Application of targeting ESR1 to inhibit GALNT7 expression in improving endoplasmic reticulum stress sensitivity of breast cancer cells

Abstract

The present invention discloses the application of targeting ESR1 to inhibit GALNT7 expression in improving the endoplasmic reticulum stress sensitivity of breast cancer cells. The present invention proves through cell and mouse experiments that GALNT7 resists endoplasmic reticulum stress in cells, and knocking out GALNT7 can significantly restore the toxicity sensitivity of chemotherapy drugs and promote breast cancer cell death, and its function depends on the integrity of domain B. The present invention also found that estrogen receptor ESR1 directly regulates GALNT7 expression at the transcriptional level, and the mutant ESR1-MUT1 protein of ESR1 can promote the transcription of GALNT7 to a greater extent. In short, the combined treatment of estrogen receptor inhibitors and endoplasmic reticulum stress inducers can synergistically promote breast cancer cell apoptosis, overcome the inherent drug resistance caused by GALNT7, reduce the occurrence and development of breast cancer, and provide a new method for the comprehensive treatment strategy of breast cancer. The present invention has important application value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of targeting ESR1 to inhibit GALNT7 expression in improving the endoplasmic reticulum stress sensitivity of breast cancer cells. Background Art

[0002] Breast cancer is one of the most common malignant tumors in women. Clinically, cancer is divided into four subtypes, including luminal A, luminal B, human epidermal growth factor receptor 2 positive (HER2+), and triple negative type (TNBC). Both luminal A and luminal B express estrogen receptor (ER+) and / or progesterone receptor (PR+), HER2+ usually shows high levels of HER2, while TNBC does not express any receptors. The most common subtypes in breast cancer patients are ER+ and HER2 negative (HER2-) subtypes, accounting for 70% of the total incidence. Estrogen receptor α (encoded by the ESR1 gene) is a member of the NR3 subfamily of the nuclear hormone receptor family and is involved in the proliferation, differentiation and homeostasis of target cells. As a classic nuclear receptor, ERα is a ligand-dependent transcription factor that can specifically bind to estrogens, such as estradiol, estriol, and estrogen, and regulates the transcription of estrogen-sensitive genes by binding to specific estrogen response elements. Abnormal ERα signaling pathways are associated with the occurrence and development of many tumors, such as breast cancer, ovarian cancer, prostate cancer, colon cancer, etc. Advances in high-throughput technologies such as transcriptomics, proteomics, and cutting-edge single-cell RNA sequencing have improved our understanding of the molecular characteristics, tumor microenvironment, and heterogeneity of breast cancer. Despite this, breast cancer still has the malignant characteristics of high recurrence rate, metastasis, and drug resistance. Among them, drug resistance is the most severe challenge in the clinical treatment of breast cancer, and the sensitivity of breast cancer to chemotherapy toxicity decreases sharply after recurrence. Due to the heterogeneity of tumor cells, even if some breast cancer cells do not develop resistance to specific drugs, their inherent characteristics make them less responsive to chemotherapeutic drugs. Therefore, improving the chemotherapy sensitivity of breast cancer is a difficult challenge that needs to be overcome urgently.

[0003] Protein glycosylation is one of the most important post-translational modifications, which is mainly divided into two types: N-glycosylation and O-glycosylation. The important branch of O-glycosylation is mucin-type O-glycosylation. In humans, there are 20 GalNAc Ts that initiate mucin-type O-glycosylation, namely GALNT1-20. Specific glycosyltransferases directly add UDP-N-acetylgalactosamine (UDP-GalNAc) to the serine- or threonine-rich amino acid sequence at the N-terminus of mucin to form a unique Tn modified structure, and further add galactose or mannose through other glycosylases to form a more complex O-glycan structure, protecting epithelial cells from damage, dryness and pollutants. Endoplasmic reticulum stress (ER stress) refers to the dysfunction of the endoplasmic reticulum (ER), which leads to the disturbance of protein folding and modification processes in the endoplasmic reticulum, causing an imbalance of intracellular proteins. When cells face environmental stress, such as nutrient deficiency, insufficient oxygen supply, calcium ion imbalance, etc., ER stress will be triggered. ER stress is usually responded to through a mechanism called ER stress response (ER stress response). An important ER stress response mechanism is the activation of three signaling pathways mediated by non-coding RNA, which is called Unfolded Protein Response (UPR). UPR maintains the homeostasis of the intracellular environment, relieves stress pressure, and promotes cell survival by reducing protein burden, increasing ER capacity, and clearing accumulated unfolded proteins. When the stress is too severe or lasts too long, such as under the treatment of chemotherapy drugs, the overloaded ER stress that cannot be repaired will activate cell apoptosis, autophagy or necrosis and other pathways to induce programmed cell death. Since rapid division requires a large amount of protein synthesis, compared with ordinary cells, cancer cells often acquire more active UPR signaling pathways and higher comprehensive response capabilities to resist endoplasmic reticulum stress-induced death through gene mutations, thereby being able to survive and proliferate under various stimulating pressures such as hypoxia, nutrient deficiency, chemotherapy drug stimulation, anoikis and DNA damage, ultimately leading to the formation of drug tolerance, which greatly reduces the patient's survival rate. Summary of the invention

[0004] The purpose of the present invention is to improve the endoplasmic reticulum stress sensitivity of breast cancer so as to overcome the inherent insensitivity of breast cancer cells to breast cancer chemotherapeutic drugs.

[0005] The present invention first discovered that targeting ESR1 to inhibit GALNT7 expression can increase the endoplasmic reticulum stress sensitivity of breast cancer. Therefore, the present invention first protects the use of "substances that inhibit GALNT7 protein activity and / or expression" and / or "substances that inhibit ESR1 protein activity and / or expression", which can specifically be at least one of A1)-A12):

[0006] A1) Increase the sensitivity of breast cancer cells to breast cancer chemotherapy drugs;

[0007] A2) Increase the sensitivity of breast cancer cells to the toxicity of ER stress inducers;

[0008] A3) Increase the level of endoplasmic reticulum stress in breast cancer cells;

[0009] A4) Promote apoptosis and / or DNA damage in breast cancer cells;

[0010] A5) Inhibit the growth and / or development of breast cancer;

[0011] A6) Adjuvant therapy for breast cancer;

[0012] A7) preparing products for increasing the sensitivity of breast cancer cells to breast cancer chemotherapy drugs;

[0013] A8) preparing a product for increasing the toxic sensitivity of breast cancer cells to endoplasmic reticulum stress inducers;

[0014] A9) preparing a product for increasing the level of endoplasmic reticulum stress in breast cancer cells;

[0015] A10) preparing products for promoting apoptosis and / or DNA damage in breast cancer cells;

[0016] A11) Preparation of products for inhibiting the growth and / or development of breast cancer;

[0017] A12) Preparing products for adjuvant treatment of breast cancer.

[0018] In the above application, the breast cancer chemotherapy drug may specifically be cisplatin.

[0019] In the above application, the breast cancer subtype may be an ER+ breast cancer subtype.

[0020] In the above application, the substance that inhibits the activity and / or expression of GALNT7 protein can specifically be an estrogen receptor inhibitor, GALNT7 siRNA or GALNT7 sgRNA.

[0021] The GALNT7 siRNA may specifically consist of a nucleic acid molecule shown in SEQ ID NO:4 and a nucleic acid molecule shown in SEQ ID NO:5.

[0022] The GALNT7 sgRNA may specifically consist of a nucleic acid molecule shown in SEQ ID NO:1 and a nucleic acid molecule shown in SEQ ID NO:2.

[0023] In the above application, the substance that inhibits the activity and / or expression of ESR1 protein may be ESR1 sgRNA or an estrogen receptor inhibitor.

[0024] The ESR1 sgRNA may specifically consist of a nucleic acid molecule shown in SEQ ID NO:7 and a nucleic acid molecule shown in SEQ ID NO:8.

[0025] In the above application, the estrogen receptor inhibitor may specifically be tamoxifen or fulvestrant. Both fulvestrant and tamoxifen can downregulate GALNT7 expression at the transcriptional level, showing a gradient-dependent effect.

[0026] In the above application, the endoplasmic reticulum stress inducer may be tunicamycin, cisplatin or thapsigargin.

