EsSPL6 gene and its function verification method and application

Abstract

The present invention discloses an EsSPL6 gene capable of improving the drought resistance of Siberian barley. The EsSPL6 gene has the function of positively regulating the drought resistance of plants, and provides scientific basis and new materials for the research directions such as the breeding of drought-resistant Siberian barley varieties and understanding the drought resistance mechanism of plants; in addition, the present invention provides a method for verifying the function of the EsSPL6 gene, starting from the intrinsic regulatory mechanism of Siberian barley drought stress, and applying transgenic Arabidopsis for functional verification, which has research depth and breadth, obvious technical effects, and can obtain plant strains with intended phenotypes; and adopts a variety of indicators for evaluating the degree of drought stress, which has a good evaluation effect, and each indicator verifies each other, constructs a scientific evaluation system, and can accurately verify the function of the EsSPL6 gene. After verification, the EsSPL6 gene has a positive regulatory effect on the drought resistance of Siberian barley, and can significantly improve the drought resistance of Siberian barley and the ability to resist drought stress. It is suitable for promotion and application in the field of biotechnology.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an EsSPL6 gene and a function verification method and application thereof. Background Art

[0002] Elymus sibiricus L. is the model species of the genus Elymus L., a perennial sparse-clumped mesophilous plant, allotetraploid (genome is StStHH, 2n=4X=28). Elymus sibiricus L. is cold-resistant, high-yielding and easy to cultivate. It is the highest-yielding perennial forage grass in the Qinghai-Tibet Plateau. It has a high crude protein content and good palatability. It can form a dominant species or community-building species in meadow steppe plant communities. It is widely used for grazing, grassland cultivation, grassland restoration and reconstruction, etc. It is one of the most widely used grass species in the alpine meadow steppe area of ​​the Qinghai-Tibet Plateau. Drought is one of the most serious natural disasters in the world. It has the greatest impact on plant growth and yield. It has become an important issue that restricts the development of modern agriculture and affects plant growth and development. Therefore, understanding the drought-resistant physiology and genetic basis of Elymus sibiricus forage grasses such as Elymus sibiricus and then breeding new varieties of Elymus sibiricus with high drought resistance can not only increase the yield and seed yield of high-quality forage grasses cultivated on the Qinghai-Tibet Plateau, but also serve as sand-fixing and soil-fixing plants for improving desertified and compacted grasslands, which is also of great significance for the ecological protection of the region.

[0003] Transcription factors are a class of regulatory factors that can regulate the transcription of structural genes by recognizing specific cis-acting elements in the promoters of structural genes. SPL transcription factors are involved in regulating various abiotic stresses and act as transcriptional activators or repressors by up-regulating or down-regulating the expression of downstream target genes during abiotic stresses, thereby leading to stress tolerance or stress sensitivity phenotypes. Drought stress in Elymus sibiricus is regulated by intrinsic transcription factors. Exploring the intrinsic regulatory mechanism of drought stress has important practical significance. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide an EsSPL6 gene capable of improving the drought resistance of Siberian sibiricum.

[0005] The technical solution adopted by the present invention to solve the technical problem is: the coding region sequence of the EsSPL6 gene is shown in the sequence table SEQ ID NO.1.

[0006] The present invention also provides a method for verifying the function of the EsSPL6 gene, and the method comprises the following steps:

[0007] 1) The coding region sequence of the EsSPL6 gene was cloned into the plant expression vector pCAMBIA1300S to generate the overexpression vector pCAMBIA1300S-EsSPL6, and the coding region sequence of the EsSPL6 gene is shown in SEQ ID NO.1; the overexpression vector pCAMBIA1300S-EsSPL6 was transformed into Columbia wild-type Arabidopsis thaliana by Agrobacterium-mediated transformation; positive transformants were screened by resistance, and the expression of EsSPL6 was detected by RT-qPCR to obtain the transformed EsSPL6 overexpression strain;

[0008] 2) The transformed EsSPL6 overexpression strain was used as the experimental material, and the wild-type Arabidopsis strain was used as the control material. The experimental and control materials were subjected to drought stress, and the indicators of the degree of drought stress of the experimental and control materials were evaluated and compared to verify whether the EsSPL6 gene has a regulatory effect on the drought resistance of Elymus sibiricus.

[0009] Furthermore, in step 1), the coding region sequence of the EsSPL6 gene was cloned into the plant expression vector pCAMBIA1300S by homologous recombination to generate the overexpression vector pCAMBIA1300S-EsSPL6, wherein the forward primer sequence was ATGGAGTGGACGGCCCCG; and the reverse primer sequence was TCAATTCATCCGGTTTACGCC.

