An in vitro synthesized lethal gene of Ceropegia glutinosus and its application

Abstract

The invention belongs to the technical field of grain storage, and specifically relates to an in vitro synthesized lethal gene for mealworms and an application thereof. The lethal gene for mealworms is prepared by using the Snf7 gene of a known potato beetle, and obtaining a homologous gene RdSnf7 of mealworms by comparison with a transcriptome database, and synthesizing dsRdSnf7 by in vitro transcription according to RdSnf7. The invention aims to screen the homologous gene of Snf7 of mealworms and verify the lethal effect thereof, and when the lethal effect is proved, explore the influence of phosphine resistance on RNAi effect, and further explore the relationship between dsRNA concentration and lethal effect; and conduct a preliminary exploration on the stability of dsRNA in a grain storage environment.

Description

Technical Field

[0001] The invention belongs to the technical field of grain storage, and in particular relates to an in vitro synthesized rice cuttlefish lethal gene and application thereof. Background Art

[0002] Endosomal sorting transport complexes (ESCRTs) are essential for multivacuolar body (MVB) biogenesis. The ESCRT pathway is a key regulator of biological processes that are important for eukaryotic cell growth and survival. In yeast, humans, and insects, the ESCRT pathway consists of five distinct, highly conserved subcomplexes: ESCRT-0, -I, -II, and -III, and VPS4-Vta1. ESCRT-III is the last complex in the MVB degradation pathway, which provides the core machinery for mediating membrane deformation and fission events during MVB biogenesis. Studies have found that ESCRT-I and -III components are localized to the midbody, and ESCRT-III components are thought to mediate membrane fission at the end of cell division. The vacuolar sorting protein Snf7 is an important cellular component of the ESCRT-III complex in multiple organisms, and it participates in the sorting of transmembrane proteins en route to lysosomal degradation via the endosomal-autophagic pathway. Previous studies have shown that Snf7 is an effective RNAi target for controlling pests such as the corn rootworm Dvvirgifera LeConte and the southern corn rootworm D. undecimpunctata howardi. The first commercialized transgenic corn variety, MON87411, contains an RNAi trait targeting Snf7 in the corn rootworm, and the variety was deregulated in the United States in 2017. Although the function of the Snf7 protein is conserved, the suppression of the Snf7 gene in the corn rootworm by dsSnf7 is sequence-specific.

[0003] Snf7 is the only registered nucleic acid pesticide gene at present. The nucleic acid pesticide produced with Snf7 gene as the target sequence has shown excellent lethal effect against potato beetles in field experiments.

[0004] As a common stored-grain pest, Rhyzopertha dominica is widely distributed around the world, causing huge losses to the stored-grain industry every year. At present, the control of Rhyzopertha dominica mainly relies on phosphine fumigation, but high concentrations of phosphine cause the Rhyzopertha dominica to produce a protective coma, which reduces the fumigation effect of phosphine and may be a key factor leading to phosphine resistance. In recent years, phosphine alternative technologies have emerged in an endless stream. Nitrogen gas conditioning, inert powder, insecticidal essential oils, and nucleic acid pesticides have all been proven to have a certain killing effect on pests. Among them, nucleic acid pesticides have attracted more and more attention due to their high efficiency and specificity. The use of RNAi technology (RNA interference, RNAi) for the control of stored-grain pests is one of the main research directions at present. Snf7 is a known RNAi target gene. Its lethal effect has been reported in related studies on corn rootworms, southern corn rootworms, and potato beetles. However, for stored-grain pests, such as Rhyzopertha dominica, the RNAi effect of related homologous genes has not been reported yet, and it is urgent to study. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an in vitro synthesized lethal gene for grain cuttlefish and its application.

[0006] In order to achieve the purpose of the present invention, the present invention will be implemented by adopting the technical solution described below.

[0007] The gene sequence of a rice borer lethal gene dsRdSnf7 is: CGATGGAACGCTCACAACTATCGAGCTGCAGAGACAGACCCTCGAAGATGCCAGCACAAGCGGACAGGTGTTGTCTACGATGAAGAATGCAGCGGATGCGCTCAAGATTGCCCACAAGAATATGGATATCGACCAAGTCCACGATATGATGGATGACATTGCCGAACAGCAGGATATCGCGAATGAAATATCGAATGCCATTAGTAACCCGGTTGCCTTCGGACAGGACATCGACGAGGATGAACTGGAAAAGGAACTGGAGGAATTAGAACAAGAACAGTTGGACGAGAACCTCATCAAGATCCCAACGAAGCCGATTACGGACGATTTGCCGACTGTGCC.