[0027] In the above application, the improvement of endoplasmic reticulum stress level of breast cancer cells can be manifested as at least one of increased expression of endoplasmic reticulum stress-related genes, increased expression of UPR proteins, increased fluorescence intensity of endoplasmic reticulum staining, and increased content of stress product ROS. The UPR proteins mainly include CHOP, XBP1S and GRP78.

[0028] In the above application, the inhibition of breast cancer growth and / or development can be manifested as at least one of decreased tumor weight, decreased tumor volume, increased apoptosis of tumor tissue, and increased DNA damage of tumor tissue.

[0029] The present invention also protects the use of GALNT7 protein or a substance that increases the activity and / or expression of GALNT7 protein, which may be at least one of B1) to B6):

[0030] B1) Reduce the sensitivity of breast cancer cells to the toxicity of endoplasmic reticulum stress inducers;

[0031] B2) Reduce the level of endoplasmic reticulum stress in breast cancer cells;

[0032] B3) Reduce apoptosis and / or DNA damage in breast cancer cells;

[0033] B4) preparing a product for reducing the toxic sensitivity of breast cancer cells to endoplasmic reticulum stress inducers;

[0034] B5) preparing a product for reducing the level of endoplasmic reticulum stress in breast cancer cells;

[0035] B6) Preparing a product for reducing apoptosis and / or DNA damage in breast cancer cells.

[0036] In the above application, any of the above endoplasmic reticulum stress inducers may be tunicamycin, cisplatin or thapsigargin.

[0037] In the above application, the substance that increases the activity and / or expression of the GALNT7 protein is an estrogen receptor activator or ESR1-MUT1 protein.

[0038] The ESR1-MUT1 gene encodes the ESR1-MUT1 protein. The nucleotide sequence of the ESR1-MUT1 gene is shown in SEQ ID NO: 10. The amino acid sequence of the ESR1 protein is shown in SEQ ID NO: 13. Compared with the ESR1 protein, the amino acid sequence of the ESR1-MUT1 protein differs only in that Y at position 537 from the N-terminus of SEQ ID NO: 13 is replaced by S.

[0039] The estrogen receptor activator may be estradiol. Estradiol can regulate GALNT7 expression at the transcriptional level in a gradient-dependent manner.

[0040] In the above application, the reduction of endoplasmic reticulum stress level of breast cancer cells can be manifested as at least one of a reduction in the expression of endoplasmic reticulum stress-related genes, a reduction in the expression of UPR proteins, a reduction in the fluorescence intensity of endoplasmic reticulum staining, and a reduction in the content of stress product ROS. The UPR proteins mainly include CHOP, XBP1S and GRP78.

[0041] In the above application, the GALNT7 protein or a substance that increases the activity and / or expression of the GALNT7 protein can significantly inhibit breast cancer cell death and / or DNA damage induced by tunicamycin or thapsigargin.

[0042] The present invention also protects a sensitizer for breast cancer chemotherapy drugs, which may be C1) or C2) or C3):

[0043] C1) consisting of any of the above substances that inhibit the activity and / or expression of ESR1 protein and an endoplasmic reticulum stress inducer;

[0044] C2) consisting of any of the above substances that inhibit the activity and / or expression of GALNT7 protein and an endoplasmic reticulum stress inducer;

[0045] C3) It is composed of any of the above substances that inhibit the activity and / or expression of ESR1 protein, any of the above substances that inhibit the activity and / or expression of GALNT7 protein, and an endoplasmic reticulum stress inducer.

[0046] The present invention also protects the use of any of the above-mentioned sensitizers, which may be at least one of A1)-A6):

[0047] A1) Increase the sensitivity of breast cancer cells to breast cancer chemotherapy drugs;

[0048] A2) Increase the sensitivity of breast cancer cells to the toxicity of ER stress inducers;

[0049] A3) Increase the level of endoplasmic reticulum stress in breast cancer cells;

[0050] A4) Promote apoptosis and / or DNA damage in breast cancer cells;

[0051] A5) Inhibit the growth and / or development of breast cancer;

[0052] A6) Adjuvant therapy for breast cancer.

[0053] In the above application, the breast cancer chemotherapy drug may specifically be cisplatin.

[0054] In the above application, the breast cancer subtype may be an ER+ breast cancer subtype.

[0055] In the above application, the endoplasmic reticulum stress inducer may be tunicamycin, cisplatin or thapsigargin.

[0056] In the above application, the improvement of endoplasmic reticulum stress level of breast cancer cells can be manifested as at least one of increased expression of endoplasmic reticulum stress-related genes, increased expression of UPR proteins, increased fluorescence intensity of endoplasmic reticulum staining, and increased content of stress product ROS. The UPR proteins mainly include CHOP, XBP1S and GRP78.

[0057] In the above application, the inhibition of breast cancer growth and / or development can be manifested as at least one of decreased tumor weight, decreased tumor volume, increased apoptosis of tumor tissue, and increased DNA damage of tumor tissue.

[0058] In addition, after a large number of experiments, the present application also found that knocking out ESR1 can completely inhibit the expression of GALNT7, and overexpressing ESR1 can significantly enhance the expression level of GALNT7; gene correlation analysis at the single cell level showed that ESR1 was positively correlated with GALNT7, and its expression increased with the progression of cancer; knocking out ESR1 significantly promoted cell death induced by tunicamycin and thapsigargin, and replenishing ESR1 or ESR1-MUT1 protein could partially rescue it; tamoxifen pretreatment significantly increased the toxic sensitivity of thapsigargin at various concentrations; tamoxifen pretreatment significantly increased the expression level of endoplasmic reticulum-related genes induced by thapsigargin; fulvestrant pretreatment combined with tunicamycin significantly increased the expression level of endoplasmic reticulum stress-related proteins CHOP and GRP78, promoted ROS generation and increased the fluorescence intensity of endoplasmic reticulum staining; fulvestrant pretreatment combined with tunicamycin significantly increased the expression of apoptosis-related protein Cleaved-PARP and DNA damage marker γH2AX, and promoted an increase in the apoptosis ratio; fulvestrant pretreatment combined with tunicamycin or thapsigargin further inhibited clone formation. The combined treatment of estrogen receptor inhibitor and endoplasmic reticulum stress inducer can synergistically promote breast cancer cell apoptosis, overcome the inherent drug resistance caused by GALNT7, reduce the occurrence and development of breast cancer, and provide a new strategy for the comprehensive treatment of breast cancer. The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is a bioinformatics comprehensive analysis of the expression level and clinical value prediction of GALNT7 in breast cancer and its subtypes; p < 0.05 is considered statistically significant: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0060] Figure 2 Single-cell sequencing-related bioinformatics analysis was performed to analyze the expression level of GALNT7 in patients in different groups.

[0061] Figure 3 GALNT7 reduces drug sensitivity by inducing intracellular ER stress resistance; p < 0.05 was considered statistically significant: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0062] Figure 4 This is a nude mouse tumor-bearing experiment; p < 0.05 was considered statistically significant: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0063] Figure 5 Heterologous overexpression of GALNT7 significantly reduced ER stress sensitivity; p < 0.05 was considered statistically significant: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0064] Figure 6 ESR1 directly regulates GALNT7 expression at the transcriptional level; p < 0.05 was considered statistically significant: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference.

[0065] Figure 7 Targeting ESR1 and ER stress-inducing drugs synergistically promote cell death; p < 0.05 is considered statistically significant: * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001, and ns indicates no significant difference. DETAILED DESCRIPTION

[0066] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0067] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0068] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0069] The breast cancer cells involved in the following examples include MCF-7, T47D and BT474 cell lines, all of which are estrogen receptor-positive breast cancer cells. The culture medium used to culture breast cancer cells is RPMI 1640 culture medium, exogenously added with 5% (v / v) fresh fetal bovine serum and 1% (v / v) double antibody. RPMI 1640 culture medium, fresh fetal bovine serum and double antibody are all products of Thermo Fisher Scientific. Tunicamycin (Tuni) and thapsigargin (THA) are both products of Sigma. The chemotherapy drug cisplatin is a product of Selleck. Estrogen receptor inhibitors tamoxifen (TAMO), fulvestrant (Ful) and estrogen receptor activator estradiol (E2) are all products of MedChemExpress. CCK-8 cell viability detection kit, crystal violet dye, flow apoptosis detection kit, endoplasmic reticulum green fluorescent probe and ROS probe are all products of Shanghai Biyuntian Biological Co., Ltd. All monoclonal antibodies were products of CST, ProteinTech or Abclonal. qPCR primers and gRNA were synthesized by Beijing Ruibo Biotechnology Co., Ltd. siRNA was synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0070] The MCF-7 breast cancer cells in the following examples are wild-type MCF-7 breast cancer cells.

