A drought-resistant gene TaHsfC3-4 and its application in improving plant drought resistance

By overexpressing the wheat heat shock transcription factor gene TaHsfC3-4 in plants, the problem of insufficient drought resistance in wheat was solved, and drought resistance in plants was significantly improved, providing new gene resources for drought resistance breeding.

CN118440949BActive Publication Date: 2025-08-22HEBEI ACADEMY OF AGRI & FORESTRY SCI INST OF GENETICS & PHYSIOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311491830.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-10
Publication Date
2025-08-22
Estimated Expiration
2043-11-10

AI Technical Summary

Technical Problem

Wheat yield is severely affected by drought stress, and the prior art is difficult to effectively improve the drought resistance of crops.

Method used

The wheat heat shock transcription factor gene TaHsfC3-4 was used to overexpress the gene in plants by PCR amplification, genetic transformation and expression vector (pCAMBIA1300-TaHsfC3-4). It was introduced into the plant genome using Agrobacterium-mediated genetic transformation method to activate the expression of downstream stress-resistant genes to improve drought resistance.

Benefits of technology

The drought resistance of plants is significantly improved, especially under drought stress, transgenic plants show stronger drought tolerance, enhance the drought resistance of plants, and provide new genetic resources for drought resistance breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention provides a drought-resistant gene TaHsfC3-4 and its application in plant drought resistance improvement, relating to the field of plant genetic engineering technology. The drought-resistant gene TaHsfC3-4 of the present invention is cloned from the salt-alkali-tolerant / drought-resistant heat wheat variety Cang 6005, and the gene expression is induced by PEG6000 osmotic stress and ABA, and its nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2. The present invention utilizes Agrobacterium genetic transformation method to overexpress the gene in Arabidopsis wild type and Arabidopsis mutant (ABA receptor gene deletion mutant), and the drought resistance of the obtained transgenic strain is significantly improved, indicating that the TaHsfC3-4 gene cloned by the present invention has the function of improving plant drought resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular biology and genetic engineering, and specifically relates to the verification and application of the drought resistance function of the wheat drought resistance gene HsfC3-4. Background Art

[0002] Wheat is one of my country's staple crops, and ensuring stable wheat yields is crucial for ensuring food security in my country and around the world. However, with global climate change and the intensification of abiotic stress, wheat yields have been severely impacted, with drought stress causing yields to drop by over 15%. Therefore, cultivating drought-resistant and stable-yielding wheat is a key goal of current wheat breeding programs. The rapid development of biotechnology has provided new avenues for plant breeding. Genetic engineering allows for targeted genetic improvement of crops, and has demonstrated significant utility in developing new stress-resistant crop varieties (materials). Therefore, the discovery and identification of drought-resistant genes is crucial for creating drought-resistant transgenic plants through genetic engineering and accelerating the advancement of drought-resistant wheat breeding.

[0003] Heat shock transcription factors (HSTFs) have attracted considerable attention due to their ability to regulate the expression of multiple stress-responsive genes. Studies have shown that HTFs are involved in responses to various stresses, including high temperature, salt, drought, and oxidative stress. The HTF family of wheat is extensive, with at least 82 identified to date. Discovering and characterizing functional genes within this vast family of wheat HTFs will provide genetic resources for crop breeding to improve stress tolerance. Summary of the Invention

[0004] The purpose of the present invention is to provide a wheat drought-resistant gene TaHsfC3-4, to describe the function of the gene in responding to drought stress, and its role in cultivating drought-resistant plants.

[0005] The present invention employs the following technical solution: a wheat heat shock transcription factor gene, TaHsfC3-4, whose nucleotide sequence is shown in SEQ ID No. 1. TaHsfC3-4 can be highly expressed in response to PEG6000 stress and is also highly expressed in response to ABA induction, activating the expression of downstream related stress resistance genes and improving the plant's drought resistance.

[0006] A protein encoded by the wheat heat shock transcription factor gene TaHsfC3-4, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] A primer pair for amplifying the wheat heat shock transcription factor gene TaHsfC3-4, wherein the forward primer sequence of the primer pair is shown in SEQ ID NO. 3, and the reverse primer sequence of the primer pair is shown in SEQ ID NO. 4. The primer pair of SEQ ID NO. 3 and SEQ ID NO. 4 can amplify the TaHsfC3-4 gene from wheat strain Cang 6005. Primer pairs that amplify any fragment of TaHsfC3-4 are also within the scope of protection of the present invention.