[0008] A method for preparing a rice borer lethal gene dsRdSnf7 comprises the following steps:

[0009] S1. Based on the known Snf7 gene of potato beetle, the homologous gene RdSnf7 of Leptinotarsa ​​decemlineata was obtained by comparing and screening the transcriptome database;

[0010] S2. Synthesize dsRdSnf7 by in vitro transcription based on RdSnf7 obtained in S1.

[0011] As a preferred embodiment of the present invention, the preparation method specifically comprises the following steps:

[0012] S1. Based on the CDS sequence of the known lethal gene Snf 7 of potato beetle as a template, the homologous gene RdSnf7 in Leptinotarsa ​​decemlineata was screened through blast analysis;

[0013] S2. Primer design: Primers were designed using Primer Primier 5 software, 341 bp were selected from base positions 237 to 578 as the target site sequence for synthesizing dsRNA, and T7 promoter sequences were added to the 5' ends of the upstream and downstream primers, respectively, to synthesize DNA primers containing T7 promoter;

[0014] S3, total RNA extraction, take the test grain borer, freeze it quickly in liquid nitrogen and then extract total RNA;

[0015] S4, cDNA synthesis, using the extracted RNA as a template, reverse transcription and synthesis of cDNA;

[0016] S5, PCR amplification, using DNA primers connected to T7 promoter and the prepared cDNA solution as template, PCR amplify the target gene sequence of 341 bp in size as a template for in vitro transcription synthesis of dsRdSnf7;

[0017] S6, PCR purification: the PCR amplification product was purified according to the instructions of MiniBEST DNA Fragement Purification Kit Ver.4.0 (Takara);

[0018] S7. Use T7RiboMAXTM Express RNAi System kit to transcribe the target fragment and synthesize dsRdSnf7 with interference effect in vitro.

[0019] As a preferred embodiment of the present invention, the sequence of RdSnf7 in S1 is:.

[0020] As a preferred embodiment of the present invention, the sequence of the DNA primer containing the T7 promoter in S2 is as follows:

[0021] RdSnf7-341-T7-F

[0022] 5'-TAATACGACTCACTATAGGGCGATGGAACGCTCACA-3'

[0023] RdSnf7-341-T7-R

[0024] 5'-TAATACGACTCACTATAGGGGGCACAGTCGGCAAAT-3'.

[0025] As a preferred embodiment of the present invention, the specific method for synthesizing dsRdSnf7 in vitro comprises the following steps:

[0026] S1. Prepare the dsRdSnf7 in vitro synthesis system according to the instructions of the kit, pipette up and down 8-10 times, observe that there is no oily liquid in the solution, and then incubate it in a 37 degree gradient PCR instrument for 3-5 hours;

[0027] S2. Heat shock in a 70-degree water bath for 10 minutes, take out the centrifuge tube and place it in a plastic box filled with 70-degree hot water, let it stand at room temperature for 20 minutes, and then slowly cool it to room temperature;

[0028] S3. After the annealing operation is completed, the single / double-stranded DNA and ssRNA in the solution are removed;

[0029] S4, centrifugation at 12000 g for 10 min;

[0030] S5, discard the supernatant, add 500 μL 70% ethanol, and centrifuge at 12000 g for 5 min;

[0031] S6, repeat operation S5 once;

[0032] S7. Discard the supernatant, carefully remove the residual ethanol, place in a clean bench and air-dry at room temperature for 15 minutes. After air-drying, add 2-5 times the initial reaction volume of RNase-free water to dissolve the product;

[0033] S8. Use an ultra-micro spectrophotometer to measure the concentration of the diluted dsRdSnf7 solution, prepare 1.5% agarose gel, and detect the purity of dsRdSnf7 at a voltage of 170 V and a time of 15 min.

[0034] An exogenous control gene dsEGFP, characterized in that the sequence of the dsEGFP is: GATTAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCACGTGACCACCCTGACCTACGGCGTGCAGCGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAA.