[0071] The amino acid sequence of the GALNT7 protein is shown in SEQ ID NO:12.

[0072] The amino acid sequence of the ESR1 protein is shown in SEQ ID NO:13.

[0073] The nucleotide sequence of the gene encoding the GALNT7 protein (ie, the GALNT7 gene) is shown in SEQ ID NO:6.

[0074] The GALNT7 domain B deletion is a deletion of the domain B of the GALNT7 protein (encoded by the nucleotide sequence of positions 1141-1341 from the 5' end of SEQ ID NO:6). The nucleotide sequence of the gene encoding the GALNT7 domain B deletion (i.e., the gene of the GALNT7 domain B deletion, named GALNT7 B_LOSS gene) is shown in SEQ ID NO:3, i.e., the GALNT7 B_LOSS gene is the nucleotide sequence after the 1141-1341 positions of the GALNT7 gene from the 5' end are deleted.

[0075] The nucleotide sequence of the gene encoding the ESR1 protein (ie, the ESR1 gene) is shown in SEQ ID NO:9.

[0076] Example 1: Bioinformatics analysis of GALNT7 expression in breast cancer and its subtypes

[0077] 1. Access the TCGA PanCancer Atlas database through the cBioPortal portal to detect the expression level of GALNT7 in various cancer types.

[0078] Results Figure 1 Middle A. The results showed that GALNT7 was highly expressed specifically in breast cancer.

[0079] 2. The TCGA database was used to analyze the average expression level of GALNT7 in breast cancer tissues and non-cancerous tissues.

[0080] Results Figure 1 Middle B. The results showed that the expression of GALNT7 in cancer tissues was significantly higher than that in adjacent adjacent tissues.

[0081] 3. Use the TCGA database to access the survival information of different patients.

[0082] Results Figure 1 Middle C. The results showed that the overall survival rate and disease-free survival of patients in the low GALNT7 expression group were significantly higher than those in the high expression group.

[0083] 4. Use R language to analyze the breast cancer single cell dataset (GSE176078).

[0084] Results Figure 1 The results are as follows: Based on the expression of marker genes, 94,679 single cells were classified by UMAP dimensionality reduction and divided into 7 cell subtypes, namely epithelial cells, endothelial cells, macrophages, fibroblasts, B cells, T cells and mesenchymal cells.

[0085] 5. After completing step 4, epithelial cells are extracted and then classified according to whether the marker genes of different breast cancer subtypes are expressed.

[0086] Results Figure 1 Middle F. The results showed that breast cancer subtypes were divided into three categories according to whether the marker genes were expressed, namely estrogen receptor positive (ER+), human epidermal growth factor receptor positive (HER2+) and triple negative (TNBC).

[0087] 6. After completing step 5, detect the expression level of GALNT7 gene in the above three subtypes.

[0088] Results Figure 1 Middle G. The results showed that GALNT7 was highly expressed specifically in the ER+ breast cancer subtype and was barely expressed in the other two subtypes.

[0089] Example 2: Bioinformatics analysis of GALNT7 expression and clinical value in pancreatic cancer single cell dataset

[0090] The pancreatic cancer dataset (GSE205013) was analyzed with reference to the analysis method for the single-cell sequencing dataset in Example 1.

[0091] The results are as follows:

[0092] Using the expression of marker genes as a reference, single cells were classified into six subtypes using UMAP dimensionality reduction, namely epithelial cells, endothelial cells, macrophages, fibroblasts, B cells and T cells (see Figure 2 Middle A);

[0093] Single gene expression analysis detected that GALNT7 was highly expressed in pancreatic cancer epithelial cells (see Figure 2 Middle B);

[0094] Group single cells by patient-derived label, such as Figure 2 As shown in Figure CD, it is divided into untreated group / treated group and non-progression group / progression group. The difference in the expression of GALNT7 between the above groups was compared to clarify the clinical value and significance of GALNT7. The results showed that compared with the untreated group and the non-progression group, GALNT7 was highly enriched in the treated group and the progress group, suggesting that the high level of GALNT7 is closely related to the formation of drug resistance and the malignant progression of cancer.

[0095] Example 3: Detection of the effect of GALNT7 knockout on the endogenous response of breast cancer cells

[0096] 1. Obtaining GALNT7 monoclonal knockout cell lines

[0097] 1. Human GALNT7 sg-forward: 5′-CACCGACATGAGGCCATGGTACCAC-3′ (SEQ ID NO: 1) and human GALNT7 sg-reverse: 5′-AAACGTGGTACCATGGCCTCATGTC-3′ (SEQID NO: 2) were artificially designed and synthesized, and then annealed to obtain annealing product 1. The pLenti-CRISPR v2 allin one-Puro vector (Addgene) was digested with BsmI (NEB product) to remove the specific filter region, and then the gel was cut and recovered to obtain the vector backbone. The annealing product 1 was ligated with the vector backbone using T4 ligase (Takara product) to obtain the pLenti-CRIPSR V2 all-in-one GALNT7 knockout vector, hereinafter referred to as the GALNT7 knockout vector (puromycin resistance).

[0098] 2. Take HEK 293T cells with excellent growth status, culture them to 80% confluency, and then transfect the GALNT7 knockout vector. Collect the supernatant after 72 hours; filter the supernatant with a 0.45μm filter membrane and collect the filtrate, which is the virus liquid.

[0099] 3. Take MCF-7 breast cancer cells with good growth status, add the virus solution prepared in step 2 to infect for 24 hours when the cell confluence grows to 40%, and then treat with 0.5-1 μg / ml puromycin for 1-2 weeks (the purpose is to screen resistant cells), collect surviving cells and sort them into monoclones in 96-well plates, and each surviving and well-growing monoclonal cell is a GALNT7 monoclonal knockout cell line. Proteins of wild-type MCF-7 breast cancer cells and each amplified GALNT7 monoclonal knockout cell were extracted and detected by western blot, in which GALNT7 rabbit monoclonal antibody (ABclonal) was used as the primary antibody (β-actin was the internal reference protein), and horseradish peroxidase-labeled goat anti-rabbit IgG was used as the secondary antibody.

[0100] Some results can be found in Figure 3 In Figure B (WT is wild-type MCF-7 breast cancer cell, KO is GALNT7 monoclonal knockout cell). The results showed that GALNT7 was completely knocked out in each GALNT7 monoclonal knockout cell, which was recorded as MCF-7 GALNT7 KO cell, KO, GALNT7 KO, or G7 KO.

[0101] 4. Using the GALNT7 gene as a reference, the nucleotide sequence encoding domain B was deleted (shown in SEQ ID NO:6, positions 1141-1341 from the 5' end, domain B is located at positions 381-447 from the N' end of the GALNT7 protein), and a Flag tag (GACTACAAGGACGATGATGACAAG) was added to the front end of ATG, and the deletion fragment was synthesized by Suzhou Junji Gene Technology Co., Ltd., which is the G7 B_LOSS fragment. According to the map of the pLenti-CMV-Neo lentiviral overexpression plasmid vector (geneticin resistance vector), the upstream primer and the downstream primer were designed and synthesized, and then the pLenti-CMV-Neo lentiviral overexpression plasmid vector and the G7 B_LOSS fragment were PCR amplified using KOD One PCR Master Mix high-fidelity polymerase, respectively, to obtain the vector PCR amplification product and the G7 B_LOSS PCR amplification product in turn. Agarose electrophoresis was used to verify the vector PCR amplification product and G7 B_LOSS PCR amplification product, and then purified and the concentration was accurately determined by microplate reader. The vector PCR amplification product and G7 B_LOSS PCR amplification product were digested with DpnI (digestion conditions: 37℃ 2 h), and then the digestion products were connected using a seamless cloning kit (connection conditions: 50℃ connection for 20 min, cooled to 4℃ and stored at -20℃) to obtain a connection mixture. Then 5 μL of the connection mixture was transformed into 50 μL DH5α competent cells, heat-shocked at 42℃ for 45 s, immediately placed on ice, added an appropriate amount of LB medium, and spread on AMP-resistant LB solid medium, and incubated at 37℃ overnight. Then, single clones were picked and shaken, and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for Sanger sequencing. After the correct bacterial solution was expanded and cultured, the plasmid was extracted using a plasmid extraction kit, and the concentration and purity were accurately determined using an enzyme reader, finally obtaining the pLenti-CMV-G7 B_LOSS-Neo vector with appropriate purity and concentration.

