Application of rice OsHsfA1 gene in regulation and control of resistance of rice to magnaporthe oryzae

Abstract

The invention discloses application of a rice OsHsfA1 gene in regulation and control of resistance of rice to magnaporthe oryzae, and belongs to the field of gene engineering. The CDS nucleotide sequence of the rice OsHsfA1 gene is as shown in SEQ ID No.2 (sequence identifier number 2). Researches show that the rice gene OsHsfA1 plays an important role in the rice blast resistance process of rice. The deletion of the OsHsfA1 gene reduces the basic defense ability of the rice to the magnaporthe oryzae, and overexpression of the OsHsfA1 gene can improve the disease resistance of the rice to the magnaporthe oryzae, so that the OsHsfA1 gene of the rice can be used for improving the resistance of the rice to the magnaporthe oryzae.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and specifically relates to the application of rice OsHsfA1 gene in regulating the resistance of rice to Magnaporthe oryzae. Background Art

[0002] As an important monocotyledonous food crop, rice has particularly prominent disease problems, and rice blast is the "number one killer" among rice diseases. Rice blast is caused by the infection of Magnaporthe oryzae, and this disease can occur at different stages and different parts of rice growth and development, including leaf blast, panicle neck blast, grain blast, etc., bringing great losses to rice production. It is estimated that the annual yield reduction caused by rice blast is equivalent to 10% to 30% of the total global rice output, and this figure is shocking, highlighting the great harm of rice blast to agricultural production.

[0003] Currently, the control measures for rice blast mainly include the use of pesticides and disease-resistant breeding. However, although the use of pesticides has reduced the impact of diseases to a certain extent, the resulting pesticide residues and negative impacts on the natural environment cannot be ignored. This not only threatens human health but also poses a potential threat to the balance of the ecosystem. In contrast, disease-resistant breeding is considered a more economical and effective control method. By exploring new rice blast resistance genes and resistance resources and cultivating broad-spectrum disease-resistant varieties, the resistance of rice to rice blast can be fundamentally improved. However, despite certain progress in disease-resistant breeding, little is known about new agents for effectively controlling rice blast.

[0004] Through research, the present invention reveals the regulatory mechanism of rice disease resistance at the molecular level, finds new disease resistance-related genes, and uses them to inhibit the formation of appressoria of Magnaporthe oryzae. It attempts to effectively apply them to the control of rice blast and develop agents for highly effective control of rice blast. Summary of the Invention

[0005] Aiming at the problems existing in the prior art, the purpose of the present invention is to design and provide a technical solution for the application of rice OsHsfA1 gene in regulating the resistance of rice to Magnaporthe oryzae. The present invention studies and finds that the rice OsHsfA1 gene is related to the immune response of rice to rice blast. After knocking out the OsHsfA1 gene, the defense ability of rice against Magnaporthe oryzae is reduced, while overexpressing the OsHsfA1 gene can improve the disease resistance of rice to Magnaporthe oryzae.

[0006] The technical solution of the present invention is as follows:

[0007] The present invention provides the application of rice OsHsfA1 gene in regulating the resistance of rice to Magnaporthe oryzae.

[0008] Preferably, the CDS nucleotide sequence of the rice OsHsfA1 gene is as shown in SEQ ID No. 2.

[0009] The present invention also provides the application of the rice disease resistance factor OsHsfA1 protein in regulating the resistance of rice to Magnaporthe oryzae.

[0010] Preferably, the amino acid sequence of the rice pathogenic factor OsHsfA1 protein is as shown in SEQ ID No. 1.

[0011] The present invention also provides a method for regulating the resistance of rice to Magnaporthe oryzae. When it is necessary to reduce the resistance of rice to Magnaporthe oryzae, the OsHsfA1 gene in rice is silenced or knocked out; when it is necessary to increase the resistance of rice to Magnaporthe oryzae, the OsHsfA1 gene in rice is overexpressed.