[0035] Application of a grain borer lethal gene dsRdSnf7 in controlling the grain storage pest grain borer.

[0036] Beneficial Effects

[0037] (1) The dsRdSnf7 spraying experiment showed that dsRdSnf7 had a significant lethal effect on rice cuttlefish;

[0038] (2) The sensitivity of different resistant strains to dsRdSnf7 indicates that phosphine resistance has little effect on the effect of dsRNA interference, and it can be widely used throughout the country to control rice borers with different phosphine resistance levels;

[0039] (3) The lethal effect of dsRdSnf7 on different grains: dsRdSnf7 can cause significant lethal effects on rice borers in three different grains: rice, brown rice, and wheat. However, there are certain differences in the lethal effects. The lethal efficiency is: brown rice group > rice group > wheat group.

[0040] (4) During the storage period, the dynamic analysis of dsRdSnf7 residues on the grain surface showed that there was no dsRdSnf7 residue on the grain surface, but the lethal gene could still cause a lethal effect on grain borers, and the lethal effect on grain borers increased with the extension of storage time. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1This is a graph showing the relationship between the survival rate of the MJ strain test insects of the present invention and the starvation time;

[0042] Figure 2 is the relative expression level of RdSnf7 gene of different ages of grain borer in the present invention;

[0043] Figure 3 is the survival rate of the test insects after RNAi of the present invention;

[0044] Figure 4 is the survival rate of the test insects of different resistance strains of the present invention after interference;

[0045] Figure 5 is the survival rate of the test insects after different concentrations of lethal gene interference of the present invention;

[0046] Figure 6 The relative expression of the target gene of the test insect after the gene interference of the present invention changes over time

[0047] Figure 7 The figures show the spraying effects of the lethal gene on different grains of the present invention, wherein Figure A shows rice, Figure B shows brown rice, and Figure C shows wheat. DETAILED DESCRIPTION

[0048] The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0049] As an embodiment of the present invention, the following steps are specifically included:

[0050] 1. Test Insects

[0051] The selected rice borer was cultured in the National Engineering Laboratory for Grain Storage and Transportation of Nanjing University of Finance and Economics. 800 rice borers (Rhyzoperthadominica) of three different phosphine-resistant strains, GX (Taizhou Grain and Oil Institute, Jiangsu Province), XD (Xindu District Grain Depot, Chengdu City, Sichuan Province), and MJ (Mingjia Food Co., Ltd., Huanggang City, Hubei Province) were taken as the first generation, and the feed was prepared in a ratio of whole wheat flour: wheat 1:2. The rice borers were placed in a wide-mouth bottle filled with feed and cultured in a constant temperature and humidity culture room at a temperature of 30±1℃ and a humidity of 65% for three days. Then all adults were picked and transferred. After a period of cultivation, the adults of the same age in the wide-mouth bottle were taken for subsequent experiments.

[0052] 2. Preparation of dsRdSnf 7

[0053] 1. Primer design

[0054] The synthesis of dsRdSnf7 was based on the transcriptome database of Leptinotarsa ​​kidecemlineata. The CDS sequence of the reported lethal gene Snf 7 of potato beetle was used as a template. The homologous gene RdSnf7 (Unigene0040534) in Leptinotarsa ​​kidecemlineata was screened through blast analysis. Primers were designed using Primer Primier 5 software. 341 bp were selected from base positions 237 to 578 as the target site sequence for dsRNA synthesis. T7 promoter sequences (TAATACGACTCACTATAGGG) were added to the 5' ends of the upstream and downstream primers, respectively, to synthesize specific primers for dsRNA synthesis containing T7 promoter.