[0102] In the above steps, "taking the GALNT7 gene as a reference, deleting the nucleotide sequence encoding domain B" was replaced with "taking the GALNT7 gene as a reference, replacing the gene encoding the amino acid site (QLMQ) in the RICIN domain of the GALNT7 protein for binding to the glycosylation substrate GalNac with the gene encoding four alanines (AAAA)", and the other steps remained unchanged to obtain the pLenti-CMV-G7 MUT-Neo vector. The RICIN domain is located at positions 531-652 from the N'terminus of the GALNT7 protein. The amino acid site (QLMQ, located at positions 578-581 from the N'terminus of the GALNT7 protein) in the RICIN domain of the GALNT7 protein for binding to the glycosylation substrate GalNac was replaced with four alanines (AAAA), and the resulting protein was an enzyme-dead mutant.

[0103] According to the above steps, "taking the GALNT7 gene as a reference, deleting the nucleotide sequence encoding domain B" was replaced with "taking the GALNT7 gene as a reference", and the other steps remained unchanged to obtain the pLenti-CMV-G7 Neo vector.

[0104] 5. The vectors constructed in step 4 were transfected into HEK 293T synthetic virus solution by lentiviral packaging technology, and then transfected into GALNT7 KO cells again. After 24 hours of infection, 500 μg / ml geneticin was used to treat for 1-2 weeks (to screen resistant cells). Surviving cells were collected and sorted for monoclonal cloning in 96-well plates. Each surviving and well-growing monoclonal cell was a recombinant expression monoclonal cell line (the recombinant expression monoclonal cell line complemented with pLenti-CMV-G7 Neo vector was named Re_GALNT7 or Re_G7 or Flag-G7, the recombinant expression monoclonal cell line complemented with pLenti-CMV-G7 B_LOSS-Neo vector was named Re_B LOSS, and the recombinant expression monoclonal cell line complemented with pLenti-CMV-G7 MUT-Neo vector was named Re_MUT). Proteins from WT, KO and the above three complement-expressing cell lines were extracted and verified by western blot, using GALNT7 rabbit monoclonal antibody (ABclonal) as the primary antibody (β-actin as the internal reference protein) and horseradish peroxidase-labeled goat anti-rabbit IgG as the secondary antibody.

[0105] Some results can be found in Figure 3 Middle B.

[0106] 2. RNAseq and GO analysis

[0107] The mRNA of cells (MCF-7 breast cancer cells or MCF-7 GALNT7 KO cells) was extracted using the conventional TRIZOL lysis method and dissolved in DEPC water; the concentration and purity of mRNA were then tested using a microplate reader to ensure that the concentration was higher than 500 ng / µl and the OD value was between 1.8-2.0. The above mRNA was subjected to RNAseq and GO analysis.

[0108] The analysis results are shown in Figure 3 Middle A. The results showed that GALNT7 knockout promoted the positive enrichment of endoplasmic reticulum-related target proteins, suggesting that GALNT7 may be associated with ER stress.

[0109] Effect of GALNT7 knockout on relative cell viability

[0110] 1-2 days in advance, cells (MCF-7 breast cancer cells (i.e. WT), MCF-7 GALNT7 KO cells, Re_G7, Re_BLOSS or Re_MUT) were evenly spread in a sterile imported 96-well plate to a density of 3000 cells / well, and 100 µl of culture medium was added to each well. When the cell confluence reached 30-40%, medium containing DMSO (as a control group), medium containing 5 μM THA or medium containing 10 μM Tuni was added, and cultured continuously in a 37°C constant temperature incubator for 48 h. After incubation, the OD of the system was detected using the CCK8 method. 450nm Calculate the relative cell viability.

[0111] The results of cell viability assay are shown in Figure 3 Middle C. The results showed that compared with MCF-7 breast cancer cells, GALNT7 monoclonal knockout cells had significantly increased sensitivity to Tuni and THA toxicity and a large increase in cell death; GALNT7 complement expression (Re_G7) could effectively improve Tuni and THA-induced cell death, but expression of domain B deletion (Re_B LOSS) and enzymatic dead mutant GALNT7 (Re_MUT) could not rescue the increased cell death.

[0112] Effects of GALNT7 knockout on cell apoptosis

[0113] Cells (MCF-7 breast cancer cells (WT), MCF-7 GALNT7 KO cells, Re_G7, Re_BLOSS or Re_MUT) were cultured in medium containing 10 μM Tuni for 48 h. Afterwards, cell proteins were extracted and western blot was used to detect the expression of apoptotic proteins (PARP / Cleaved-PARP) and DNA damage markers (γH2AX) after treatment (β-actin was used as an internal reference protein).

[0114] Test results see Figure 3 Middle D. The results showed that the sensitivity of GALNT7 monoclonal knockout cells to Tuni toxicity was significantly increased, with the protein expression of Tuni-treated MCF-7 breast cancer cells as the control. Re_G7 effectively reduced the expression of the above proteins, but Re_BLOSS and Re_MUT could not rescue the apoptotic phenotype.

[0115] At the same time, a similar experiment was performed using a flow cytometry apoptosis detection kit. After 24 h of treatment with 10 μM Tuni, the apoptosis folds of MCF-7 breast cancer cells were compared using the apoptosis ratio as a control.

[0116] Test results see Figure 3 Middle E. Figure 3 The results of E and Figure 3 The results of D are exactly the same.

[0117] 5. Effects of GALNT7 knockout on UPR proteins

[0118] Endoplasmic reticulum stress activates the unfolded protein response (UPR) in cells for compensatory repair, activating survival pathways through pro-survival signaling cascades to relieve stress. Cells (MCF-7 breast cancer cells (i.e. WT), MCF-7 GALNT7 KO cells, Re_G7, Re_BLOSS or Re_MUT) were treated with 10 μM Tuni for 48 h, and then western blot was used to detect typical UPR-related proteins, mainly including CHOP, XBP1S and GRP78.

[0119] Test results see Figure 3 Middle F. The results showed that compared with wild-type cells, MCF-7 GALNT7 KO cells significantly increased Tuni toxicity sensitivity and the expression of three UPR proteins surged. Wild-type GALNT7 complement expression effectively reduced protein expression, but both mutants could not rescue the surge in UPR.

[0120] At the same time, a similar experiment was conducted using the endoplasmic reticulum green fluorescent probe. After 24 h of treatment with 10 μM Tuni, the average fluorescence intensity of the endoplasmic reticulum of wild-type cells under Tuni treatment was used as a control to compare the fluorescence intensity multiple differences of other cells.

[0121] Test results see Figure 3 The results showed that Figure 3 The results of F and Figure 3 The results of G are exactly the same.

[0122] VI. Effects of GALNT7 knockout on ER stress-related genes

[0123] The cells (MCF-7 breast cancer cells (i.e., WT), MCF-7 GALNT7 KO cells, Re_G7, Re_BLOSS, or Re_MUT) were treated with 10 μM Tuni for 12 h, and then the expression of various ER stress-related genes was detected by fluorescence quantitative qPCR.

[0124] Test results see Figure 3 The results showed that, with the expression of each gene in wild-type cells under Tuni treatment as the control, GALNT7 knockout significantly increased the sensitivity to Tuni toxicity, the expression of the above-mentioned multiple ER stress-related genes surged, the UPR was severely disturbed, and the wild-type GALNT7 complement expression effectively reduced the expression of stress genes, but the two mutants could not rescue the surge in the expression of the above-mentioned genes.

[0125] VII. Effect of GALNT7 knockout on ROS content

[0126] Severe ER stress often leads to the activation of intracellular oxidative stress pathways, produces a large amount of ROS, and activates cell apoptosis signals. Cells (MCF-7 breast cancer cells (i.e. WT), MCF-7 GALNT7 KO cells, Re_G7, Re_BLOSS, or Re_MUT) were treated with 10 μM Tuni for 24 h, and then the ROS generation level was detected using a ROS probe.