[0010] Furthermore, in step 1), the specific process of transforming the overexpression vector pCAMBIA1300S-EsSPL6 into Columbia wild-type Arabidopsis thaliana by Agrobacterium-mediated transformation is as follows: First, the positive Agrobacterium bacterial solution is inoculated into 150 mL containing 50 μg / mL Kan and 25 μg / mL R Fif in YEB liquid culture medium, shake overnight at 28°C and 200 rpm in a shaker to culture until OD600 = 0.8-1.0; centrifuge at 4500 rpm for 10 min, collect the bacteria, and remove the supernatant; use Arabidopsis transformation solution (5% sucrose solution + 0.02% Sillwett-77 active agent + 100 acetosyringone As) to resuspend the bacteria and adjust OD600 to 0.8-1.0; immerse the Arabidopsis inflorescence that is bolting and flowering in the infection solution for about 20 seconds, culture in the dark for 24 hours after infection, and then transfer to normal light for culture, repeat the above infection steps after 7 days, and infect 3 times in total; culture normally and collect T0 generation seeds, and store them at low temperature after drying.

[0011] Furthermore, in step 1), the Arabidopsis transformation solution consists of 5% sucrose solution, 0.02% Sillwett-77 active agent, and 100 acetosyringone As.

[0012] Furthermore, in step 1), the specific process of screening positive transformants by resistance is as follows: the T0 generation seeds are disinfected and sown in a 1 / 2MS solid culture medium containing hygromycin, vernalized at 4°C for 2 days, and cultured under normal conditions for germination; the normally grown positive seedlings are transferred to nutrient soil for culture and the T1 generation seeds are collected; the single plant seeds are harvested continuously according to the above method, and the seeds are screened and cultured until the T3 generation seeds of the pure strain are obtained.

[0013] Furthermore, in step 2), the experimental materials and the control materials were subjected to drought stress treatment as follows: the drought stress treatment at the germination stage of Elymus sibiricus was 200 mM mannitol, and the drought stress treatment at the seedling stage was natural drought for 3 weeks.

[0014] Furthermore, in step 2), the indicators for evaluating and comparing the degree of drought stress of the experimental materials and the control materials include: appearance, relative water content, relative conductivity of superoxide anion, malondialdehyde content, hydrogen peroxide content, O 2 - content, superoxide dismutase activity, catalase activity, free proline content and root length during the germination period.

[0015] The present invention also finds the application of the EsSPL6 gene in improving the drought resistance of Elymus sibiricus.

[0016] The beneficial effects of the present invention are as follows: the EsSPL6 gene described in the present invention has the function of positively regulating the drought resistance of plants, and provides a scientific basis and new materials for the research directions such as the breeding of drought-resistant old sibiricum varieties and understanding the drought resistance mechanism of plants; in addition, the function verification method of the EsSPL6 gene provided by the present invention starts from the intrinsic regulatory mechanism of drought stress of old sibiricum and uses transgenic Arabidopsis for function verification, which has research depth and breadth, obvious technical effect, and can obtain plant strains with intended phenotypes; and multiple indicators for evaluating the degree of drought stress are used, which has a good evaluation effect, and each indicator verifies each other, and a scientific evaluation system is constructed, which includes drought-related key indicators: appearance traits, relative water content, superoxide anion relative conductivity, malondialdehyde content, hydrogen peroxide content, O 2 -content, superoxide dismutase activity, catalase activity, free proline content and root length in the germination period can all reflect the degree of drought stress in plants, and can accurately verify the function of the EsSPL6 gene. It has been verified that the EsSPL6 gene described in the present invention has a positive regulatory effect on the drought resistance of E. sibiricum, and can significantly improve the drought resistance and drought stress resistance of E. sibiricum. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is a comparison diagram of root lengths during the germination period of the experimental material and the control material in the embodiment of the present invention;

[0018] Figure 2 is a comparison diagram of drought stress phenotypes of the experimental materials and the control materials at the seedling stage in the embodiment of the present invention;

[0019] Figure 3 is the test result of the relative water content of the experimental material and the control material under drought stress in the embodiment of the present invention;

[0020] Figure 4 It is the test result of the relative conductivity of superoxide anion of the experimental material and the control material under the degree of drought stress in the embodiment of the present invention;

[0021] Figure 5 is the test result of the malondialdehyde content of the experimental materials and the control materials under drought stress in the embodiment of the present invention;

[0022] Figure 6 is the test result of the catalase content of the experimental materials and the control materials under drought stress in the embodiment of the present invention;

[0023] Figure 7 is the degree of drought stress of the experimental materials and the control materials in the embodiment of the present invention. 2 - Test results of content;

[0024] Figure 8 It is the test result of superoxide dismutase SOD activity of the experimental materials and the control materials under drought stress in the embodiment of the present invention;

[0025] Fig. 9 is the test result of catalase CAT activity of the experimental materials and the control materials under drought stress in the embodiment of the present invention;

[0026] Fig.10 It is the test result of the free proline (Pro) content of the experimental materials and the control materials under the degree of drought stress in the examples of the present invention. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with the embodiments.

