MBD2 conditional gene knockout mouse model, construction method and application thereof

Abstract

The present invention discloses a MBD2 conditional gene knockout mouse model, a construction method and its application, and belongs to the field of genetic engineering technology. The present invention obtains F0 generation mice by microinjecting Cas9mRNA, sgRNA and donor DNA fragments containing loxP sites into fertilized eggs of C57BL / 6J mice, and transplanting the fertilized eggs to pseudo-pregnant mother mice; hybridizing F0 generation mice containing targeting sequences with wild-type mice to obtain stable genetic heterozygous mice containing targeting sequences; hybridizing the obtained heterozygous mice containing targeting sequences with CD8-Cre positive mice to obtain CD8+T lymphocyte MBD2 gene knockout mouse model. The conditional gene knockout (Conditional Knockout, CKO) animals obtained by the present invention provide a convenient, reliable and economical mouse model for studying the MBD2 gene affecting CD8+T activation and exhaustion in the mechanism of autoimmune diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to an MBD2 conditional gene knockout mouse model, a construction method and an application thereof. Background Art

[0002] Methyl-CpG Binding Domain Protein 2 (MBD2) is located on mouse chromosome 18 NC_000084.7 (70701298..70761769). There are 5 transcripts in mice, among which the commonly used transcript MBD2-201 (ENSMUST00000074058.11) is 1953bp in length, contains 7 exons, and encodes a protein containing 414 amino acid residues.

[0003] MBD2 is an important methylation reading protein that specifically binds to densely methylated DNA rich in CpG in vivo. The typical role of MBD2 is to recruit NuRD to the CpG island of methylated DNA, and exert transcriptional repression through transcriptional regulation and chromatin modification. MBD2 plays an important role in epigenetic regulation and is involved in the occurrence and development of tumors and autoimmune diseases. Abnormal DNA methylation is generally believed to trigger or promote CD8+T cell activation and target cell killing function. At present, the incidence of autoimmune diseases in my country has been increasing year by year. The annual treatment costs of autoimmune diseases have greatly increased the economic burden on society.

[0004] CRISPR / Cas9 technology: It is based on the transformation of the immune system in bacteria and archaea. It consists of an RS structure composed of multiple regular short repeating palindromic sequences and non-repeating spacer sequences and a gene operon encoding the Cas9 nuclease. It uses guide RNA (sgRNA) to mediate the endonuclease Cas9 protein to recognize the target DNA sequence and cause DNA double-strand breaks, promote the repair of damaged DNA by homologous recombination or non-homologous end joining, and thus achieve multiple modifications such as site-specific knockout, knock-in, and gene correction at the target site. Due to its high specificity, simple molecular construction, and short process, CRISPR / Cas9 technology has developed rapidly in recent years. It has shown strong genome editing activity in bacteria, mammalian cells, zebrafish, mice, rats, etc., which can help people discover potential therapeutic targets for related diseases and play an important role in studying the pathogenic mechanism of diseases and drug screening. Summary of the invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a MBD2 conditional gene knockout mouse model, construction method and application thereof. The present invention utilizes MBD2 gene flox mice to mate with mice that express Cre recombinase (CD8-Cre) in a tissue-specific manner, and the flox region of the offspring flox homozygous and Cre-positive mice is knocked out, resulting in functional loss of the MBD2 gene in CD8+T cells, thereby obtaining conditional gene knockout (CKO) animals, and providing an ideal mouse model for purposefully studying the mechanism of action of the MBD2 gene on CD8+T cell activation and regulation of target cell killing function.