[0127] Test results see Figure 3 The results showed that, with the ROS content of wild-type cells under Tuni treatment as the control, GALNT7 knockout significantly increased the sensitivity to Tuni toxicity, and the ROS content was significantly upregulated. Wild-type GALNT7 complement expression effectively alleviated the stress-induced generation of ROS, but the two mutants could not rescue the increase in ROS content.

[0128] These results indicate that the ER stress resistance function mediated by GALNT7 depends on the integrity of its domain B and normal enzymatic activity.

[0129] Example 4: Nude mouse tumor-bearing experiment verification

[0130] SPF-grade female BALB / c nude mice are products of Beijing Charles River Company and are raised in the SPF-grade animal breeding center of China Agricultural University; the following SPF-grade female BALB / c nude mice are referred to as nude mice.

[0131] 1. Take 5-week-old nude mice and inoculate cells (MCF-7 breast cancer cells or MCF-7GALNT7 KO cells) subcutaneously in the right axilla of each mouse. The cell inoculation concentration is 1×10 6Each cell was inoculated with 100 μl of PBS:Matrigel=1:1 (Matrigel is a matrix gel purchased from Thermo Fisher Scientific).

[0132] 2. After completing step 1 1-2 weeks, the nude mice with successful tumor transplantation were randomly divided into a drug-treated group (n=8) and a control group (n=8). The control group was treated with solvent DMSO (1%), and the drug-treated group was treated with cisplatin (20 mg / kg / day), once every two days for a total of 20 days, and the administration method was intraperitoneal injection. During the experiment, tumor weight, tumor volume and nude mouse body weight were measured every other day.

[0133] The experimental results are shown in Figure 4 AD (WT-Veh or WT means inoculation of MCF-7 cells and treatment with DMSO, GALNT7 KO-Veh or G7 KO-Veh or G7 KO means inoculation of MCF-7 GALNT7 KO cells and treatment with DMSO, WT-Cisplatin or WT-Cis or WT+Cis means inoculation of MCF-7 cells and treatment with 20 mg / kg cisplatin, KO-Cisplatin or G7 KO-Cis or G7 KO+Cis means inoculation of MCF-7 GALNT7 KO cells and treatment with 20 mg / kg cisplatin). The results showed that in the control group, there was no significant difference in tumor volume and tumor weight between inoculation of MCF-7 cells and MCF-7 GALNT7 KO; in the drug-treated group, the tumor volume and tumor weight of MCF-7 GALNT7 KO were significantly smaller than those of MCF-7 cells; there was no significant difference in the body weight of nude mice in the four groups, indicating that the nude mice grew normally. It can be seen that knocking out GALNT7 can effectively increase the drug sensitivity of cisplatin, promote the toxicity of the drug in the body, and reduce the occurrence and development of tumors.

[0134] 3. Extract proteins from the four groups of tumor tissues in step 2 respectively, and detect apoptosis effectors and DNA damage marker proteins.

[0135] Test results see Figure 4Middle G (WT-Veh or WT means MCF-7 cells were inoculated and treated with DMSO, GALNT7 KO-Veh or G7 KO-Veh or G7 KO means MCF-7 GALNT7 KO cells were inoculated and treated with DMSO, WT-Cisplatin or WT-Cis or WT+Cis means MCF-7 cells were inoculated and treated with 20 mg / kg of cisplatin, KO-Cisplatin or G7 KO-Cis or G7 KO+Cis means MCF-7 GALNT7 KO cells were inoculated and treated with 20 mg / kg of cisplatin). The results showed that intratumoral apoptosis and DNA damage were significantly increased in the KO-Cisplatin group.

[0136] 4. An in vitro clone formation experiment was used to detect the sensitivity of cells (MCF-7 WT, GALNT7 KO, Re_G7, Re_B LOSS or Re_MUT) to Tuni and cisplatin toxicity. Low concentrations of Tuni (1 μM) and cisplatin (1 μM) were treated continuously for 1 week. After formaldehyde fixation for 15 min, crystal violet staining was performed for 20 min. After sufficient PBS rinsing, the distribution of monoclonal counts was observed and counted.

[0137] Test results see Figure 4 Middle E and F. The results showed that the sensitivity of MCF-7 GALNT7 KO cells and their mutants to the toxicity of ER stress inducers (such as Tuni and cisplatin) was significantly enhanced, the number of monoclonal clones decreased sharply, and only the wild-type GALNT7 complementation group was effectively alleviated.

[0138] Example 5: Study on ER stress sensitivity under heterologous overexpression of GALNT7 and its mutants

[0139] 1. After adding a Flag tag to the front end of the ATG of the GALNT7 gene, it was synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd. to obtain the Flag-GALNT7 fragment. According to the map of the pLenti-CMV-Puro lentiviral vector (puromycin resistance vector), the upstream primer and the downstream primer were designed and synthesized, and then the pLenti-CMV-Puro lentiviral vector and the Flag-GALNT7 fragment were PCR amplified using KOD One PCR Master Mix high-fidelity polymerase, respectively, to obtain the lentiviral vector PCR amplification product and the GALNT7 amplification product in turn, which were then purified and the concentration was accurately determined by the microplate reader. The vector PCR amplification product and the GALNT7 amplification product were digested with DpnI (digestion conditions: 37℃ 2 h), and then the digestion products were connected using a seamless cloning kit (connection conditions: 50℃ connection for 20 min, cooled to 4℃ and stored at -20℃), to obtain a connection mixture. Then 5 μL of the ligation mixture was transformed into 50 μL of DH5α competent cells, and immediately placed on ice after heat shock at 42°C for 45 s. After adding an appropriate amount of LB medium, it was spread on LB solid medium containing AMP resistance and incubated at 37°C overnight. After that, a single clone was picked and shaken, and sent to Beijing Ruiboxing Biotechnology Co., Ltd. for Sanger sequencing. After the correct bacterial solution was expanded and cultured, the plasmid was extracted using a plasmid extraction kit and the concentration and purity were accurately determined using an ELISA reader, and finally the pLenti-CMV-GALNT7-Puro vector with appropriate purity and concentration was obtained.

[0140] The GALNT7 gene in the above steps was replaced with the GALNT7 B_LOSS gene, and the other steps remained unchanged to obtain the pLenti-CMV-G7 B_LOSS-Puro vector.

[0141] The vector (pLenti-CMV-GALNT7-Puro vector, pLenti-CMV-G7 B_LOSS-Puro vector or pLenti-CMV-Puro lentiviral vector) was transfected into wild-type MCF-7 cells by lentiviral packaging technology. After 24 hours of infection, 0.5-1 μg / ml puromycin was used to kill the cells for 1-2 weeks. After no further cell death was observed, protein was extracted and the expression of GALNT7 was detected by western blot. β-actin was used as the internal reference protein. The pLenti-CMV-Puro lentiviral vector was used as a control.

[0142] Test results see Figure 5In A (GALNT7 OE is a cell overexpressing wild-type GALNT7 (i.e., cells transfected with pLenti-CMV-GALNT7-Puro vector), B LOSS OE is a cell overexpressing GALNT7 domain B deletion (i.e., cells transfected with pLenti-CMV-G7 B_LOSS-Puro vector), and WT is a cell transfected with pLenti-CMV-Puro lentiviral vector). The results showed that compared with wild-type MCF-7 cells, GALNT7 in the GALNT7 overexpressing cells was significantly enhanced, while a band with a molecular weight slightly lower than that of GALNT7, namely the G7 B_LOSS fragment, existed in the GALNT7 domain B deletion overexpressing cells, indicating that the cell line was successfully constructed.

[0143] 2. 1-2 days in advance, evenly spread breast cancer cell lines (MCF-7 cells, MCF-7 cells overexpressing GALNT7, or MCF-7 cells overexpressing GALNT7 domain B deletion) on a sterile imported 96-well plate at a density of 3000 cells / well, and add 100µl of culture medium to each well. When the cell confluence reaches 30-40%, add culture medium (as a control group) or drug culture medium containing 5 μM THA or 10 μM Tuni, and culture continuously in a 37°C constant temperature incubator for 48 hours. After incubation, use the CCK8 method to detect the OD of the system. 450nm Calculate the relative cell viability.