[0012] The present invention also provides the application of the rice OsHsfA1 gene in rice breeding. By screening rice plants with high expression of the rice OsHsfA1 gene, a rice line resistant to Magnaporthe oryzae is obtained.

[0013] The present invention also provides the application of the rice disease resistance factor OsHsfA1 protein in rice breeding. By screening rice plants with high expression of the rice disease resistance factor OsHsfA1 protein, a rice line resistant to Magnaporthe oryzae is obtained.

[0014] The present invention also provides a method for constructing a transgenic rice resistant to Magnaporthe oryzae. The rice OsHsfA1 gene is transferred into rice plants to obtain transgenic rice with high expression of the rice OsHsfA1 gene.

[0015] Specifically, the CDS region nucleotide sequence of the rice OsHsfA1 gene is cloned into a vector, first transferred into Agrobacterium, and then transferred into rice cells through callus transformation to obtain transgenic rice with high expression of the rice OsHsfA1 gene.

[0016] Preferably, the vector is the pCAMBIA1300ubi vector.

[0017] The present invention has found through research that the rice gene OsHsfA1 plays an important role in the process of rice resistance to Magnaporthe oryzae. The deletion of the OsHsfA1 gene reduces the basic defense ability of rice to Magnaporthe oryzae, and overexpression of the OsHsfA1 gene can improve the disease resistance of rice to Magnaporthe oryzae. Therefore, the rice OsHsfA1 gene can be used to improve the resistance of rice to Magnaporthe oryzae. Description of the Drawings

[0018] Figure 1 It is a diagram showing the identification results of the blast resistance of the rice OsHsfA1 knockout mutant; among them, A: in vivo inoculation diagram; B: relative mycelial biomass of the diseased leaves, **p<0.001.

[0019] Figure 2 It is the identification result diagram of the blast resistance of the rice OsHsfA1 overexpression mutant; among them, A: the in vivo inoculation diagram; B: the relative hyphal biomass diagram of the diseased leaves, **p<0.01.

[0020] Figure 3 It is the result diagram of the expression of rice defense-related genes and the determination of reactive oxygen species in the OsHsfA1 homozygous knockout mutant. Among them, A-B: the relative expression analysis of the rice defense-related genes KS4 and NAC4; C: the accumulation of ROS in the wild-type and knockout gene OsHsfA1 mutant plants after chitin treatment, **p<0.01.

[0021] Figure 4 It is the result diagram of the expression of rice defense-related genes and the determination of reactive oxygen species in the OsHsfA1 overexpression mutant. Among them, A-B: the relative expression analysis of the rice defense-related genes KS4 and NAC4; C: the accumulation of ROS in the wild-type and overexpression gene OsHsfA1OE mutant plants after chitin treatment, **p<0.01. Detailed implementation method

[0022] The following is a detailed description in combination with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and the detailed implementation methods and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0023] Example 1

[0024] Obtaining the rice OsHsfA1 gene knockout mutant.

[0025] The amino acid sequence of the rice OsHsfA1 protein is shown in SEQ ID No.1, and the gene sequence (CDS sequence) of the rice OsHsfA1 gene is shown in SEQ ID No.2. We used the Crispr / Cas9 technology to perform directional knockout of the target gene, so as to obtain the knockout mutant of the OsHsfA1 gene.

[0026] The steps for constructing the knockout vector are as follows:

[0027] (1) First, according to the gene number of OsHsfA1, download its reference sequence in Nipponbare https: / / rice.uga.edu / cgi-bin / sequence_display.cgi?orf=LOC_Os03g63750.1, determine the target site and design the adapter primers OsHsfA1cas9-F / R. The primer sequences are as follows:

[0028] OsHsfA1cas9-F: ggcCAGAGGTCCCAGCTAACTC;

[0029] OsHsfA1cas9-R: aaacGAGTTAGCTGGGACCTCTG;

[0030] (2) Preparation of target adaptor: Dissolve the adaptor primer into a 100 μM stock solution, take 1 μL of each and add it to 98 μL of ddH 2 O, dilute to 1 μM, and after treating the mixture at 90 °C for 30 s, transfer it to room temperature and cool for 20 min to complete annealing;

[0031] (3) Ligation reaction of gRNA expression cassette: The digested pYL gRNA-U3 vector is ligated with the corresponding target adaptor. The PCR reaction system is as follows:

[0032]

[0033] The PCR reaction conditions are:

[0034] 37 °C, 5 min; 20 °C, 5 min. A total of 5 cycles.