[0008] A method for amplifying the wheat heat shock transcription factor gene TaHsfC3-4, comprising the following steps: using the cDNA of the salt-tolerant, heat-tolerant and drought-resistant wheat variety Cang 6005 as a template, performing PCR amplification using the primer pair to obtain the drought-resistant gene TaHsfC3-4; the PCR amplification procedure comprises: pre-denaturation at 94°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1 minute, 35 cycles; and extension at 72°C for 10 minutes.

[0009] An expression vector comprises the wheat heat shock transcription factor gene TaHsfC3-4. Further, the expression vector is pCAMBIA1300-TaHsfC3-4.

[0010] Provided is a method for improving plant drought resistance, comprising the following steps: expressing or overexpressing the drought resistance gene TaHsfC3-4 in the plant genome.

[0011] Preferably, the overexpression comprises using a genetic transformation method to transfer the above-mentioned recombinant vector into the genome of a plant to obtain a plant with improved drought resistance.

[0012] Beneficial Effects: The present invention provides a drought-resistant gene, TaHsfC3-4, isolated and cloned from the elite, multi-resistant wheat variety Cang 6005. Its nucleotide sequence is shown in SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 2. It comprises an 825-bp open reading frame (ORF), encodes 274 amino acids, and has a predicted molecular weight of 30.25 kDa. In an embodiment of the present invention, after obtaining the full-length TaHsfC3-4 drought-resistant gene, it was expressed in wild-type Arabidopsis thaliana and a mutant Arabidopsis thaliana lacking the ABA receptor genes PYR1, PYL1, PYL2, and PYL4 using Agrobacterium-mediated genetic transformation. The resulting transgenic plants were biologically validated. Results showed that the drought resistance of the wild-type transgenic Arabidopsis plants was significantly improved; in the mutant transgenic lines, the dwarf phenotype was eliminated and drought resistance was improved. The drought-resistant gene TaHSFC3-4 described in the present invention can effectively improve the drought tolerance of plants, providing new genetic resources for plant drought-resistant molecular breeding. By introducing the gene into plants through Agrobacterium-mediated transfection and cultivating new strains, new genetic resources can be created for the implementation of green agriculture and water-saving agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the agarose gel electrophoresis diagram of the cloned TaHsfC3-4 gene.

[0014] Figure 2 The expression of TaHsfC3-4 in wheat roots and leaves was induced by PEG6000 and ABA.

[0015] Figure 3 A diagram showing how the TaHsfC3-4 gene was introduced into wild-type Arabidopsis to improve the drought resistance of the plant.

[0016] Figure 4 Figure 1: Transfer of TaHsfC3-4 gene into Arabidopsis ABA receptor gene deletion mutant improves plant drought resistance. Implementation Method

[0017] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0018] Example 1 Cloning of TaHsfC3-4 gene

[0019] Total RNA was extracted from the roots and leaves of the wheat variety Cang 6005 using Redzol lysis buffer (Beijing Saibaisheng, the operation method was according to the instruction manual). The quality and concentration of RNA were tested to obtain RNA that met the experimental requirements.

[0020] The first-strand cDNA was synthesized according to the instructions using the reagents in the RevertAid First Strand cDNA Synthesis Kit (Thermo scientific) and the extracted RNA as a template.

[0021] PCR amplification was performed using Takara's high-fidelity enzyme PrimerStar with forward primer SEQ ID NO.3 and reverse primer SEQ ID NO.4. The amplification program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 10 min.

[0022] The amplified products were separated by agarose gel electrophoresis. Figure 1 The TaHsfC3-4 agarose gel electrophoresis pattern for the cloned fragment showed a clear band between 800 and 1000 bp. The target fragment was excised and recovered using the TaKaRa MiniBESTAgarose Gel DNA Extraction Kit. The fragment was ligated to the vector using the p-EASY-Blunt cloning kit from Beijing Quanshijin Biotechnology Co., Ltd. The ligated plasmid was transformed into competent E. coli cells for resistance screening. Single clones were selected for PCR verification and then sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.

[0023] Example 2 TaHsfC3-4 gene expression analysis

[0024] Wheat seedlings at the two-leaf-one-core stage with consistent growth were selected for stress treatment. They were placed in Hoagland nutrient solution containing 20% ​​PEG6000 or 200 μmol / L abscisic acid (ABA), and roots and leaves were collected at 0, 2, 4, 6, 8, 12, and 24 h, respectively.