[0144] The results of cell viability assay are shown in Figure 5 Figure B (WT is the control group, WT_GALNT7 is overexpressing wild-type GALNT7, and BLOSS_GALNT7 is overexpressing GALNT7 domain B deletion). The results showed that after 48 h of Tuni or THA treatment, GALNT7 OE cells (i.e., MCF-7 cells overexpressing GALNT7) were significantly less sensitive to Tuni or THA toxicity and had increased cell viability compared with MCF-7 cells, but BLOSS OE cells (i.e., MCF-7 cells overexpressing GALNT7 domain B deletion) could not effectively improve Tuni or THA-induced cell death.

[0145] 3. An in vitro clone formation experiment was used to detect the toxicity sensitivity of breast cancer cell lines (MCF-7 cells, MCF-7 cells overexpressing GALNT7, or MCF-7 cells overexpressing GALNT7 domain B deletion) under Tuni treatment. Low concentration of Tuni (1 μM) was treated continuously for 1 week, and then the cells were fixed with formaldehyde for 15 min and stained with crystal violet for 20 min. After sufficient rinsing with PBS, the distribution of monoclonal counts was observed and counted.

[0146] Test results see Figure 5Middle C (WT is the control group, GALNT7 is the MCF-7 cells overexpressing GALNT7, and G7 B LOSS is the MCF-7 cells overexpressing domain B deletion). Compared with MCF-7 cells, GALNT7 OE cells (i.e., MCF-7 cells overexpressing GALNT7) significantly inhibited the drug toxicity of Tuni, and the number of monoclonal clones increased, but B LOSS OE cells (i.e., MCF-7 cells overexpressing domain B deletion) could not be effectively alleviated, and the number of monoclonal clones was similar to that of MCF-7 cells.

[0147] 4. Western blot was used to detect typical UPR proteins in breast cancer cell lines (MCF-7 cells, MCF-7 cells overexpressing GALNT7, or MCF-7 cells overexpressing GALNT7 domain B deletion) after simultaneous addition of 10 μM Tuni for 48 h, mainly including CHOP, XBP1S and GRP78.

[0148] Test results see Figure 5 Figure D (WT is the control group, GALNT7 is MCF-7 cells overexpressing GALNT7, and G7 B LOSS is MCF-7 cells overexpressing domain B deletion). Compared with MCF-7 cells, GALNT7 OE cells (i.e., MCF-7 cells overexpressing GALNT7) significantly downregulated the level of ER stress induced by Tuni, as shown by the suppressed expression level of UPR proteins, but B LOSS OE cells (i.e., MCF-7 cells overexpressing GALNT7 domain B deletion) could not effectively reduce the expression of UPR proteins, which was similar to the expression of MCF-7 cells.

[0149] 5. Fluorescence quantitative qPCR was used to detect the expression of multiple ER stress-related genes in breast cancer cell lines (MCF-7 cells, MCF-7 cells overexpressing GALNT7, or MCF-7 cells overexpressing GALNT7 domain B deletion) after simultaneous addition of 10 μM Tuni for 12 h.

[0150] Test results see Figure 5Middle E (G7 OE is a cell overexpressing wild-type GALNT7 (i.e., cells transfected with pLenti-CMV-GALNT7-Puro vector), B LOSS OE is a cell overexpressing GALNT7 domain B deletion (i.e., cells transfected with pLenti-CMV-G7 B_LOSS-Puro vector), and WT is a cell transfected with pLenti-CMV-Puro lentiviral vector). Taking the expression of each gene under Tuni treatment in MCF-7 cells as a control, GALNT7 OE cells (i.e., MCF-7 cells overexpressing GALNT7) significantly downregulated the expression level of ER stress-related genes induced by Tuni, as shown by the downregulated gene expression fold, but B LOSS OE cells (i.e., MCF-7 cells overexpressing domain B deletion) could not effectively reduce the expression fold of the above genes, and the overall expression was similar to that of MCF-7 cells.

[0151] A similar experiment was conducted using the endoplasmic reticulum green fluorescent probe. After 24 h of treatment with 10 μM Tuni, the average fluorescence intensity of the endoplasmic reticulum of MCF-7 cells treated with Tuni was used as the control to compare the fluorescence intensity multiple difference. Figure 5 F (G7 OE is a cell overexpressing wild-type GALNT7 (i.e., cells transfected with pLenti-CMV-GALNT7-Puro vector), B LOSS G7OE is a cell overexpressing GALNT7 domain B deletion (i.e., cells transfected with pLenti-CMV-G7 B_LOSS-Puro vector), and WT is a cell transfected with pLenti-CMV-Puro lentiviral vector). The results showed that Figure 5 The results of F and Figure 5 The results of E are exactly the same.

[0152] 6. Western blot was used to detect the expression of apoptotic proteins and DNA damage markers in breast cancer cell lines (MCF-7 cells, MCF-7 cells overexpressing GALNT7, or MCF-7 cells overexpressing GALNT7 domain B deletion) after simultaneous addition of 10 μM Tuni for 48 hours.

[0153] Test results see Figure 5Middle G (G7 OE is a cell overexpressing wild-type GALNT7 (i.e., cells transfected with pLenti-CMV-GALNT7-Puro vector), G7 B_LOSS is a cell overexpressing GALNT7 domain B deletion (i.e., cells transfected with pLenti-CMV-G7 B_LOSS-Puro vector), and WT is a cell transfected with pLenti-CMV-Puro lentiviral vector). Taking the protein expression of MCF-7 cells under Tuni treatment as the control, MCF-7 cells overexpressing GALNT7 significantly downregulated Tuni-induced cell apoptosis, as shown by the decreased expression of apoptosis-related proteins, while MCF-7 cells overexpressing GALNT7 domain B deletion could not effectively alleviate the expression level of apoptotic proteins.

[0154] Example 6: ESR1 directly regulates GALNT7 transcriptional expression in breast cancer

[0155] About 70% of breast cancer patients are estrogen receptor-positive and are the main subjects of endocrine therapy. The important molecular feature of this subtype is the expression of estrogen receptor α, which is encoded by the ESR1 gene in the human body. Bioinformatics and single-cell sequencing data analysis of GALNT7 suggest that GALNT7 is highly enriched in estrogen receptor-positive subtypes, while it is almost not expressed in other subtypes (HER2-positive, triple-negative TNBC). Therefore, it is reasonable to speculate that ESR1 may highly regulate the transcriptional expression of GALNT7 as a transcription factor. Based on this, the inventors of the present application conducted the following experiments.

[0156] 1. Wild-type MCF-7 cells were incubated with different concentrations of estrogen receptor inhibitors tamoxifen and fulvestrant and estrogen receptor activator estradiol (DMSO solvent treatment group was used as control), and then the expression level of GALNT7 was detected by fluorescence quantitative qPCR, and the expression fold difference was compared.

[0157] Test results see Figure 6 The results showed that both tamoxifen and fulvestrant significantly inhibited the transcriptional expression of GALNT7, while estradiol significantly activated the transcriptional expression of GALNT7, and the above reagents were concentration gradient-dependent.

[0158] 2. Use different concentrations (see Figure 6 (C) MCF-7 cells were treated with fulvestrant for 48 h, and the expression levels of ESR1 and GALNT7 were detected by western blot.

[0159] Test results see Figure 6 Middle C. The results showed that with the increase of fulvestrant concentration, the expression of ESR1 and GALNT7 gradually decreased.

[0160] 3. Use different concentrations (see Figure 6 (D) MCF-7 cells were treated with estradiol for 48 h, and the expression levels of ESR1 and GALNT7 were detected by western blot.

[0161] Test results see Figure 6 Middle D. The results showed that with the increase of estradiol concentration, the expression of ESR1 and GALNT7 gradually increased.

[0162] 4. Three estrogen receptor-positive breast cancer cell lines (MCF-7, T47D and BT474) were treated with solvent control, estradiol alone (250 nM), fulvestrant alone (10 μM) and combined treatment for 48 h, and the expression level of GALNT7 was detected by western blot.

[0163] Test results see Figure 6 Middle E. The results showed that compared with the solvent control group, estradiol alone promoted GALNT7 expression, fulvestrant alone reduced GALNT7 expression, and the expression of GALNT7 was almost inhibited under combined treatment.