[0006] In order to achieve the above purpose, this application adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a method for constructing an MBD2 conditional gene knockout mouse model, the method comprising the following steps:

[0008] S1: Determine the knockout exon 2 region based on the structure of the MBD2 gene, and design two pairs of sgRNAs upstream and downstream of the knockout region respectively;

[0009] The upstream sgRNAs are Mbd2-sgRNA-L-1 having the sequence shown in SEQ ID No. 1, and Mbd2-sgRNA-L-2 having the sequence shown in SEQ ID No. 2;

[0010] The downstream sgRNAs are Mbd2-sgRNA-R-1 having the sequence shown in SEQ ID No.3, and Mbd2-sgRNA-R-2 having the sequence shown in SEQ ID No.4;

[0011] S2: Using the sgRNA and its primers, constructing an sgRNA / Cas9 expression vector by linearizing the vector, annealing and connecting the oligonucleotide chains, and transforming the recombinant plasmid;

[0012] S3: The sgRNA / Cas9 expression vector described in S2 is linearized and purified, and then used as a template for in vitro transcription to synthesize sgRNA and Cas9 mRNA;

[0013] S4: Microinjection of fertilized eggs: Use a microinjection instrument to mix the sgRNA and Cas9mRNA synthesized in S3 and the donor DNA fragment containing the loxP site at a certain concentration ratio, and inject them into the cytoplasm of the mouse fertilized egg together to construct a specific mouse fertilized egg (embryonic cell);

[0014] S5: After 1-2 hours of in vitro culture, the surviving fertilized eggs are transplanted into the oviduct of pseudo-pregnant female mice to produce F0 generation mice;

[0015] The F0 generation of mice was identified to determine the insertion site, and flox-positive mice were screened from the offspring;

[0016] S6: The positive F0 mice are mated with wild-type mice to obtain F1 mice, and the F1 mice are identified;

[0017] S7: The heterozygous F1 mice containing the targeting sequence obtained in S6 were crossed with CD8-Cre recombinase positive mice to obtain F2 mice, and the F2 mice were identified to obtain the MBD2 conditional gene knockout mouse model, which was recorded as CD8 cre -MBD2 fl / fl .

[0018] Furthermore, in S4, the donor DNA sequence at the loxP site is shown as SEQ ID No.5.

[0019] Furthermore, in S5, PCR was performed to identify the site-specific insertion effect of the produced F0 generation mice, and the primer pair sequence was SEQ ID No.6 and SEQ ID No.7.

[0020] Furthermore, in S6, the flox site PCR was performed on the F1 generation mice, and the primer pairs used for identification were: MBD2-L-LOXP-F having the sequence shown in SEQ ID No.8, MBD2-L-LOXP-R having the sequence shown in SEQ ID No.9, MBD2-R-LOXP-F having the sequence shown in SEQ ID No.10, and MBD2-R-LOXP-R having the sequence shown in SEQ ID No.11.

[0021] Further, in S7, the flox site PCR was performed on the F2 generation mice, and the primer pair sequences used for identification were: MBD2-L-LOXP-F having the sequence shown in SEQ ID No.8, MBD2-L-LOXP-R having the sequence shown in SEQ ID No.9, MBD2-R-LOXP-F having the sequence shown in SEQ ID No.10, and MBD2-R-LOXP-R having the sequence shown in SEQ ID No.11.

[0022] Furthermore, in S7, the Cre effect was identified by PCR on F2 mice, and the primer pair sequence used for the identification was SEQ ID No.12 and SEQ ID No.13.

[0023] In a second aspect, the present invention provides an MBD2 conditional gene knockout mouse model, which is constructed by the above-mentioned construction method.

[0024] In a third aspect, the present invention provides an application of the above mouse model in studying the mechanism of action of the MBD2 gene on the regulation of CD8+T cell activation, exhaustion and target cell killing function.

[0025] The beneficial effects of the present invention are:

[0026] (1) The present invention utilizes MBD2 gene flox mice to mate with mice that tissue-specifically express Cre recombinase (CD8-Cre), and the flox region of the offspring flox homozygous, Cre-positive mice is knocked out, resulting in functional loss of the MBD2 gene in CD8+T cells, thereby obtaining conditional knockout (CKO) animals, thereby providing an ideal mouse model for purposefully studying the mechanism of action of the MBD2 gene on the regulation of CD8+T cell activation, exhaustion and target cell killing function.