[0035] (4) Amplification of gRNA expression cassette (two-round nested PCR amplification):

[0036] Use the product obtained from the ligation in (3) for the first-round amplification. The PCR reaction system is as follows:

[0037]

[0038]

[0039] The sequences of the first-round PCR amplification primers U-F / gDNA-R are:

[0040] U-F: 5-CTCCGTTTTACCTGTGGAATCG-3;

[0041] gRNA-R: 5-CGGAGGAAAATTCCATCCAC-3.

[0042] The first-round PCR amplification reaction conditions are shown in Table 1:

[0043] Table 1

[0044]

[0045] After the amplification is completed, take 3 μL of the amplification product for electrophoresis inspection. The size of the target band is 564 bp. Dilute the product obtained from the first-round amplification 20 times as the template for the second-round amplification.

[0046] The reaction system for the second-round PCR amplification is as follows:

[0047]

[0048] The primer sequences for the second-round PCR amplification are:

[0049] Uctcg-B1’: 5’-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3’;

[0050] gRcggt-BL: 5’-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3’.

[0051] The reaction conditions for the second-round PCR amplification are shown in Table 2:

[0052] Table 2

[0053]

[0054] After the amplification is completed, take 3 μL of the amplification product for electrophoresis to check the product length. Purify the second-round amplification product and measure its concentration.

[0055] (5) Cutting and ligating simultaneously (two-round nested PCR amplification):

[0056] Take about 20 ng of the purified product in step (4), add about 20 ng of the uncut pYLCRISPR / Cas9-MH plasmid, and digest with 10 U of BsaI enzyme in a 15 μL reaction system at 37 °C for 10 min.

[0057] After digestion, add 1.5 μL of 10×T4 ligase buffer and 35 U of T4 ligase to the system. The PCR reaction system is shown in Table 3:

[0058] Table 3

[0059]

[0060] Use the heat shock method to transform the ligated plasmid into Escherichia coli E. coli, select positive clones for detection. After correct sequencing, send the plasmid to Wuhan Boyuan Biotechnology Co., Ltd. for callus transformation, using ZH11 as the background, to obtain the rice OsHsfA1 gene knockout mutants OsHsfA1-3 and OsHsfA1-5.

[0061] Example 2

[0062] Obtaining of the overexpression mutant of the rice OsHsfA1 gene.

[0063] According to the CDS sequence of OsHsfA1, primers OsHsfA1OX-F / R were designed. The primer sequences are as follows:

[0064] OsHsfA1OE-F: gtgttacttctgcaggagctcATGGAGGCCGCCGTTGCT;

[0065] OsHsfA1OE-R: gcccttgctcaccatggatccTCCTGTATGGTGTGATGACAGGA;

[0066] Using the ZH11 (Zhonghua 11) genome as a template, the CDS sequence of the gene OsHsfA1 was amplified with primers OsHsfA1OX-F / R. After purification of the amplification product, it was ligated to the pCAMBIA1300ubi vector (double digested with SacI / BamHI) by seamless cloning technology. The ligated plasmid was transformed into Escherichia coli E. coli by heat shock method, and positive clones were selected for detection. After correct sequencing, the plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd. It was transformed into Agrobacterium and then introduced into rice callus for transformation. Using the ZH11 strain as the background, the rice OsHsfA1 gene overexpression mutants OsHsfA1OE-1 and OsHsfA1OE-2 were obtained.