[0164] 5. With the ESR1 gene as a reference, the Flag tag was added to the front end of ATG and synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd., i.e., the Flag-ESR1 fragment. Upstream primers and downstream primers were designed and synthesized according to the map of the pLenti-CMV-Puro lentiviral vector (puromycin resistance vector), and then the KOD One PCR Master Mix high-fidelity polymerase was used to PCR amplify the pLenti-CMV-Puro lentiviral vector and the Flag-ESR1 fragment, respectively, to obtain the lentiviral vector PCR amplification product and the ESR1 amplification product, which were then purified and the concentration was accurately determined by the microplate reader. The vector PCR amplification product and the ESR1 amplification product were respectively digested with DpnI (digestion conditions: 37℃ 2 h), and then the digestion products were connected using a seamless cloning kit (connection conditions: 50℃ connection for 20 min, cooled to 4℃ and stored at -20℃), to obtain a connection mixture. Then 5 μL of the ligation mixture was transformed into 50 μL of DH5α competent cells, and immediately placed on ice after heat shock at 42°C for 45 s. After adding an appropriate amount of LB medium, it was spread on LB solid medium containing AMP resistance and incubated at 37°C overnight. After that, a single clone was picked and shaken, and sent to Beijing Ruiboxing Biotechnology Co., Ltd. for Sanger sequencing. After the correct bacterial solution was expanded and cultured, the plasmid was extracted using a plasmid extraction kit and the concentration and purity were accurately determined using an ELISA reader, and finally the pLenti-CMV-ESR1-Puro vector with appropriate purity and concentration was obtained.

[0165] The pLenti-CMV-ESR1-Puro vector was transfected into wild-type MCF-7 cells using lentiviral packaging technology. 24 hours after infection, the cells were killed with 0.5-1 μg / ml puromycin for 1-2 weeks. The cells were expanded and cultured to extract proteins. The cell lines were treated with 250 nM estradiol (E2) or not for 48 hours, and the expression of GALNT7 was detected by western blot. β-actin was used as the internal reference protein.

[0166] Test results see Figure 6 Middle F. The results showed that compared with MCF-7 cells, the GALNT7 content in MCF-7 cells overexpressing ESR1 (i.e., cells transfected with the pLenti-CMV-ESR1-Puro vector) was significantly increased, and the addition of estradiol further stimulated its expression level.

[0167] 6. Obtaining ESR1 monoclonal knockout cell lines

[0168] (1) Human ESR1 sg1-forward: 5′-CACCGCTCGGGGTAGTTGTACACGG-3′ (SEQ ID NO: 7) and human ESR1 sg1-reverse: 5′-AAACCCGTGTACAACTACCCCGAGC-3′ (SEQID NO: 8) were artificially designed and synthesized, and then annealed to obtain annealing products. The pLenti-CRISPR v2 all-in-one-Puro vector (Addgene) was digested with BsmI (NEB product) to remove the specific filter region, and the vector backbone was obtained by gel extraction. The annealing product was then ligated with the vector backbone using T4 ligase (Takara product) to obtain the pLenti-CRIPSR V2 all-in-one ESR1 knockout vector (puromycin resistance).

[0169] (2) Take HEK 293T cells in excellent growth condition, culture them to 80% confluency, and then transfect them with ESR1 knockout vector. Collect the supernatant after 72 hours; filter the supernatant with a 0.45 μm filter membrane and collect the filtrate, which is the virus liquid.

[0170] (3) Take MCF-7 breast cancer cells with good growth status, add the virus solution prepared in step (2) to infect for 24 hours when the cell confluence grows to 40%, and then treat with 0.5-1 μg / ml puromycin for 1-2 weeks (the purpose is to screen resistant cells), collect surviving cells and sort them into monoclonal cells in a 96-well plate, and each surviving and well-growing monoclonal cell is an ESR1 monoclonal knockout cell line. Proteins of MCF-7 breast cancer cells and each amplified ESR1 monoclonal knockout cell were extracted and western blot was performed, in which ESR1 rabbit monoclonal antibody (product of ABclonal company) was used as the primary antibody (β-actin was the internal reference protein), and horseradish peroxidase-labeled goat anti-rabbit IgG was used as the secondary antibody.

[0171] Some results can be found in Figure 6 Middle G (WT is MCF-7 breast cancer cells, KO is ESR1 monoclonal knockout cells). The results showed that ESR1 was almost completely absent in each ESR1 monoclonal knockout cell, indicating that the cell line was successfully constructed. Importantly, GALNT7 expression was almost completely deprived in each ESR1 monoclonal knockout cell, indicating that GALNT7 is highly dependent on the expression of ESR1. ESR1 monoclonal knockout cells are MCF-7 ESR1 KO cells or ESR1 KO.

[0172] 7. Design and synthesize siRNA sequences targeting GALNT7 and control group siRNA sequences to obtain siRNA dry powder. The siRNA sequences targeting GALNT7 are CGCCCAUUUAUGUUGGGUCUUTT (shown in SEQ ID NO:4) and AAGACCCAACAUAAAUGGGCGTT (shown in SEQ ID NO:5). Wild-type MCF-7 cells were plated in sterile 6-well plates in advance, and transfection was started when the confluence was about 30-50%. Dissolve 2.5 nmol of siRNA dry powder in 125µl sterile purified water in each tube, dilute to a mother solution concentration of 20 μM, and the working concentration is 100 nM. Transfect wild-type MCF-7 cells with opti-MEM medium and mixed LipoRNA transfection reagent, replace fresh medium 6 hours after transfection, extract protein 48 hours after transfection, and use western blot to detect the expression of GALNT7, with β-actin as the internal reference protein.

[0173] Test results see Figure 6Middle H. The results showed that the GALNT7 knockdown cell line (named shGALNT7) was successfully constructed, and the cell line of the control group was named shNT. In addition, wild-type MCF-7 cells and GALNT7 knockdown cells were treated with or without fulvestrant to further verify whether GALNT7 was regulated by estrogen receptors.

[0174] 8. One day in advance, shGALNT7 and shNT control cells were evenly spread in sterile imported 96-well plates to a density of 3000 cells / well, and 100 µl of culture medium was added to each well. When the cell confluence reached 30-40%, culture medium containing 10 μM Fulvestrant was added or not, and incubated in a 37°C constant temperature incubator for 24 h in advance. After the incubation, 10 μM Tuni was added and continued for 48 h. After the end, the OD450nm value of the system was detected by CCK8 method to calculate the relative cell viability.

[0175] The results of cell viability assay are shown in Figure 6 Middle J (shNT is the control group). The results showed that for shNT cells, pre-treatment with fulvestrant significantly increased the ER stress sensitivity of Tuni and increased cell death; but for shGALNT7 cells, pre-treatment with fulvestrant could not achieve sensitization. The above results show that the effectiveness of fulvestrant combined lethality depends on the basal expression of GALNT7.

[0176] 9. The GALNT7 overexpression cell line (GALNT7-ctrl) was constructed in the same manner as in Example 5, and the control group cells were Vector-ctrl. Vector-ctrl and GALNT7-ctrl were treated with or without fulvestrant, i.e., Vector-Ful and GALNT7-Ful, respectively, and the expression of GALNT7 was detected by western blot, with β-actin as the internal reference protein.

[0177] Test results see Figure 6 Figure I (GALNT7 is a GALNT7 overexpression cell line, and Vector is an MCF-7 cell transfected with an empty vector). The results showed that the GALNT7 overexpression cell line was successfully constructed, but the 48-h incubation with 10 μM fulvestrant significantly reduced the increased GALNT7 expression, which once again verified that GALNT7 is indeed directly regulated by the estrogen receptor.

[0178] 10. One day in advance, the GALNT7 overexpressing cell line and the MCF-7 cells with empty vector were evenly spread in a sterile imported 96-well plate to a density of 3000 cells / well, and 100 µl of culture medium was added to each well. When the cell confluence reached 30-40%, medium containing 10 μM Fulvestrant was added or not, and incubated in a 37°C constant temperature incubator for 24 h in advance. After the incubation, 10 μM Tuni was added and continued for 48 h. After the end, the OD450nm value of the system was detected by CCK8 method to calculate the relative cell viability.

[0179] The results of cell viability assay are shown in Figure 6 Middle K (Vector-ctrl is the control group). The results showed that for Vector-ctrl, pre-treatment with fulvestrant significantly increased Tuni's ER stress sensitivity and increased cell death; but for GALNT7 overexpressing cell lines, pre-treatment with fulvestrant was unable to increase sensitivity. This shows that overexpression of GALNT7 effectively offsets the synergistic lethal effect of fulvestrant and exerts a core ER stress resistance effect downstream of ESR1.