[0055] The sequences of the specific T7 DNA primers used are as follows:

[0056] RdSnf7-341-T7-F

[0057] 5'-TAATACGACTCACTATAGGGCGATGGAACGCTCACA-3'

[0058] RdSnf7-341-T7-R

[0059] 5'-TAATACGACTCACTATAGGGGGCACAGTCGGCAAAT-3'

[0060] 2. Total RNA Extraction

[0061] Eight test grain borers were selected and quick-frozen in liquid nitrogen before total RNA extraction. All extraction steps were performed in a clean bench. The specific steps are as follows:

[0062] 21. Use a pipette to draw up 250 μl of RNA-easy solution and transfer it into a 1.5 mL centrifuge tube;

[0063] 22. Use metal tweezers (enzyme-free and sterile) to pick up three 2 mm metal grinding beads and place them in a 1.5 mL centrifuge tube;

[0064] 23. Transfer the quick-frozen grain borer test insects from the liquid nitrogen freezing tube to a 1.5 mL centrifuge tube;

[0065] 24. Grind the test insects using a frozen mixing ball mill at a grinding frequency of 30mHz and a grinding time of 5min;

[0066] 25. Then quickly take out the ground tissue sample and put it in an ice box to delay degradation;

[0067] 26. Add 250 μl RNA-easy solution to the ground tissue solution again and let it stand for 5 minutes;

[0068] 27. Add 200 μl enzyme-free sterile water (DEPC treated) and shake to mix;

[0069] 28. Place the mixed centrifuge tube into a microcentrifuge and centrifuge at 12000 rpm for 15 min.

[0070] 29. Take 600 μl of supernatant and transfer it to another 1.5 mL centrifuge tube, then add 600 μl of isopropanol;

[0071] 210. Shake and mix, and place in an ice box for 5 minutes;

[0072] 211, centrifuge at 12000 rpm for 10 min;

[0073] 212. Remove the supernatant and add 75% anhydrous ethanol for rinsing;

[0074] 213, centrifuge at 12000 rpm for 5 min;

[0075] 214. Repeat the operations of 212 and 213;

[0076] 215. Remove the supernatant and air-dry for 15 minutes;

[0077] After air drying, add 60 μl of enzyme-free sterile water (DEPC treated), determine the concentration of the extracted total RNA using an ultra-microphotometer, and determine the purity of the total RNA using nucleic acid gel electrophoresis technology.

[0078] 3. cDNA Synthesis

[0079] The extracted RNA was used as a template for reverse transcription and cDNA synthesis. The specific steps refer to the reverse transcription reagent (model: II 1st Strand cDNA Synthesis Kit + gDNA wiper) instructions.

[0080] (1) Genomic DNA removal

[0081] Prepare the following reaction system in a 200 μl microcentrifuge tube:

[0082]

[0083] Pipette up and down 5-8 times to mix the solution, then heat the microcentrifuge tube in a 42℃ metal bath for 2 minutes.

[0084] (2) First-strand cDNA synthesis reaction

[0085] Prepare the following synthetic reaction solution

[0086]

[0087] Oscillate the centrifuge tube on a shaker for 5-10 seconds, then place it in a mini desktop centrifuge and centrifuge for 5-10 seconds. After the solution is mixed, place it in a gradient PCR instrument and perform cDNA synthesis under the following conditions:

[0088]

[0089] After the reaction was completed, 60 μL of enzyme-free sterile water (DEPC-treated) was added to the cDNA solution, the mixture was shaken and mixed, and the prepared cDNA solution was placed in a -20°C low-temperature refrigerator for storage.

[0090] 4. PCR amplification

[0091] (1) PCR amplification

[0092] Using the DNA primers connected to the T7 promoter and the prepared cDNA solution as a template, PCR amplified the target gene sequence of 341 bp in size as a template for in vitro transcription synthesis of dsRdSnf7. The specific PCR reaction system and reaction conditions are as follows:

[0093] PCR reaction system

[0094]

[0095] PCR reaction conditions

[0096]

[0097] Prepare 1.5% agarose gel to detect the PCR product, with an electrophoresis voltage of 170 V and an electrophoresis time of 15 min. Use a 2000 bp DNA marker as a reference to confirm that the PCR product is a single band and is in the correct position before proceeding to the next step of purification.

[0098] 5. PCR Purification

[0099] The PCR product was purified according to the instructions of MiniBEST DNA Fragement Purification Kit Ver.4.0 (Takara).

[0100] 6. In vitro synthesis of dsRdSnf7

[0101] After the target fragment linked to the T7 promoter was amplified and purified by PCR, the target fragment was transcribed using the T7RiboMAXTM Express RNAi System kit of Promega Company to synthesize double-stranded RNA with interference effect in vitro.