[0025] For all treatments, the second expanded leaves of wheat seedlings were taken. After the leaves and roots were isolated, they were immediately placed in liquid nitrogen, frozen and crushed, and stored in a -80°C ultra-low temperature freezer until use.

[0026] Quantitative PCR primers were designed based on the sequence characteristics of the wheat TaHsfC3-4 gene. The forward primer sequence was ACGGGCTGTCCTGCGGCATCAA, and the reverse primer sequence was CGCTCCGGTGTAGAAACCAGTGAA. The internal reference gene was RNA polymerase 15-kD subunit (TaRP15), with the forward primer sequence being CAATCGTGTGTGACAATGG and the reverse primer sequence being AACCCTCGTAGATTGGCA. All primer sequences were synthesized by Shanghai Sangon Biotechnology Co., Ltd. SYBR Pre-mix ExTaq™ kit (TaKaRa, Dalian, China) and 7500 Realtime PCR System (Applied Biosystems, USA) were used for qPCR. A 0-minute treatment period was used as a control.

[0027] Figure 2 As shown in A, the TaHsfC3-4 gene was strongly expressed in roots and leaves under the drought stress environment simulated by PEG6000, and the expression level reached a peak after 12 hours of treatment. The expression change in roots was stronger than that in leaves, indicating that it may play a role in resisting drought stress.

[0028] Figure 2 As shown in B, the TaHsfC3-4 gene is strongly expressed in roots and leaves under the induction of ABA, with the expression level reaching a peak at 12 hours. The expression level in roots is higher than that in leaves, indicating that this gene plays a role in the transduction pathway of drought signal ABA.

[0029] Example 3 Construction of plant expression vector (pCAMBIA1300-TaHsfC3-4)

[0030] The TaHsfC3-4 gene was constructed and inserted into the binary expression vector pCAMBIA1300 using a recombination method. First, the 35S promoter was inserted between the HindIII and XbaI restriction enzyme sites within the pCAMBIA1300 multiple cloning site by enzyme ligation. Second, the NOS terminator was inserted between the SacI and EcoR I restriction enzyme sites within the pCAMBIA1300 multiple cloning site by enzyme ligation. Finally, TaHsfC3-4-specific primers were designed and amplified using the ClonExpress II (Novozymes Biotech) recombination reaction system. The transformed vector was digested with the restriction endonucleases XbaI and SacI (NEB). The PCR product was mixed with the linearized vector at a molar ratio of 1:2 and recombination was performed using the ClonExpress II rapid cloning technology to insert the TaHsfC3-4 gene between the 35S promoter and NOS terminator. The total ligation reaction system is: 4 µL 5× ClonExpress II Buffer, 50–200 ng of linearized vector, 20–200 ng of insert amplification product, 2 µL Exnase II, and sterile water to a total volume of 20 µL. Mix all components and incubate at 37°C for 30 min. Upon completion, immediately cool in an ice bath for 5 min.

[0031] The ligation product was then transformed into Agrobacterium tumefaciens competent cells and screened in LB solid medium containing 50 mg / L kanamycin. Single clones that tested positive for PCR were picked and sent to the company for sequencing. Sequencing confirmed that the reading frame was completely correct, indicating that the pCAMBIA1300-TaHsfC3-4 recombinant vector was successfully constructed.

[0032] Example 4 Application of TaHsfC3-4 in Improving Drought Resistance in Arabidopsis

[0033] The steps for Agrobacterium tumefaciens-mediated genetic transformation of Arabidopsis thaliana are as follows: take a fresh Agrobacterium tumefaciens bacterial suspension, streak it on an LB solid plate (containing 50 mg / L kanamycin and 25 mg / L rifampicin), scrape the streaked plaque, add it to 1 / 2 MS liquid culture medium, and shake culture at 28°C and 200 rpm. When the bacterial suspension concentration reaches OD600 = 0.8-1.2, immerse it for immersion; immerse Arabidopsis plants in the flowering stage in the Agrobacterium suspension for 1-3 minutes, then remove them, lay them on a tray, cover them with plastic wrap and protect them from light overnight; after one day, remove the plastic wrap to allow air to circulate, and straighten the Arabidopsis plants for normal culture until the seeds mature.

