Serine / threonine protein kinase tapix7-nw and use thereof
By overexpressing the serine/threonine protein kinase TaPIX7-NW in wheat plants, gene editing technology was used to solve the problems of reproductive isolation and toxicity variation in traditional breeding methods, thereby achieving broad-spectrum enhanced resistance to stripe rust in wheat and providing a new pathway for breeding disease-resistant varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2024-05-30
- Publication Date
- 2026-06-05
AI Technical Summary
Traditional disease-resistant breeding suffers from reproductive isolation and incompatibility in distant hybridization, making it difficult to achieve targeted improvement of target traits in a short period of time. Furthermore, the rapid mutation of stripe rust fungi makes it difficult to control wheat stripe rust in the long term.
Gene function studies revealed that the serine/threonine protein kinase TapIX7-NW plays a positive regulatory role in the wheat stripe rust invasion defense response. By using Agrobacterium-mediated genetic transformation technology to overexpress its encoding ORF sequence in wheat plants, wheat resistance to stripe rust was enhanced.
In a relatively short period of time, the transgenic wheat broke through the barriers between species, achieved targeted improvement of wheat disease resistance, provided broad-spectrum and long-lasting disease protection, and showed significant resistance to stripe rust.
Smart Images

Figure CN118421593B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology and relates to serine / threonine protein kinase TaPIX7-NW and its applications, specifically to serine / threonine protein kinase TaPIX7-NW and its application in improving wheat stripe rust resistance. Background Technology
[0002] Wheat, as one of the most widely planted and highest-yielding cereal crops globally, reportedly feeds 30%-45% of the world's population. Wheat stripe rust, caused by the wheat-specific spore fungus *Puccinia striiformis* f. spritici (Pst), is a fungal disease occurring in almost every major wheat-growing region worldwide, severely impacting wheat yields. Frequent variations in the virulence of the stripe rust fungus lead to frequent outbreaks of wheat stripe rust and the overcoming of resistance in existing varieties. Therefore, the rational utilization of disease-resistant genes to create resistant materials is the most economical, effective, and sustainable development strategy for controlling wheat stripe rust.
[0003] Protein kinases, also known as protein phosphorylases, are a class of enzymes that catalyze the phosphorylation of proteins. Protein kinases transfer the γ-phosphate from adenosine triphosphate (ATP) to amino acid residues in protein molecules. Protein kinases can be classified into the following families: serine / threonine protein kinases, tyrosine-specific protein kinases, histidine-specific protein kinases, tryptophan kinases, and aspartate / glutamyl protein kinases. Serine / threonine protein kinases utilize ATP as a phosphate donor to catalyze the phosphorylation of serine or threonine residues on target proteins. Besides participating in the initiation of co-stimulatory signals, these kinases generally function in the mid-to-downstream of signal transduction. Due to the cross-talking nature of signaling pathways, serine / threonine kinases are often shared by various immune cells and different receptor-mediated signaling pathways. Further research has revealed that members of the serine / threonine protein kinase family not only regulate plant growth and development but also play important roles in plant disease resistance and stress tolerance, and can participate in plant hormone signaling pathways.
[0004] Currently, chemical control is the primary method for controlling wheat stripe rust, and the environmental and food safety hazards posed by chemical pesticides have drawn widespread attention. Disease-resistant breeding is one of the most economical and effective measures for controlling wheat stripe rust. However, the discovery of disease-resistant genes is time-consuming, the cultivation of resistant varieties is difficult, and the stripe rust fungus exhibits rapid virulence variation, making it challenging to achieve sustained control of the disease. Therefore, creating broad-spectrum, long-lasting disease-resistant materials is the fundamental approach and key technology for controlling wheat stripe rust. Summary of the Invention
[0005] The purpose of this invention is to address the challenges of reproductive isolation and incompatibility in distant hybridization in traditional disease-resistant breeding, which makes it difficult to achieve targeted improvement of the target trait within a short breeding cycle. At the same time, the rapid virulence variation of stripe rust fungi makes long-term control of wheat stripe rust still a significant challenge under current technological conditions.
[0006] To address this need in the field, this invention provides a serine / threonine protein kinase, TaPIX7-NW, and its applications. This invention aims to further explore the innate immune defense mechanisms of wheat, identify disease-resistant genes that play a positive regulatory role in the defense response against wheat stripe rust, and provide a new pathway for creating wheat-resistant materials to control wheat stripe rust through gene function research.
[0007] On one hand, the present invention relates to a serine / threonine protein kinase TaPIX7-NW, the amino acid sequence of which is shown in SEQ ID NO: 1; and the encoding ORF sequence of which is shown in SEQ ID NO: 2.