[0028] The coding region sequence of the EsSPL6 gene is shown below:

[0029] ATGGAGTGGACGGCCCCGAAGTCCACCCCGTCCTCCCCGCCCCACCTCCTTGGGACTGG

[0030] GGTGACGCCGCCGCGCTGGGCTCCTCCGGCGAGGCGGCGGGGAGGCGCGGGAAGGAGAAG

[0031] CGGGCCAGGGGGGAGGGGGCCGGCGGAGGAGGCGGAGGAGGGGGCGTGAGGTGCCAGGTG

[0032] GAGGGCTGCGGGACCGAGCTCGCCGCCGCCAAGGAGTACCACCGGAAGCACCGGGTCTGC

[0033] GAGGCCCACACCAAGTCCCCCCGCGTCGTCGTCGCCGGCCAGGAGCGCCGCTTCTGCCAG

[0034] CAGTGCAGCCGGTTCCATGGGCTCTCGGAGTTTGACCAGAAGAAGAGGAGCTGCCGGAGG

[0035] CGACTGTCTGATCACAATGCTCGGCGCCGGAAGCCACAGCCAGACGCATTCTCCTTTGCA

[0036] CCGGCAAGGCTCCCGTCGTCATTGATGTTTGATGATAGACGGCAAATAAGTTTTGTCTGG

[0037] AATAAAGATCCACTTAGCCATGTAAGGCCTTTCCCATGTTCTCCATGGGACAGCCCATCT

[0038] GACTTCAAGCCCCCACAAGTGAAGGAAATAAGAGAAGTGTCAATCAATGGACAAGTTCAT

[0039] TTTGATAAATCTCATCTACCCAATGCTGTTCCAGCGAGTCATGGCATAGCTGAGCTGCTA

[0040] CCAATGAAAGGTCCGGACGCATCTGTAACCGCTTCGAAATTAGGTGGAGCACCGGATCTT

[0041] CAG CGCGCGCTATCGCTCCTCTCGGCTAGTTCTTGTGGAGTACCTGATCCCGTACAGCAA

[0042] GCATCTTGTCTCGTCCAATTCACTGGTGCCAGCCAAAACAGCCGGGGCCTGCCTTCGCCA

[0043] CATGGAGGGAGCCCTCCGTCGGCATCCTGTGCCGAAGGACAGCCCATGGCGCCATCGCCT

[0044] CAGTTCGTCCGTTTCACCATGGATGGCGCCAGCAGTGGCTATGAATCCACTTTCTTCGGC

[0045] GTAAACCGGATGAATTGA

[0046] Example

[0047] This example verifies the function of the EsSPL6 gene, and the function verification method specifically includes the following steps:

[0048] 1) First, the coding region sequence of the EsSPL6 gene was cloned into the plant expression vector pCAMBIA1300S by homologous recombination to generate the overexpression vector pCAMBIA1300S-EsSPL6. The coding region sequence of the EsSPL6 gene is shown in SEQ ID NO.1, wherein the forward primer sequence is ATGGAGTGGACGGCCCCG; the reverse primer sequence is TCAATTCATCCGGTTTACGCC;

[0049] Next, the overexpression vector pCAMBIA1300S-EsSPL6 was transformed into Columbia wild-type Arabidopsis thaliana by Agrobacterium-mediated transformation. The specific process is as follows: First, the positive Agrobacterium culture was inoculated into 150 mL of 50 μg / mL Kan and 25 μg / mL The cells were cultured in YEB liquid medium of Rif, shaken overnight at 28°C and 200rpm in a shaker until OD600 = 0.8-1.0; centrifuged at 4500rpm for 10min, the cells were collected, and the supernatant was removed; the cells were resuspended in Arabidopsis transformation liquid, which was composed of 5% sucrose solution, 0.02% Sillwett-77 active agent, and 100 acetosyringone As, and OD600 was adjusted to 0.8-1.0; the Arabidopsis inflorescence that was bolting and flowering was immersed in the infection liquid for about 20s, and the infection was dark cultured for 24h, and then transferred to normal light for culture, and the above infection steps were repeated after 7d, and the infection was carried out 3 times in total; the T0 generation seeds were collected and dried and stored at low temperature;