[0102] 3. Preparation of dsEGFP

[0103] 1. Primer design

[0104] The synthesis steps of dsEGFP are basically the same as those of dsRdSnf7. The synthesis template is an engineered bacterium (E. coli) transformed with a plasmid vector containing an EGFP gene fragment provided by Nanjing Agricultural University. Using Primer Primier5 software, a gene amplification fragment with a total length of 420 bp was designed at base positions 1 to 420, and a T7 promoter sequence was also added to the 5' end of the upstream and downstream primers to synthesize dsEGFP.

[0105] The sequences of the specific T7 DNA primers used are as follows:

[0106] DsEGFP-420-T7-F

[0107] 5'-TAATACGACTCACTATAGGGGATTAAGTTCAGCGTGTCCG-3'

[0108] DsEGFP-420-T7-R

[0109] 5'-TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTCT-3'.

[0110] 2. Bacteria recovery

[0111] The obtained bacterial liquid needs to be revived to obtain Escherichia coli with stronger vitality for subsequent PCR amplification experiments.

[0112] 3. Plasmid extraction

[0113] The plasmid was extracted by adsorption column method.

[0114] 4. PCR amplification

[0115] The EGFP gene was amplified using the plasmid extracted above and T7 primer.

[0116] 5. PCR Purification

[0117] The operation is the same as the above PCR purification.

[0118] 6. In vitro synthesis of dsEGFP

[0119] The operation was the same as the in vitro synthesis of dsRdSnf7. After synthesis, the synthesis of dsEGFP was detected by gel electrophoresis.

[0120] 4. Verification of the lethal effect of dsRdSnf7

[0121] 1. Detection of adult starvation survival rate

[0122] 30 adult MJ strain rice borers were placed in a clean disposable culture dish for starvation treatment. Three replicates were set up and the death of the test insects was observed every day. The results are as follows:

[0123] Depend on Figure 1 The results showed that the MJ strain of adult grain borers began to die on the third day of starvation, and then the death rate increased every day until the 14th day, when all the test insects died. Among them, the mortality rate of the test insects did not suddenly increase, which ruled out the possibility of death due to starvation for subsequent lethal gene experiments.

[0124] 2. Test the effect of lethal genes

[0125] The main purpose is to study whether dsRdSnf7 has a lethal effect on adults of the rice borer. Three replicates were set for each treatment group and control group. Weigh 50g of brown rice, control the moisture content at 12±0.5%, put it into a 50ml beaker, spray 200ng / μL dsRdSnf7, dsEGFP and DEPC water on the surface of the brown rice, stir and mix, and air dry naturally for use. Pick the MJ strain adults and starve them for 2 days. Put 50 starved test insects into the air-dried brown rice samples respectively, and record the death of the test insects every day. The results are as follows:

[0126] Depend on Figure 3 It can be seen that in the one-week observation, there was no obvious death of the test insects in the dsRdSnf7 experimental group in the first three days. Most of the dead test insects died of their own reasons. After the fourth day of feeding, the test insects died in large numbers. Finally, the mortality rate reached 100% on the sixth day, while the test insects in the dsEGFP and DEPC control groups almost did not die. This shows that 200ng / μL dsRdSnf7 has a lethal effect on the MJ strain test insects, and the effect is significant.

[0127] 3. Detection of the difference in RdSnf7 expression in test insects at different developmental stages

[0128] The 4th instar larvae with enlarged and straight bodies, the milky white pupa test insects and the black grain borer adults were stripped from the wheat grains, and the total RNA was extracted. After synthesizing cDNA, fluorescence quantitative PCR was performed. The relative expression of Snf7 in the test insects at three different developmental stages was analyzed using qPCR primers. The results are as follows:

[0129] Can be obtained from Figure 2 It can be seen that there is no obvious difference in the expression level of Snf7 in the pupal and adult stages compared with the 4th instar larvae. The pupal stage is slightly lower than the 4th instar larvae and adult stages, but there is no significant difference, which proves that the gene is expressed in the 4th instar larvae, pupal stage and adult stage of the test insect, and will not change significantly with the development stage, and is relatively stable.

[0130] 4. Analysis of target gene expression patterns in RNAi test insects.

[0131] Low concentration (10 ng / μL) and very low concentration (1 ng / μL) dsRdSnf7 solutions were used to interfere with the test insects. 3-5 test insects were selected every 2 days for gene expression pattern analysis. The expression level of the Snf7 gene in the test insects after different interference times was obtained by fluorescent quantitative PCR reaction, and then the Graphpad Prism image analysis software was used to draw the Figure 6 .