[0008] On the other hand, the present invention relates to the application of serine / threonine protein kinase TapIX7-NW in the breeding of wheat varieties resistant to stripe rust.
[0009] Furthermore, in the application provided by the present invention, the ORF sequence encoding the serine / threonine protein kinase TapIX7-NW is expressed through Agrobacterium-mediated genetic transformation and plays a positive regulatory role in the interaction between wheat and stripe rust fungus. Overexpression of the ORF sequence encoding the serine / threonine protein kinase TapIX7-NW can enhance the resistance of wheat to stripe rust pathogen.
[0010] On the other hand, the present invention relates to a method for breeding wheat varieties resistant to stripe rust, which involves expressing serine / threonine protein kinase TapIX7-NW in the plant or transferring the encoding ORF sequence of serine / threonine protein kinase TapIX7-NW into the plant.
[0011] Furthermore, the method for breeding wheat varieties resistant to stripe rust provided by the present invention includes: transforming the encoding ORF sequence of the serine / threonine protein kinase TapIX7-NW into the cells of the plant to obtain a plant variety with gene-edited serine / threonine protein kinase TapIX7-NW.
[0012] Furthermore, the method for breeding wheat varieties resistant to stripe rust provided by the present invention includes: constructing an editing vector containing the encoding ORF sequence of the serine / threonine protein kinase TapIX7-NW; and transforming the plant embryos using Agrobacterium-mediated genetic transformation to obtain plant varieties with gene-edited serine / threonine protein kinase TapIX7-NW.
[0013] Furthermore, in the method for cultivating wheat varieties resistant to stripe rust provided by the present invention, the plant is a monocotyledonous plant, the monocotyledonous plant is a cereal crop, and the cereal crop is wheat.
[0014] Compared with the prior art, the beneficial effects or advantages of the present invention are as follows:
[0015] (1) Compared with traditional disease-resistant breeding techniques, plant disease-resistant genetic engineering technology can overcome reproductive isolation and incompatibility between species, achieving targeted improvement of target traits in a shorter time and providing crops with more comprehensive, continuous, and broad-spectrum protection. This invention, through gene function research, discovered that the serine / threonine protein kinase TapIX7-NW plays a positive regulatory role in the defense response against stripe rust in wheat; that is, overexpression of the ORF sequence encoding TapIX7-NW can enhance wheat's resistance to stripe rust. Overexpression of the ORF sequence encoding TapIX7-NW in plants can confer certain disease resistance.
[0016] (2) This invention provides a method for breeding wheat varieties resistant to stripe rust. This method utilizes genetic engineering technology to overexpress the serine / threonine protein kinase TaPIX7-NW in wheat plants, thereby enhancing wheat's resistance to stripe rust pathogens. Verification has shown that the transgenic wheat obtained using this method exhibits resistance to the main prevalent races of stripe rust. This invention provides a new technical approach for breeding wheat varieties resistant to stripe rust from a molecular biology perspective, effectively solving the technical problems of this invention. Attached Figure Description
[0017] Figure 1 This is a schematic diagram of the expression profile analysis of the wheat receptor protein kinase TaPIX7-NW gene. Affinity is defined as the TaPIX7-NW gene inoculated with stripe rust fungus CYR23 in wild-type wheat Fielder, while incompatibility is defined as the TaPIX7-NW gene inoculated with stripe rust fungus CYR31 in wild-type wheat Fielder.
[0018] Figure 2This is a schematic diagram showing the phenotypic results of wheat receptor protein kinase TaPIX7-NW gene editing followed by inoculation with CYR23. TaPIX7-NW-KO represents TaPIX7-NW gene-edited plants inoculated with stripe rust fungus CYR31. Fielder is a wild-type wheat variety, and CYR31 is a stripe rust fungus line that interacts with Fielder.
[0019] Figure 3 To obtain the wheat receptor protein kinase TaPIX7-NW gene editing vector diagram.
[0020] Target1 and Target2 are the two target sgRNAs of the TaFER-NW gene; TaU6 is the promoter that initiates Target1 and Target2; Cas9 is the core element of the gene editing system that encodes the Cas9 protein; and ZmUbi is the maize ubiquitin promoter that initiates Cas9 expression.
[0021] Figure 4 This is a schematic diagram showing the PCR detection results of wheat receptor protein kinase TaPIX7-NW gene-edited plants. L1–L6 represent different TaPIX7-NW gene-edited lines.
[0022] Figure 5 This is a schematic diagram of the detection results for the wheat receptor protein kinase TaPIX7-NW gene editing. Detailed Implementation
[0023] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.
[0024] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings. However, the embodiments described are not intended to limit the present invention.