[0050] Then, positive transformants were screened by resistance, and the specific process was as follows: T0 generation seeds were disinfected and sown in 1 / 2MS solid culture medium containing hygromycin, vernalized at 4°C for 2 days, and cultured under normal conditions for germination. Non-positive Arabidopsis seeds would germinate, but as the culture time increased, their young leaves would turn yellow and gradually die; normally growing positive seedlings were transferred to nutrient soil for culture and T1 generation seeds were collected; single plant seeds were harvested continuously according to the above method, and after screening and culture, T2 generation seeds of pure and homozygous strains were obtained;

[0051] Finally, the strains obtained after culturing T2 generation seeds were screened by detecting EsSPL6 expression through RT-qPCR to obtain transformed EsSPL6 overexpression strains OE1, OE2, and OE3;

[0052] 2) The transformed EsSPL6 overexpression lines OE1, OE2, and OE3 were used as experimental materials, and the wild-type Arabidopsis line WT was used as the control material. The experimental materials OE1, OE2, OE3 and the control material WT were subjected to drought stress. The drought stress treatment method was as follows: 200 mM mannitol was used for the drought stress treatment during the germination period of Elymus sibiricus, and natural drought was used for 3 weeks during the seedling stage. The indicators of the degree of drought stress of the experimental materials and the control materials were evaluated and compared, including: appearance, relative water content, relative conductivity of superoxide anions, malondialdehyde content, hydrogen peroxide content, O 2 - content, superoxide dismutase activity, catalase activity, free proline content and root length during the germination period, such as Figure 1-10 As shown, Figure 1 is a comparison diagram of root lengths during the germination period of the experimental material and the control material in the embodiment of the present invention; Figure 2 is a comparison diagram of drought stress phenotypes of the experimental materials and the control materials at the seedling stage in the embodiment of the present invention; Figure 3 is the test result of the relative water content of the experimental material and the control material under drought stress in the embodiment of the present invention; Figure 4 It is the test result of the relative conductivity of superoxide anion of the experimental material and the control material under the degree of drought stress in the embodiment of the present invention; Figure 5 is the test result of the malondialdehyde content of the experimental materials and the control materials under drought stress in the embodiment of the present invention; Figure 6 is the test result of the catalase content of the experimental materials and the control materials under drought stress in the embodiment of the present invention; Figure 7 is the degree of drought stress of the experimental materials and the control materials in the embodiment of the present invention. 2 - Test results of content; Figure 8 It is the test result of superoxide dismutase SOD activity of the experimental materials and the control materials under drought stress in the embodiment of the present invention; Fig. 9is the test result of catalase CAT activity of the experimental materials and the control materials under drought stress in the embodiment of the present invention; Fig.10 It is the test result of the free proline (Pro) content of the experimental materials and the control materials under the degree of drought stress in the examples of the present invention.

[0053] Depend on Figure 1-10 It can be seen that under normal growth conditions, there was no significant difference in root length between WT and EsSPL6 overexpression lines OE-1, OE-2, and OE-3 (P>0.05, P means significant marker, greater than 0.05 indicates significant difference, otherwise the difference is not significant); under mannitol stress, the root length of EsSPL6 overexpression Arabidopsis was significantly longer than WT (P<0.05), with more fibrous roots, larger and brighter leaves. This shows that under drought stress, compared with WT Arabidopsis, EsSPL6 overexpression lines have better adaptability and show better growth status, indicating that the SPL transcription factor EsSPL6 has a positive regulatory effect on the drought resistance of Elymus sibiricus. The WT and EsSPL6-overexpressing Arabidopsis plants cultured normally for 20 days can grow normally without significant differences, their leaves are green and the plants are strong; however, the WT and EsSPL6-OE lines that were naturally drought-exposed for 3 weeks have different degrees of wilting and yellowing. Compared with WT, the degree of wilting and yellowing of the leaves of EsSPL6-OE plants is lower, among which the leaves of OE-3 line are relatively more yellowing, while the WT plants show obvious wilting and death. This indicates that the EsSPL6-OE line has stronger drought resistance, and the overexpression of the EsSPL6 gene can significantly improve the drought resistance of Arabidopsis plants. Under drought conditions, compared with WT Arabidopsis, the relative water content, superoxide dismutase SOD activity, catalase CAT activity and free proline content of the EsSPL6 overexpression line were higher, while the superoxide anion relative conductivity, malondialdehyde, hydrogen peroxide and superoxide anion content were lower, indicating that the overexpression of EsSPL6 improved the tolerance of Arabidopsis to drought stress, indicating that the overexpression of EsSPL6 induced significant changes in the drought resistance indicators of transgenic Arabidopsis and improved its resistance to drought stress.

Claims

1. Application of the EsSPL6 gene in improving drought resistance of Elymus sibiricus. The coding region sequence of the EsSPL6 gene is shown in the sequence table SEQ ID NO.1.

Images