[0067] Example 3

[0068] Effect of OsHsfA1 on rice disease resistance.

[0069] To verify that the gene OsHsfA1 is involved in the defense response of rice against Magnaporthe oryzae, we detected the changes in the resistance of OsHsfA1 knockout mutants and overexpression mutants to Magnaporthe oryzae. The specific operations are as follows:

[0070] The wild Magnaporthe oryzae strain RB22 was activated on OA medium, cultured in the dark at 25°C for 3 days, and then cultured under light for 4 days. Sterile ddH 2 O was added to the culture dish, and the mycelium was gently scraped with an inoculation loop to elute the Magnaporthe oryzae spores from the medium. The eluate was filtered through a Magic filter cloth to obtain a spore suspension. The spore suspension was placed in a 2 mL centrifuge tube, centrifuged at 12000 rpm for 2 min, the supernatant was discarded (avoid pouring out the spores at the bottom), and sterile ddH 2 O was added to adjust the spore concentration to not less than 1×10 6 spores / mL. 1 / 10 volume of 0.1% Gelatin (final concentration of Gelatin was 0.01%, v / v) was added to the spore solution for inoculation of Magnaporthe oryzae.

[0071] Spray inoculation: Water the rice seedlings (mutants and wild types) at the 3-4 leaf stage in advance until the water is full (3-5 plants per pot), and the water surface needs to exceed the soil to ensure good subsequent sealing. Insert the lower part of the cylindrical transparent PVC film into the soil, cover the upper part with plastic wrap, and completely seal the rice seedlings. Pierce a hole in the center of the plastic wrap, and suck 1 mL of spore suspension for each pot to spray the rice seedlings sufficiently to ensure that atomized fine water droplets are formed on each leaf, and then cover another layer of plastic wrap for sealing. After 24 hours of dark treatment at 22 °C, restore the normal light cycle, and culture in a high-humidity environment for 5-7 days, then investigate the disease incidence. Each experiment is repeated three times.

[0072] Determination of hyphal biomass: Cut the rice lesion, and extract total DNA by the CTAB method. Using the rice gene OsUbiquitin as an internal reference (LOC_Os03g13170), detect the amount of the Magnaporthe oryzae Mopot2 gene (MGG_13294), and analyze the fungal biomass by real-time fluorescence quantitative PCR. Calculate the relative expression level of the gene by the 2 -ΔΔCT method. The primer sequences are as follows:

[0073] qOsUBQ-F: AAGAAGCTGAAGCATCCAGC;

[0074] qOsUBQ-R: CCAGGACAAGATGATCTGCC;

[0075] Mopot2-F: ACGACCCGTCTTTACTTATTTGG;

[0076] Mopot2-R: AAGTAGCGTTGGTTTTGTTGGAT.

[0077] Inoculation results ( Figure 1-2 ) show that: compared with the wild type, the lesion areas of the knockout mutants OsHsfA1-3 and OsHsfA1-5 are significantly larger than those of the wild type, and the resistance to rice blast is significantly weakened; the lesion areas of the overexpression mutants OsHsfA1OE-1 and OsHsfA1OE-2 are significantly smaller than those of the wild type, and the resistance to rice blast is significantly enhanced, indicating that OsHsfA1 is essential for rice resistance to rice blast.

[0078] Example 4

[0079] Effect of OsHsfA1 on the expression of defense-related genes and the burst of reactive oxygen species in Magnaporthe oryzae.

[0080] In Example 3, samples were taken 3 days after spray inoculation and stored at -80°C. Total RNA of the samples was extracted using Trizol reagent, and then 1 μg was taken for reverse transcription to synthesize cDNA using M-MLV reverse transcriptase and Olig(dT). Rice gene OsUbiquitin was used as an internal reference (LOC_Os03g13170). Real-time fluorescence quantitative PCR was performed on rice defense-related genes.