[0025] Unless otherwise specified, the experimental and detection methods described in the following embodiments are conventional methods; unless otherwise specified, the reagents and materials are commercially available.
[0026] Example
[0027] This invention provides the application of the serine / threonine protein kinase TapIX7-NW in the improvement of wheat rust-resistant varieties.
[0028] To ensure a complete and unambiguous understanding of the technical solution of this invention, it should be noted that the serine / threonine protein kinase described in this invention is represented by the non-italicized font "TaPIX7-NW", while the serine / threonine protein kinase gene or encoding ORF sequence is represented by the italicized font "TaPIX7-NW". Of course, those skilled in the art can clearly and completely understand the meaning and description of the relevant genes and their encoded proteins based on the description of this invention.
[0029] By using plant gene editing technology, the wheat serine / threonine protein kinase TaPIX7-NW gene was transformed into wheat cells, resulting in a wheat variety with gene-edited TaPIX7-NW protein kinase.
[0030] The application of the wheat serine / threonine protein kinase TaPIX7-NW provided in this invention embodiment in the breeding and improvement of wheat rust-resistant varieties also includes:
[0031] An editing vector containing the wheat serine / threonine protein kinase TaPIX7-NW gene was constructed; wheat embryos were transformed using Agrobacterium-mediated genetic transformation to obtain wheat with the TaPIX7-NW gene edited.
[0032] like Figure 1 As shown in the embodiments of the present invention, the verification method for the application of wheat serine / threonine protein kinase TapIX7-NW in breeding and improving wheat rust-resistant varieties includes:
[0033] S101, Obtain TaPIX7-NW gene-edited wheat, and perform molecular detection on the obtained TaPIX7-NW gene-edited wheat;
[0034] S102, T1 generation gene-edited plants were inoculated with the prevalent stripe rust race CYR23, and the resistance of the gene-edited plants to the prevalent stripe rust race was identified.
[0035] The functional identification method provided in this embodiment of the invention includes:
[0036] Based on qRT-PCR with the elongation factor gene TaEF as an internal control, real-time quantitative PCR was performed using specific primers for the protein kinase gene TapIX7-NW to determine the expression level of the TapIX7-NW gene at different infection times in wheat infected with stripe rust.
[0037] The gene TapIX7-NW was edited using CRISPR / Cas9 gene editing technology. Phenotypic results were observed 14 days after wheat was inoculated with wheat stripe rust fungus CYR23 at the two-leaf stage to identify disease resistance.
[0038] Figure 1This is a schematic diagram of the expression profile analysis of the wheat receptor protein kinase TaPIX7-NW gene. qRT-PCR was used to detect the induced expression of the TaPIX7-NW gene at different time points (1 h, 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h after inoculation with stripe rust fungus CYR23 (affinity) and stripe rust fungus CYR31 (incompatibility) in wild-type wheat Fielder.
[0039] Figure 2 This is a schematic diagram showing the phenotypic results of wheat receptor protein kinase TaPIX7-NW gene editing followed by inoculation with CYR23. TaPIX7-NW gene-edited plants (TaPIX7-NW-KO) were inoculated with stripe rust fungus CYR31, and wheat disease incidence was observed 14 days later.
[0040] The present invention provides the application of wheat serine / threonine protein kinase TaPIX7-NW in the improvement of wheat rust-resistant varieties.
[0041] The encoding ORF sequence of the wheat serine / threonine protein kinase TapIX7-NW of the present invention is SEQ ID NO: 2.
[0042] The amino acid sequence of the wheat serine / threonine protein kinase TapIX7-NW of the present invention is SEQ ID NO: 1.
[0043] The plant species used in this invention are preferably monocotyledonous cereal crops that can be successfully infected by wheat stripe rust fungus, with wheat being a particularly preferred species.
[0044] Figure 3 To obtain the wheat receptor protein kinase TaPIX7-NW gene editing vector diagram.
[0045] Target1 and Target2 are the two target sgRNAs of the TaFER-NW gene; TaU6 is the promoter that initiates Target1 and Target2; Cas9 is the core element of the gene editing system that encodes the Cas9 protein; and ZmUbi is the maize ubiquitin promoter that initiates Cas9 expression.
[0046] The application of the wheat serine / threonine protein kinase TapIX7-NW in the improvement of wheat rust-resistant varieties, as provided in this embodiment of the invention, includes the following steps:
[0047] The obtained TapIX7-NW gene-edited plants, when inoculated with the incompatible strain CYR23, showed a significant decrease in wheat disease resistance, indicating that TapIX7-NW plays a positive regulatory role in the interaction between wheat and stripe rust fungus.