[0132] Depend on Figure 6 As shown in the figure, after 2 days of feeding, the Snf7 gene in the MJ strain test insects was interfered by dsRNA, and the expression level was significantly reduced. On the 4th day, the expression level of the target gene was reduced to 20% of the untreated level. As the feeding time increased, after the 6th day, the expression level of the target gene in the test insects increased. This may be because the defense mechanism in the test insects affected the silencing efficiency of dsRNA on the target gene, thereby inhibiting the lethal effect.

[0133] 5. Detection of the sensitivity of adults of different resistant strains to dsRdSnf7

[0134] Based on the fact that dsRdSnf7 can cause significant lethal effects on the MJ strain test insects, the experiment studied whether the test insects of different phosphine-resistant strains have different sensitivities to the effects of the lethal gene. The experiment used GX (sensitive strain, phosphine resistance multiple Rf = 7.5) and XD (extremely high resistance strain, phosphine resistance multiple Rf = 1173.63) as experimental test insects, and carried out feeding experiments according to the same experimental operation of the MJ strain. The number of test insect deaths was recorded daily, and the analysis results are as follows:

[0135] Depend on Figure 4 It can be seen that, in the case of no obvious death in the control group, the mortality rate of the test insects of the three strains of MJ, XD, and GX reached 100% within one week of feeding. Among the test insects with different resistance, the extremely high-resistant XD strain test insects showed a lower mortality rate on the 4th and 5th days. However, as the feeding time was prolonged, the test insects still began to die on a large scale on the 6th day, which means that in the short term, the higher the resistance multiple of phosphine, the ability of the test insects to resist dsRNA will be appropriately improved, and then eventually, the target gene will still be interfered with, eventually leading to death, indicating that phosphine resistance has little effect on the dsRNA interference effect, and can be widely used throughout the country to prevent and control grain borers with different phosphine resistance multiples.

[0136] 6. Detection of lethal effects of different concentrations of dsRdSnf7

[0137] The present invention is based on the fact that 200ng / μL dsRdSnf7 has an obvious lethal effect on the test insects of grain borers. However, at the current stage, dsRNA solutions cannot be mass-produced on a large scale. dsRNA solutions with lower concentrations can greatly reduce the cost of use. This experiment aims to explore the lethal effect of dsRdSnf7 on the test insects of grain borers at different concentrations. Due to the conclusion drawn in the previous experiment, the phosphine-resistant strain has little effect on the sensitivity of the test insects to dsRdSnf7. Therefore, this experiment only selects MJ strain test insects for lethal gene concentration screening, and dilutes the dsRNA solution to 200ng / μL, 100ng / μL, 50ng / μL, 10ng / μL, and 1ng / μL five concentrations. After the above-mentioned starvation treatment, the test insects are placed in the sample for feeding, and the number of deaths is recorded daily.

[0138] Depend on Figure 5 It can be seen that, in the case of no obvious death in the control, the lethal effect of different concentrations of dsRdSnf7 on the test insects also changed. The number of daily test insect deaths decreased slightly with the decrease of the lethal gene concentration. Among them, the samples with three concentrations of 200ng / μL, 100ng / μL, and 50ng / μL can cause 100% death of the test insects after feeding for one week. The mortality rate of the 10ng / μL test insects is slightly lower, reaching 90%. Until the 8th day, all the test insects died, while the effect of 1ng / μL on the test insects was poor, only reaching 70% mortality. In summary, the concentration of lethal genes has a great influence on the effect of test insects. The lower the concentration, the worse the knockdown of the target gene of the test insects, and the less obvious the lethal effect. Although the lethal gene at 10 ng / μL failed to cause 100% mortality to the test insects within one week of feeding, all the test insects died on the 8th day. Therefore, 10 ng / μL was selected as the fixed concentration for subsequent lethal experiments.