[0027] (2) The MBD2 conditional gene knockout mouse model constructed by the present invention lays a foundation for further studying the biological function of the MBD2 gene, and provides an ideal model for studying the mechanism of action of MBD2 in regulating CD8+ T cell activation, exhaustion and target cell killing function, thereby reducing the changes in other mechanisms caused by systemic knockout. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a diagram of the MBD2 conditional knockout mouse strategy;

[0029] Figure 2 This is a detailed diagram of the MBD2-201 transcript, which contains 7 exons, with protein translation starting at exon1 and ending at exon7;

[0030] Figure 3 This is the electrophoresis diagram for the identification of the insertion site in the F0 generation; the numbers are the numbers of the F0 generation mice; WT is the wild-type control; M is a 100 bp DNA marker;

[0031] Figure 4 It is the comparison chart of F0 generation sequencing results;

[0032] Figure 5 This is the electrophoresis diagram of the F1 generation mouse flox site insertion CR identification; the numbers are the F1 generation mouse numbers; WT is wild type; HE is flox positive heterozygote;

[0033] Figure 6This is the electrophoresis diagram of Cre and flox site PCR identification in F2 mice; WT is wild type; HE is flox heterozygote; KO is flox homozygote;

[0034] Figure 7 This is the result of western blot experiment of MBD2 protein in MBD2 conditional knockout mice;

[0035] Figure 8 The CD8+T cells of MBD2 conditional knockout mice showed obvious immune activation phenotype; Figure 8 A is the activation level of CD8+T cells; Figure 8 B is the level of CD8+T cell inflammatory factors; Figure 8 C is the level of CD8+ T cell exhaustion. DETAILED DESCRIPTION

[0036] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as being limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and the concept of the present invention will be fully conveyed to those skilled in the art, and the present invention will only be limited by the claims.

[0037] Example 1: Construction of MBD2 conditional knockout mouse model

[0038] (1) Design, construction and purification of gRNA for mouse MBD2 gene

[0039] CRISPR / Cas9 technology is based on the transformation of the immune system in bacteria and archaea. It consists of an RS structure composed of multiple regular short repeating palindromic sequences and non-repeating spacer sequences and a gene operon encoding the Cas9 nuclease. CAS9 is a nuclease that can achieve the shearing of specific DNA sequences through the mediation of crRNA and tracrRNA (or trans-activating crRNA). Considering the advantages of CRISPR / Cas9 technology in short cycle and high efficiency, the MBD2 conditional gene knockout mouse strategy was designed, see Figure 1 .

[0040] The transcript targeted in the present invention is MBD2-201 (ENSMUST00000074058.11). Figure 2As shown in the figure, the total length is 1953bp, including 7 exons, and the encoded protein contains 414 amino acid residues. The targeted flox region is exon 2 of the MBD2 gene. Knocking out this region will cause a frameshift mutation, causing the translation to terminate prematurely. Specifically, partial intron 2, exon 2 and partial intron 3 of the MBD2 gene were selected for knockout, with a total knockout region of 542bp; the uppercase letters are the exon 2 coding sequence, the uppercase bold part is the loxp sequence, and a loxp sequence is inserted upstream and downstream of exon 2, respectively. The MBD2-WT sequence is shown in SEQ ID No. 14, and the MBD2-LOXP sequence is shown in SEQ ID No. 15.

[0041] The sequence alignment of MBD2-WT and MBD2-LOXP is as follows;

[0042] ①MBD2-WT:

[0043]

[0044] ②MBD2-LOXP:

[0045] The capital letters represent the exon 2 coding sequence, the capital bold parts represent the loxp sequence, and a loxp sequence is inserted upstream and downstream of exon 2 respectively.

[0046]

[0047]

[0048] Two pairs of sgRNAs were designed upstream and downstream of exon 2 to introduce loxp sequences. The sgRNAs upstream of the knockout region were:

[0049] SEQ ID NO.1:GAATGCACATAGTCTGGTAT AGG

[0050] SEQ ID NO.2: CGTTTGGAATGCACATAGTC TGG

[0051] The sgRNAs downstream of the knockout region are respectively;