[0081] Reaction system:

[0082]

[0083] Reaction conditions:

[0084] Pre-denaturation at 95°C for 30 s; denaturation at 95°C for 20 s, extension at 60°C for 30 s, 40 cycles. The relative expression levels of the genes were calculated using the 2 -ΔΔCT -ΔΔCt method.

[0085] The primer sequences are shown in Table 4:

[0086] Table 4

[0087]

[0088]

[0089] Determination of reactive oxygen species burst:

[0090] Wild-type and mutant rice leaves were cut, and holes were punched on both sides of the main vein with a 0.5 cm punch. The obtained leaf discs were placed in sterile ddH 2 2O for dark overnight treatment. Three leaf discs were randomly selected from each sample and placed in a 1.5 mL test tube containing 100 μL of luminol, 1 μL of horseradish peroxidase, and 1 μL of chitin. Finally, they were quickly placed in a Glomax 20 / 20 Luminometer instrument, and the fluorescence was detected every 10 s for a total of 20 min. Each sample was repeated three times.

[0091] The results of fluorescence quantitative PCR showed that the expression levels of the defense-related genes NAC4 and KS4 were significantly down-regulated in the knockout mutant OsHsfA1 ( Figure 3 A-B); the expression levels of the defense-related genes OsPAL and OsNAC4 were significantly up-regulated in the overexpression mutant ( Figure 4 A-B). The above results suggest that OsHsfA1 may be involved in the rice blast resistance response.

[0092] The results of luminol chemiluminescence detection showed that compared with the wild type, the growth rate of chitin-induced ROS was slower in the knockout mutant, and its accumulation was also significantly lower than that of the wild type ( Figure 3C). In the overexpression mutants, the growth rate of ROS was relatively fast, and its accumulation was also significantly higher than that of the wild type. Figure 4 C). The results showed that the deletion of the OsHsfA1 gene reduced the basal defense ability of rice against Magnaporthe oryzae, and the overexpression of the OsHsfA1 gene enhanced the basal defense ability of rice against Magnaporthe oryzae.

Claims

1. Application of rice OsHsfA1 gene in regulating rice resistance to rice blast fungus.

2. The use according to claim 1, characterized in that The CDS nucleotide sequence of rice OsHsfA1 gene is shown in SEQ ID No.

2.

3. Application of rice disease resistance factor OsHsfA1 protein in regulating rice resistance to rice blast fungus.

4. The use according to claim 3, characterized in that The amino acid sequence of the rice pathogenicity factor OsHsfA1 protein is shown in SEQ ID No.

1.

5. A method for regulating rice resistance to rice blast fungus, characterized in that: When it is necessary to reduce the resistance of rice to rice blast fungus, the OsHsfA1 gene in rice is silenced or knocked out; when it is necessary to increase the resistance of rice to rice blast fungus, the OsHsfA1 gene in rice is overexpressed.

6. Application of rice OsHsfA1 gene in rice breeding, and obtaining rice strains resistant to rice blast fungus by screening rice plants with high expression of rice OsHsfA1 gene.

7. Application of rice disease resistance factor OsHsfA1 protein in rice breeding, and obtaining rice strains resistant to rice blast fungus by screening rice plants with high expression of rice disease resistance factor OsHsfA1 protein.

8. A method for constructing transgenic rice resistant to rice blast fungus, characterized in that: The rice OsHsfA1 gene is transferred into rice plants to obtain transgenic rice that highly expresses the rice OsHsfA1 gene.

9. The method for constructing transgenic rice resistant to rice blast fungus according to claim 8, characterized in that: The CDS region nucleotide sequence of rice OsHsfA1 gene is cloned into a vector, firstly transferred into Agrobacterium, and then transferred into rice cells through callus transformation to obtain transgenic rice with high expression of rice OsHsfA1 gene.

10. The method for constructing transgenic rice resistant to rice blast fungus according to claim 9, characterized in that: The vector is pCAMBIA1300ubi vector.

Images