[0048] TaPIX7-NW gene-edited plants were created using Agrobacterium-mediated genetic transformation. Phenotypic identification of the gene-edited plants after inoculation with CYR23 revealed that the TaPIX7-NW-edited plants exhibited weakened resistance to stripe rust fungus CYR23.
[0049] TaPIX7-NW-cDNA-F: GGTCTTTGCCAAATTCCCACTACCCT; TaPIX7-NW-cDNA-R: CATTTACCCATCAGTGCTGGACGAGA.
[0050] This invention provides the application of the wheat serine / threonine protein kinase TaPIX7-NW in improving wheat rust-resistant varieties. Firstly, to clarify the function of TaPIX7-NW in the interaction between wheat and stripe rust fungus, expression profiles of TaPIX7-NW were analyzed at different stages in both affinity and incompatible systems of wheat infected with stripe rust fungus. The results showed that the expression level of TaPIX7-NW reached its highest level in the incompatible system after 36 hours of stripe rust infection, indicating that TaPIX7-NW may play a role in wheat resistance to stripe rust fungus.
[0051] Figure 4 This diagram illustrates the PCR detection results of wheat receptor protein kinase TaPIX7-NW gene-edited plants. Transgenic positive plants were detected using Blp-F / R primers, and PCR products were detected by 1% agarose gel electrophoresis.
[0052] Quantitative primers:
[0053] TaPIX7-NW-qRT-F: GGTCTTTGCCAAATTCCCACTACCCT;
[0054] TaPIX7-NW-qRT-R:CATTTACCCATCAGTGCTGGACGAGA.
[0055] Internal reference primer:
[0056] TaEF-F:TGGTGTCATCAAGCCTGGTATGGT;
[0057] TaEF-R:ACTCATGGTGCATCTCAACGGACT.
[0058] SEQ ID NO: 5:
[0059] Gene editing target design:
[0060] TaPIX7-NW-Target1-F:actcAAGGTCGACTCCTCCACCAG;
[0061] TaPIX7-NW-Target1-R:aaacCTGGTGGAGGAGTCGACCTT.
[0062] TaPIX7-NW-Target1-F: actcGTATACGAATTTATGCCCCG;
[0063] TaPIX7-NW-Target1-R:aaacCGGGGCATAAATTCGTATAC.
[0064] Primers for detecting transgenic positive plants:
[0065] Blp-F: GCAAGACCTCTCTCTATAAGG;
[0066] Blp-R:TCAGATCTCGGTGACGGGCAGGACC.
[0067] Sequence information of TapIX7-NW was detected in Fielder and TapIX7-NW-KO plants, as follows: Figure 5 As shown. Figure 5 This is a schematic diagram illustrating the detection results of wheat receptor protein kinase TapIX7-NW gene editing. The TapIX7-NW gene sequence was amplified by PCR in Fielder and TapIX7-NW gene-edited materials, and then compared after sequencing.
[0068] The application of wheat serine / threonine protein kinase TaPIX7-NW in improving wheat rust-resistant varieties, as provided in this embodiment of the invention, involved PCR detection of gene-edited plants obtained through Agrobacterium-mediated genetic transformation. Three strains, L1, L2, and L3, from the T1 generation were inoculated with the prevalent race CYR23. The results showed that the wheat serine / threonine protein kinase TaPIX7-NW gene-edited plants exhibited weakened resistance to stripe rust.
[0069] In summary, the application of the wheat receptor protein kinase TapIX7-NW in the improvement of wheat rust-resistant varieties provided in this embodiment of the invention utilizes gene editing technology to construct a gene editing vector for the TapIX7-NW gene. This vector is then delivered to the recipient wheat Fielder through Agrobacterium-mediated wheat genetic transformation. The resulting transformed plants were tested for positive plants by PCR and gene editing type detection, revealing a mutant, TapIX7-NW-KO. Three lines (L1, L2, and L3) from the T1 generation were inoculated with stripe rust fungus CYR23. After 14 days, observation showed that the wheat receptor protein kinase TapIX7-NW gene-edited plants exhibited significantly greater sporulation compared to Fielder plants, indicating weakened resistance.
[0070] As described above, the present invention can be well implemented. The above embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, all changes and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the present invention.
Claims
1. The application of serine / threonine protein kinase TaPIX7-NW in the breeding of wheat varieties resistant to stripe rust, characterized in that, The encoding ORF sequence of the serine / threonine protein kinase TapIX7-NW is shown in SEQ ID NO:
2. The encoding ORF sequence of the serine / threonine protein kinase TapIX7-NW is expressed by Agrobacterium-mediated genetic transformation and has a positive regulatory role in the interaction between wheat and stripe rust fungus. Overexpression of the encoding ORF sequence of the serine / threonine protein kinase TapIX7-NW can enhance the resistance of wheat to stripe rust fungus.