[0052] SEQ ID NO.3:ACCCCAGCGCGCCGCCCTTG TGG

[0053] SEQ ID NO.4: TCTCCACAAGGGCGGCGCGC TGG

[0054] name Serial number sequence Mbd2-sgRNA-L-1 SEQ ID NO.1 GAATGCACATAGTCTGGTAT AGG Mbd2-sgRNA-L-2 SEQ ID NO.2 CGTTTGGAATGCACATAGTCTGG Mbd2-sgRNA-R-1 SEQ ID NO.3 ACCCCAGCGCGCCGCCCTTG TGG Mbd2-sgRNA-R-2 SEQ ID NO.4 TCTCCACAAGGGCGGCGCGC TGG

[0055] The above-mentioned sgRNA and its reverse primer are used to construct a sgRNA / Cas9 expression vector by linearizing the vector, annealing and connecting the oligonucleotide chains, and transforming the recombinant plasmid; after the sgRNA / Cas9 expression vector is linearized and purified, it is used as a template for in vitro transcription to synthesize sgRNA and Cas9 mRNA.

[0056] (2) Microinjection of fertilized eggs

[0057] Three healthy female C57BL / 6J mice aged 4-6 weeks were taken, and 5 international units (IU) of pregnant mare serum gonadotropin (PMSG) were injected into the female mice's peritoneal cavity. About 46-48 hours later, 5 units of human chorionic gonadotropin (hCG) were injected again, and ovulation was induced 12 hours later; after hCG administration, the donor female mice were co-caged with mature male mice, and the blastocysts in the uterus of the donor female mice were collected on the fourth day after mating. Cas9 mRNA, gRNA (gRNA1 and gRNA2) and donor vector were microinjected into the fertilized eggs of C57BL / 6J mice under a microscope to construct specific mouse embryonic cells (fertilized eggs); the donor DNA sequence of the loxP site was:

[0058] SEQ ID No.5: ATAACTTCGTATAATGTATGCTATACGAAGTTAT

[0059] (3) Obtaining F0 generation mice and identifying their genotypes

[0060] After 1-2 hours of in vitro culture, the surviving fertilized eggs were transplanted into the oviduct of pseudo-pregnant female mice. After the transplantation operation was successful, the mice born about 20 days later were F0 generation mice. The F0 generation mice were identified by PCR technology to determine the insertion site, and the flox-positive mice were screened from the offspring. The results are as follows Figure 3 The primer sequences used are:

[0061] SEQ ID No.6: GAGATGTGGGACCTGAAAG

[0062] SEQ ID No.7: CCTAGTGCCGTGCTGAAAC

[0063] name Serial number sequence MBD2-LD-F SEQ ID NO.6 GAGATGTGGGACCTGAAAG MBD2-R-LOXP-R SEQ ID NO.7 CCTAGTGCCGTGCTGAAAC

[0064] The PCR program was

[0065]

[0066] After PCR confirmed the site-specific insertion, gene sequencing was performed on the F0 generation positive mice, and the sequencing primer selected was SEQ ID No.7;

[0067] A: Direct sequencing of PCR products (50ul system, with primer S): If a large fragment is missing or inserted, it can be directly seen from the electrophoresis graph, and the target band can be cut and sequenced;

[0068] B: or the PCR product is cut and recovered, connected to the PMD18T vector, and then transformed with DH5α and plated and directly sent to the plate for sequencing (Taq enzyme is recommended for PCR);

[0069] C: The sequencing results can be viewed through the chromas color map. If it is a single peak, directly compare it with the WT sequence (DNAMAN software) to analyze whether it is WT or homozygous. If the color map is a double peak, compare it with the WT sequence through the screenshot to analyze the mutant sequence. The result is as follows Figure 4 As shown, mice No. 8 and No. 14 of the F0 generation were flox positive.

[0070] (4) F1 generation stable genetic mice were obtained.

[0071] Since the fertilized egg cleaves very quickly in the early stage, the F0 generation mice obtained are chimeras and may not have the ability to stably inherit the gene. They need to be subcultured to obtain F1 generation mice with stably inherited genealogy.

[0072] F0 mice No. 8 and No. 14 were crossed with WT mice to obtain F1 mice. The flox locus PCR was performed on the F1 mice. The results of PCR showed that:

[0073] ① Wild type (WT): Two bands of 621 bp fragment and 210 bp fragment obtained by PCR.

[0074] ②Heterozygote (HE): PCR obtains any two of the 655 / 621 / 481 / 210bp fragments.

