent, an RNA reverse transcription reagent and a PCR amplification reagent; and / or, The kit includes a negative control as shown in SEQ ID No.

4.

4. A kit for diagnosing and / or prognostic evaluation of breast cancer complicated with diabetes, characterized in that: The kit contains a reagent for detecting tRF expression, and the nucleotide sequence of the tRF is shown in SEQ ID No.

1.

5. The kit according to claim 4, wherein The reagents include a primer pair for amplifying the tRF, and the nucleotide sequences of the primer pair are shown as SEQ ID No. 2 and SEQ ID No.

3.

6. The kit according to claim 4 or 5, wherein The kit includes an RNA extraction reagent, an RNA reverse transcription reagent and a PCR amplification reagent; and / or, The kit includes a negative control as shown in SEQ ID No.

4.

7. Use of a tRF nucleotide sequence in the preparation of a drug for preventing and / or treating breast cancer complicated with diabetes; wherein: The nucleotide sequence of the tRF is shown in SEQ ID No.

1.

8. A drug for preventing and / or treating breast cancer complicated with diabetes, characterized in that: The drug contains the nucleotide sequence of tRF and a pharmaceutically acceptable carrier, and the nucleotide sequence of tRF is shown in SEQ ID No. 1.

Images