[0034] Screening of Transgenic Plants: After the genetically transformed Arabidopsis matures, seeds (T0 generation) are harvested, sterilized, and sown on MS medium containing 25 µg / ml hygromycin. Vernalized at 4°C for 3 days, the seeds are then cultured under normal light conditions. After one week, Arabidopsis seedlings harboring the transgenic gene (T1 generation) can be identified. Because the binary vector carries the hygromycin resistance locus, resistant seedlings exhibit green cotyledons, elongated hypocotyls, and elongated roots with two normal true leaves. Non-transformants, on the other hand, lack resistance and, while their cotyledons remain green, lack normal true leaves and their radicles cease to grow.

[0035] Transplant resistant plants, continue culturing, and harvest T1 generation seeds. Sow T1 generation seeds on a medium containing 25 µg / ml hygromycin and continue screening. The segregation ratio of their progeny (T2 generation) can be used to determine whether the insertion is a single-site insertion.

[0036] Transgenic plants with single-site insertion were selected for transplantation, and seeds (T3 generation) were collected from each plant and planted on a medium containing 25 μg / ml MS to further screen for homozygotes. Those that did not segregate were considered homozygotes.

[0037] Identification of drought resistance of transgenic Arabidopsis thaliana: Select wild-type and homozygous lines of transgenic TaHsfC3-4 genes, stop watering one week after transplanting, and after two weeks, about 80% of the leaves of wild-type Arabidopsis thaliana wilt and die, take photos, and take samples to measure physiological indicators; select Arabidopsis mutants and homozygous lines of mutants with transgenic TaHsfC3-4 genes, stop watering one week after transplanting, and after two weeks, about 80% of the leaves of mutant lines wilt and die, take photos, and take samples to measure physiological indicators.

[0038] Figure 3 The figure shows that WT is wild-type Arabidopsis, and 128-12, 121-5, and 4-24 are three Arabidopsis lines transformed with the TaHsfC3-4 gene. Under normal conditions, the growth of the three transgenic Arabidopsis lines was not significantly different from that of the wild type. However, under drought conditions, the three transgenic Arabidopsis lines grew better than the wild type, with higher chlorophyll content and lower malondialdehyde (MDA) content in their leaves, indicating that TaHsfC3-4 transgenic lines can enhance plant drought resistance.

[0039] Figure 4As shown, MT represents an ABA receptor-deficient mutant of Arabidopsis thaliana, and 139-18, 125-10, and 23-8 are homozygous lines of the mutant Arabidopsis thaliana transformed with the TaHsfC3-4 gene. Under normal conditions, the dwarf phenotype of the mutant Arabidopsis lines transformed with the TaHsfC3-4 gene disappears. However, after drought stress, 139-18, 125-10, and 23-8 all grew better than the mutant lines, with significantly higher chlorophyll content and lower malondialdehyde content in their leaves than the mutant lines, indicating that the TaHsfC3-4 gene can significantly improve the drought resistance of the mutant Arabidopsis lines.

[0040] The embodiments described above are merely descriptions of preferred implementations of the present invention, but are not limited thereto. Those skilled in the art can easily understand the spirit of the present invention based on the above embodiments and make different extensions and changes. However, as long as they do not depart from the spirit of the present invention, they are all within the scope of protection of the present invention.

Claims

1. Use of the drought-resistant gene TaHsfC3-4 or its encoded protein in improving plant drought resistance. The nucleotide sequence of the drought-resistant gene TaHsfC3-4 is shown in SEQ ID NO. 1, and the amino acid sequence of the protein expressed by the gene TaHsfC3-4 is shown in SEQ ID NO.

2. The TaHsfC3-4 gene is used to construct a recombinant expression vector, and the recombinant expression vector is transferred into plants to improve the drought resistance of the plants; The gene TaHsfC3-4 improves plant drought resistance by increasing chlorophyll content and reducing malondialdehyde content by regulating the drought signal ABA pathway; The plants are Arabidopsis thaliana and wheat.

2. The use according to claim 1, characterized in that The basic vector of the recombinant vector includes the pCAMBIA1300 vector, and the drought-resistant gene TaHsfC3-4 is inserted between the XbaI and SacI sites of the basic vector.

3. The application according to claim 1, characterized in that The recombinant vector according to claim 2 is transferred into the genome of a plant by using a genetic transformation method, and the drought-resistant gene TaHsfC3-4 is overexpressed to obtain a plant with improved drought resistance.