[0075] ③ Homozygous (KO): Two bands of 655bp and 481bp obtained by PCR

[0076] The results are as follows Figure 5 As shown, F1 generation No. 3, 4, 5, 7, 8 are flox-positive mice that can be stably inherited. The primer pair sequence used for identification is:

[0077] SEQ ID No.8: CACGGCAGAAGTGAATGAG

[0078] SEQ ID No.9: ACTTAACACCGGAAAGTGC

[0079] SEQ ID No.10: TGGGAAATGCTGTTGACCT

[0080] SEQ ID No.11: CCTAGTGCCGTGCTGAAAC

[0081] name Serial number sequence MBD2-L-LOXP-F SEQ ID NO.8 CACGGCAGAAGTGAATGAG MBD2-L-LOXP-R SEQ ID NO.9 ACTTAACACCGGAAAGTGC MBD2-R-LOXP-F SEQ ID NO.10 TGGGAAATGCTGTTGACCT MBD2-R-LOXP-R SEQ ID NO.11 CCTAGTGCCGTGCTGAAAC

[0082] The PCR program was

[0083]

[0084] (5) The heterozygous F1 mice containing the targeting sequence obtained in step (4) were hybridized with CD8-Cre mice (purchased from Jackson lab; Strain#: 032080) to obtain F2 mice, and the F2 mice were identified; the results are as follows: Figure 6 MBD2 conditional knockout mice were obtained and designated as CD8 cre -MBD2 fl / fl .

[0085] CD8-Cre identification primers are:

[0086] SEQ ID No.12: CCAGCTAAACATGCTTCATCGTC

[0087] SEQ ID No.13: TCCCACCGTCAGTACGTGAGATA

[0088]

[0089]

[0090] The PCR program is:

[0091] Step Temp(℃) Time Note 1 94 3min - 2 98 15sec - 3 60 15sec - 4 68 2min Repeat steps 2-4 for 35 cycles 5 68 5min - 6 12 - hold

[0092] Determine the mouse genotype based on PCR results:

[0093] ① Wild type (WT): PCR obtains a single 190 bp fragment

[0094] ②CD8-Cre (cre): PCR obtained two fragments of 190 bp and 295 bp.

[0095] The final CD8 cre -MBD2 fl / fl In mice, the second exon of MBD2 in CD8+T cells was completely knocked out, with a 542bp deletion, and the target gene protein reading frame shifted and terminated prematurely, which is very likely to cause the Nonsense-mediated mRNA decay (NMD) effect, causing the target gene mRNA to be degraded, thereby causing gene function loss. So far, we have obtained a CD8+T lymphocyte MBD2 gene knockout mouse model with stable genetic variation.

[0096] Various restriction endonucleases, T4 DNA ligase, Taq enzyme and PCR-related reagents were purchased from NEB. Conventional chemical reagents were mainly purchased from Sigma and Shanghai Chemical Reagent Company. Gel recovery kit and plasmid extraction kit were purchased from Qiagen, in vitro transcription kit was purchased from Invitrogen, and primers were synthesized from Wuhan Qingke Biotechnology Co., Ltd.

[0097]

[0098]

[0099] Example 2: CD8 cre -MBD2 fl / fl Detection of MBD2 protein levels in conditional knockout mice

[0100] (1) Take MBD2 respectively fl / fl and CD8 cre -MBD2 fl / fl Conditional gene knockout CD8+T cells were added with protein lysis buffer, and the cells were ultrasonically disrupted and then lysed on ice for 30 minutes. After centrifugation at 10000G for 15 minutes, the supernatant was collected to obtain protein lysis buffer. Loading / 800℃ was added at a volume ratio of 1:5 and boiled for 10 minutes to obtain a protein sample.

[0101] (2) Take MBD2 respectively fl / fl and CD8 cre -MBD2 fl / fl For protein samples, 20 μL of 8% concentration gel was loaded and electrophoresed at a constant voltage of 80 V. After the markers were separated, the voltage was adjusted to 110 V until proteins of different molecular weights were fully separated.