[0139] 7. Detection of the lethal effect of dsRdSnf7 in different grains

[0140] Rice and wheat were sprayed with 10 ng / μL dsRdSnf7, and the death of the test insects was observed and recorded every 24 hours to explore whether there was any difference in the lethal effect of dsRNA solution on rice borers when applied to different grains. Figure 7 As shown:

[0141] The results of the rice group show that under normal circumstances, the rice borer cannot survive in rice. This may be due to the high hardness of the rice shell, which makes it impossible for the rice borer to feed and eventually starve to death, so the mortality rate of the control group can reach 40%. Although the mortality rate of the control group is higher, the rice treated with the lethal gene can still cause a lethal effect on the test insects of the rice borer. Compared with the rice group, the brown rice and wheat have thin epidermis, which allows the rice borer to feed well. The control group is less than 20%, while the treatment group has a higher mortality rate. The mortality rate of the wheat group test insects in the first 7 days was only 25%, and the lethal effect was minimal. After the 8th day, the test insects suddenly died in large numbers, eventually reaching 61.2%. Compared with previous experiments, the lethal situation has a certain lag. Although in this experiment, the temperature and humidity for the test insects to survive were not suitable, the mortality rate of the brown rice group test insects within 8 days can still reach 90.2%, and the lethal effect is very significant. In summary, dsRdSnf7 can cause significant lethal effects on rice borers in three different types of grains, namely rice, brown rice and wheat, but there are certain differences in the lethal effects. The lethal efficiency is: brown rice group > rice group > wheat group.

[0142] Gene sequence list:

[0143]

[0144]

[0145] The preferred embodiments of the present invention are described above with reference to the accompanying drawings, but the scope of the rights of the present invention is not limited thereto. Any modification, equivalent substitution and improvement made by a person skilled in the art without departing from the scope and essence of the present invention should be within the scope of the rights of the present invention.

Claims

1. A rice borer lethal gene dsRdSnf7, characterized in that: The gene sequence of dsRdSnf7 is: CGATGGAACGCTCACAACTATCGAGCTGCAGAGACAGACCCTCGAAGATGCCAGCACAAGCGGACAGGTGTTGTCTACGATGAAGAATGCAGCGGATGCGCTCAAGATTGCCCACAAGAATATGGATATCGACCAAGTCCACGATATGATGGATGACATTGCC GAACAGCAGGATATCGCGAATGAAATATCGAATGCCATTAGTAACCCGGTTGCCTTCGGACAGGACATCGACGAGGATGAACTGGAAAAGGAACTGGAGGAATTAGAACAAGAACAGTTGGACGAGAACCTCATCAAGATCCCAACGAAGCCGATTACGGACGATTTGCCGACTGTGCC.