[0102] (3) Transfer: Prepare transfer solution (200 mL of methanol + 5.8 g of Tris + 2.9 g of Gly, diluted to 1000 mL with dd water), pre-cool in a 4°C refrigerator, place the fixed transfer clip into the transfer tank, fill the transfer tank with transfer solution, and finally place the transfer tank in a foam box filled with ice, transfer for 2.5 hours at a constant current of 180 mA.

[0103] (4) Blocking: Prepare 5% milk in TBST and block for 1 h or overnight at 4°C.

[0104] (5) Primary antibody incubation: After blocking, wash the membrane quickly three times with TBST. Dilute the anti-Itgb2 antibody E19399- to 0.5 μg / mL, then place the blocked membrane in the corresponding diluted antibody and incubate overnight at 4°C on a shaker.

[0105] (6) Take out the membrane and wash it in TBST solution 5 times (5×10 min);

[0106] (7) Secondary antibody incubation: dilute HRP-anti-rabbit IgG with TBST at a ratio of 1:5000, mix well, add to the membrane strips, and incubate at room temperature for 1 h;

[0107] (8) Take out the membrane strip and wash it in TBST solution 5 times (5×10 min);

[0108] (9) Mix ECL and AB solutions in a 1:1 ratio (0.5 mL each), pour evenly onto the PVDF membrane, and incubate for 2 min;

[0109] (10) Exposure: Use clean toilet paper to moisten and dry the color development cassette, place the membrane in the cassette, remove air bubbles, place the negative film in the cassette, and expose the X-ray film for different time periods according to the fluorescence intensity;

[0110] (11) Exposure: Place the film in the developer for 1 to 3 minutes, rinse with clean water, then place it in the fixer for about 9 minutes, and finally dry it in a 65°C oven. Determine the target band based on the marker and analyze the results.

[0111] The results are as follows Figure 7 As shown in the figure, CD8 cre -MBD2 fl / fl The expression level of MBD2 protein in mice is much lower than that of MBD2 fl / fl Therefore, this process once again proved that we successfully constructed a CD8+ T conditional MBD2 knockout mouse model.

[0112] Example 3: CD8+ T cells from MBD2 conditional knockout mice exhibit a distinct immune activation phenotype

[0113] MBD2 plays an important role in epigenetic regulation and is involved in the occurrence and development of tumors and autoimmune diseases. Abnormal DNA methylation is generally believed to trigger or promote CD8+T cell activation and target cell killing function. We detected the activation, exhaustion and cytokine secretion of CD8+T cells in mice after MBD2 gene knockout and found that CD8+T cells in MBD2 conditional knockout mice showed obvious immune activation phenotype;

[0114] (1) WT and CD8 cre -MBD2 fl / fl Mice were killed by cervical dislocation, spleens were removed, and red blood cells were ground, filtered, and lysed to prepare single-cell suspensions.

[0115] (2) Using MojoSort TM Mouse CD8 T Cell Isolation Kit (Cat. No. 480035) is used to isolate CD8+ T cells.

[0116] (3) A portion of the separated CD8+ T cells was placed in a 96-well plate pre-coated with anti-CD3 / anti-CD28. After culturing in a cell culture incubator for 48 hours, the levels of inflammatory factors such as Granzyme B, Perforin, TNFa, and IFNr were detected.

[0117] (4) At the same time, to induce T cell exhaustion, the 96-well plate was coated with 5ug / ml anti-CD3 antibody overnight to provide chronic stimulation. The next day, after the anti-CD3 antibody was recovered, the CD8 T cells cultured for 48h were plated into the 96-well plate, and 10ng / ml IL-2 was added (10ng / ml IL-2 was continuously present). Then, every 2 days, the cells were transferred to the 96-well plate freshly coated with anti-CD3 antibody, and CD8 T cells were collected on days 0, 2, 4, and 6, respectively; flow cytometry antibodies PD-1 / BV421 and CD366 / PE-CY7 were used for staining and subsequent flow cytometry detection.

[0118] The results are as follows Figure 8 As shown in Figure A, compared with WT mice, the proportion of CD44+ subpopulation cells in KO mice was significantly increased, and the level of T cell activation was significantly increased; combined with Figure 8 B shows that compared with WT mice, the levels of inflammatory factors such as TNFa, IFNr, perforin, and Granzyme B in KO mice were significantly increased; combined with Figure 8 C shows that compared with WT mice, the proportion of PD-1+CD366+ subpopulation cells in KO mice was significantly reduced, and the level of T cell exhaustion was significantly reduced. Mbd2 gene knockout mice showed obvious immune activation phenotype.

[0119] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A method for constructing a MBD2 conditional knockout mouse model, characterized in that: The construction method comprises the following steps: S1: Determine the knockout exon 2 region based on the structure of the MBD2 gene, and design two pairs of sgRNAs upstream and downstream of the knockout region respectively; The upstream sgRNAs are Mbd2-sgRNA-L-1 with the sequence shown in SEQ ID No.1 and Mbd2-sgRNA-L-2 with the sequence shown in SEQ ID No.2; The downstream sgRNAs are Mbd2-sgRNA-R-1 with the sequence shown in SEQ ID No.3 and Mbd2-sgRNA-R-2 with the sequence shown in SEQ ID No.4; S2: Using the sgRNA and its primers, constructing an sgRNA / Cas9 expression vector by linearizing the vector, annealing and connecting the oligonucleotide chains, and transforming the recombinant plasmid; S3: The sgRNA / Cas9 expression vector described in S2 is linearized and purified, and then used as a template for in vitro transcription to synthesize sgRNA and Cas9 mRNA; S4: Microinjection of fertilized eggs: Use a microinjection instrument to mix the sgRNA and Cas9mRNA synthesized in S3 and the donor DNA fragment containing loxP sites at a certain concentration ratio, and inject them into the cytoplasm of the mouse fertilized egg together to construct a specific mouse fertilized egg; S5: After 1-2 hours of in vitro culture, the surviving fertilized eggs are transplanted into the oviduct of pseudo-pregnant female mice to produce F0 generation mice; The F0 generation of mice was identified to determine the insertion site, and flox-positive mice were screened from the offspring; S6: The positive F0 mice are mated with wild-type mice to obtain F1 mice, and the F1 mice are identified; S7: The heterozygous F1 mice containing the targeting sequence obtained in S6 were crossed with CD8-Cre recombinase positive mice to obtain F2 mice, and the F2 mice were identified to obtain the MBD2 conditional gene knockout mouse model, which was recorded as CD8 cre -MBD2 fl / fl .

2. The construction method according to claim 1, characterized in that: In S4, the donor DNA sequence at the loxP site is shown as SEQ ID No.

5.

3. The construction method according to claim 1, characterized in that: In S5, the site-specific insertion effect of the produced F0 generation mice was identified by PCR, and the primer pair sequence was SEQ ID No.6 and SEQ ID No.

7.

4. The construction method according to claim 1, characterized in that: In S6, the flox site PCR was performed on the F1 generation mice, and the primer pairs used for identification were: MBD2-L-LOXP-F of the sequence shown in SEQ ID No.8, MBD2-L-LOXP-R of the sequence shown in SEQ ID No.9, MBD2-R-LOXP-F of the sequence shown in SEQ ID No.10, and MBD2-R-LOXP-R of the sequence shown in SEQ ID No.

11.

5. The construction method according to claim 1, characterized in that: In S7, the flox site PCR was performed on the F2 generation mice, and the primer pairs used for identification were: MBD2-L-LOXP-F of the sequence shown in SEQ ID No.8, MBD2-L-LOXP-R of the sequence shown in SEQ ID No.9, MBD2-R-LOXP-F of the sequence shown in SEQ ID No.10, and MBD2-R-LOXP-R of the sequence shown in SEQ ID No.

11.

6. The construction method according to claim 1, characterized in that: In S7, the Cre effect was identified by PCR on F2 mice, and the primer pair sequence used for the identification was SEQ ID No.12 and SEQ ID No.

13.

7. Use of the MBD2 conditional knockout mouse model constructed by the construction method according to any one of claims 1 to 6 in studying the mechanism of action of the MBD2 gene on the regulation of CD8+T cell activation, exhaustion and target cell killing function.

Images