2. A method for preparing a rice borer lethal gene dsRdSnf7, characterized in that: The steps include: S1. Based on the CDS sequence of the known lethal gene Snf 7 of potato beetle as a template, the homologous gene RdSnf7 in Leptinotarsa ​​decemlineata was screened through blast analysis; S2. Primer design: Primer Primer 5 software was used to design primers. 341 bp was selected from base positions 237 to 578 as the target site sequence for synthesizing dsRNA, and T7 promoter sequences were added to the 5' ends of the upstream and downstream primers to synthesize DNA primers containing T7 promoters. The sequences of the DNA primers are as follows: RdSnf7-341-T7-F 5'-TAATACGACTCACTATAGGGCGATGGAACGCTCACA-3'; RdSnf7-341-T7-R 5'-TAATACGACTCACTATAGGGGGCACAGTCGGCAAAT-3'; S3, total RNA extraction, take the test grain borer, freeze it quickly in liquid nitrogen and then extract total RNA; S4, cDNA synthesis, using the extracted total RNA as a template, reverse transcription, and synthesis of cDNA; S5. PCR amplification: using DNA primers connected to a T7 promoter and the prepared cDNA solution as a template, PCR amplification of a target gene sequence of 341 bp in size was performed as a template for in vitro transcription synthesis of dsRdSnf7; S6, PCR purification: the PCR amplification product was purified according to the instructions of MiniBEST DNA Fragement Purification Kit Ver.4.0; S7, using the T7 RiboMAXTM Express RNAi System kit to transcribe the target fragment and synthesize dsRdSnf7 with interference effect in vitro; The sequence of RdSnf7 is: ATGAGTTTTTTTACGAAAATTTTCGGTGGGAAAAAGGACGACGATGCTCCGACACCAGCACAGGCCATCCAGAAACTCAGGGAAACTGAGGACATGCTGATAAAGAAACAGGAATTCTTAGAGAAGAAAATTGAACTAGAAACTGCATTAGCCAAGAAGAATGCCTCCACAAACAAAAGAATAGCGATACAGGCGCTGAAGAGGAAGAAGAGATACGAAAAACAACTGCAGCAGATCGATGGAACGCTCACAACTATCGAGCTGCAGAGACAGACCCTCGAAGATGCCAGCACAAGCGGACAGGTGTTGTCTACGATGAAGAATGCAGCGGATGCGCTCAAGATTGCCCACAAGAATATGGATATCGACCAAGTCCACGATATGATGGATGACATTGCCGAACAGCAGGATATCGCGAATGAAATATCGAATGCCATTAGTAACCCGGTTGCCTTCGGACAGGACATCGACGAGGATGAACTGGAAAAGGAACTGGAGGAATTAGAACAAGAACAGTTGGACGAGAACCTCATCAAGATCCCAACGAAGCCGATTACGGACGATTTGCCGACTGTGCCGCAAGCGGAACCTGCCAAGCCGAAGCCTTCAAAGAAAGTGGAAGACGACGACGATATGAAAGAACTGGAGGCCTGGGCATCA; The gene sequence of dsRdSnf7 is: CGATGGAACGCTCACAACTATCGAGCTGCAGAGACAGACCCTCGAAGATGCCAGCACAAGCGGACAGGTGTTGTCTACGATGAAGAATGCAGCGGATGCGCTCAAGATTGCCCACAAGAATATGGATATCGACCAAGTCCACGATATGATGGATGACATTGCC GAACAGCAGGATATCGCGAATGAAATATCGAATGCCATTAGTAACCCGGTTGCCTTCGGACAGGACATCGACGAGGATGAACTGGAAAAGGAACTGGAGGAATTAGAACAAGAACAGTTGGACGAGAACCTCATCAAGATCCCAACGAAGCCGATTACGGACGATTTGCCGACTGTGCC.

3. The method for preparing the rice borer lethal gene dsRdSnf7 according to claim 2, characterized in that: The specific method for synthesizing dsRdSnf7 in vitro comprises the following steps: S1. Prepare the dsRdSnf7 in vitro synthesis system, pipette up and down 8-10 times, observe that there is no oily liquid in the solution, and then incubate it in a 37℃ gradient PCR instrument for 3-5 hours; S2. Heat shock in a 70℃ water bath for 10 min, take out the centrifuge tube and put it in a plastic box filled with 70℃ hot water, let it stand at room temperature for 20 min, and then slowly cool it down to room temperature; S3. After the annealing operation is completed, the single / double-stranded DNA and ssRNA in the solution are removed; S4, centrifugation at 12000 g for 10 min; S5, discard the supernatant, add 500 µL 70% ethanol, and centrifuge at 12000 g for 5 min; S6, repeat operation S5 once; S7. Discard the supernatant, carefully remove the residual ethanol, and air-dry the mixture in a clean bench at room temperature for 15 min. After air-drying, add 2-5 times the initial reaction volume of RNase-free water to dissolve the product. S8. Use an ultra-micro spectrophotometer to measure the concentration of the diluted dsRdSnf7 solution, prepare 1.5% agarose gel, and detect the purity of dsRdSnf7 at a voltage of 170 V for 15 minutes.

4. An application of a rice borer lethal gene dsRdSnf7 in controlling stored grain pests, the rice borer, characterized in that: The gene sequence of dsRdSnf7 is: CGATGGAACGCTCACAACTATCGAGCTGCAGAGACAGACCCTCGAAGATGCCAGCACAAGCGGACAGGTGTTGTCTACGATGAAGAATGCAGCGGATGCGCTCAAGATTGCCCACAAGAATATGGATATCGACCAAGTCCACGATATGATGGATGACATTGCCGAACAGCAGGATATCGCGAATGAAATATCGAATGCCATTAGTAACCCGGTTGCCTTCGGACAGGACATCGACGAGGATGAACTGGAAAAGGAACTGGAGGAATTAGAACAAGAACAGTTGGACGAGAACCTCATCAAGATCCCAACGAAGCCGATTACGGACGATTTGCCGACTGTGCC。

Images