[0180] 11. Perform dual gene expression correlation analysis based on breast cancer single cell dataset, such as Figure 6 As shown in L. The results showed that ESR1 and GALNT7 expression were significantly positively correlated, with a correlation coefficient of 0.22. In addition, gene expression correlation analysis based on the TCGA database once again verified that the two were positively correlated, with an R value of 0.62, which was significant.

[0181] 12. Based on the breast cancer TCGA database, the relationship between the expression levels of the two and the progression of cancer in patients was explored, such as Figure 6 The results showed that the expression levels of ESR1 and GALNT7 were significantly higher in the terminal stage (Stage X) of breast cancer, suggesting that the coordinated expression of the two has clinical marker value.

[0182] Example 7: Combining ESR1 inhibitors and ER stress inducers to synergistically promote cell death and effectively increase ER stress sensitivity

[0183] In order to study whether clinically relevant ESR1 mutants affect the expression of GALNT7, Suzhou Junji Gene Technology Co., Ltd. was responsible for optimizing and synthesizing two mutants of the ESR1 gene, which were named ESR1-MUT1 gene and ESR1-MUT2 gene. The nucleotide sequence of the ESR1-MUT1 gene is shown in SEQ ID NO:10. The nucleotide sequence of the ESR1-MUT2 gene is shown in SEQ ID NO:11. The ESR1-MUT1 gene encodes the ESR1-MUT1 protein. Compared with the ESR1 protein, the amino acid sequence of the ESR1-MUT1 protein differs only in that Y at position 537 is replaced by S. The ESR1-MUT2 gene encodes the ESR1-MUT2 protein. Compared with the ESR1 protein, the amino acid sequence of the ESR1-MUT2 protein differs only in that D at position 538 is replaced by G.

[0184] 1. Compared with wild-type MCF-7 cells, the GALNT7 content in MCF-7 cells overexpressing ESR1, MCF-7 cells overexpressing ESR1-MUT1 protein, and MCF-7 cells overexpressing ESR1-MUT2 protein increased significantly. In particular, MCF-7 cells overexpressing ESR1-MUT1 protein strongly drove GALNT7 expression, with the highest relative abundance (see Figure 7 Middle A).

[0185] 2. In the ESR1 monoclonal knockout cell line, ESR1 protein and ESR1-MUT1 protein were complemented, and then stable cell lines were constructed according to similar methods to obtain complemented ESR1 expression cell lines and complemented ESR1-MUT1 expression cell lines. Western blot was used to detect the expression of GALNT7, and β-actin was used as the internal reference protein.

[0186] Test results see Figure 7 Middle B. The results showed that compared with the ESR1 monoclonal knockout cell line, GALNT7 expression was also restored in the ESR1-replenishing cell line, and GALNT7 expression was further significantly increased in the ESR1-replenishing cell line.

[0187] 3. One day in advance, evenly spread the cell lines (MCF-7 cells, ESR1 monoclonal knockout cell lines, complemented ESR1 expression cell lines or complemented ESR1-MUT1 expression cell lines) in a sterile imported 96-well plate to a density of 3000 cells / well, and add 100 µl of culture medium to each well. When the cell confluence reaches 30-40%, add culture medium containing 10 μM Tuni and incubate in a 37°C constant temperature incubator for 48 h. After incubation, use the CCK8 method to detect the OD of the system 450nm Calculate the relative cell viability.

[0188] The results of cell viability assay are shown in Figure 7 Middle C (WT is the control group). The results showed that for MCF-7 cells, ESR1 knockout significantly increased ER stress sensitivity and cell death, ESR1 complement expression effectively alleviated the increased death, and ESR1-MUT1 complement completely overcame Tuni-induced cell death, and cell viability was significantly higher than the control group.

[0189] 4. Use western blot to detect the expression of apoptotic proteins and DNA damage markers in cell lines (MCF-7 cells, ESR1 monoclonal knockout cell lines, ESR1 complement-expressing cell lines or ESR1-MUT1 complement-expressing cell lines) after simultaneous addition of 10 μM Tuni for 48 h.

[0190] Test results see Figure 7 Middle D. The results showed that, with the protein expression of MCF-7 cells treated with Tuni as the control, ESR1 knockout significantly upregulated Tuni-induced cell apoptosis, ESR1 complement expression effectively alleviated the increased apoptosis level, and ESR1-MUT1 complement almost completely inhibited Tuni-induced cell apoptosis. This result is consistent with the cell viability results.

[0191] 5. One day in advance, evenly spread MCF-7 cells in a sterile imported 96-well plate to a density of 3,000 cells / well, and add 100 µl of culture medium to each well. When the cell confluence reaches 30-40%, add culture medium containing 1 mM TAMO or solvent control group (DMSO) and incubate in a 37°C constant temperature incubator for 24 h. After the incubation, add THA at the continuous concentration shown in the figure and continue to treat for 48 h. Finally, use the CCK8 method to detect the OD of the system. 450nm Calculate the relative cell viability.

[0192] The results of gradient cell viability assay of MCF-7 cells are shown in Figure 7 Middle E (DMSO was the control group). The results showed that TAMO pretreatment effectively increased THA-induced cell death.

[0193] 6. Fluorescence quantitative qPCR was used to detect the expression of various ER stress-related genes in MCF-7 cells under different treatments. The cells were divided into untreated group, THA alone treatment group (5 μM), TAMO alone treatment group (1 mM), and TAMO+THA combined treatment group, which were treated for 12 h respectively.

[0194] Test results see Figure 7Middle F. The results showed that, with untreated MCF-7 cells as the control, THA alone treatment group significantly increased the expression of multiple ER stress-related genes, especially upregulation of UPR-related genes, indicating the generation of ER stress; TAMO alone treatment group had almost no effect on the expression of the above genes; while the gene expression level of TAMO+THA combined treatment group was significantly higher than that of THA alone treatment group, indicating that TAMO pre-treatment increased the sensitivity of cells to THA-induced ER stress.

[0195] 7. Use western blot to detect the expression of UPR protein under the above four treatments.

[0196] Test results see Figure 7 Middle G. The results showed that compared with the Tuni single treatment group (10 μM, 48 h), the combined treatment group (Both) significantly induced the up-regulated expression of CHOP and GRP78, indicating a dramatic increase in ER stress.

[0197] 8. Use flow cytometry apoptosis detection kit to detect the apoptosis ratio under the above four treatments.

[0198] Test results see Figure 7 The results showed that compared with the Tuni single treatment group (10 μM, 24 h), the combined treatment group (Both) significantly induced an increase in the apoptosis rate.

[0199] At the same time, apoptotic proteins and DNA damage markers were detected by western blot, and similar results were obtained (see Figure 7 Middle I).

[0200] The above results indicate that estrogen receptor inhibitors (TAMO or Ful) combined with ER stress inducers (Tuni or THA) can significantly increase cell apoptosis.

[0201] 9. Severe ER stress often leads to activation of intracellular oxidative stress pathways, generating a large amount of ROS-mediated apoptosis. ROS probes were used to detect the ROS content under the above four treatments. Figure 7 As shown in middle J. The results showed that compared with the Tuni single treatment group (10 μM, 24 h), the combined treatment group (Both) significantly induced a higher proportion of ROS production, indicating a dramatic increase in ER stress.

[0202] 10. Use the endoplasmic reticulum green fluorescent probe to detect the average fluorescence intensity of the endoplasmic reticulum under the above four treatment methods, such as Figure 7 As shown in K. The results showed that compared with the Tuni single treatment group (10 μM, 24 h), the combined treatment group (Both) significantly induced a higher ER fluorescence intensity, indicating a dramatic increase in ER stress.

[0203] 11. An in vitro cloning experiment was used to detect the number of monoclonal clones under four treatment methods. Low-concentration Tuni (1 μM) alone, THA (1 μM) alone, or 10 μM Ful were pretreated for 24 h before the above drugs were added. The treatment lasted for 1 week, and the cells were fixed with formaldehyde for 15 min and stained with crystal violet for 20 min. After sufficient rinsing with PBS, the distribution of monoclonal counts was observed and counted.

[0204] Test results see Figure 7 The results showed that compared with the Tuni or THA treatment groups alone, the combined treatment group could significantly reduce the formation of monoclonal colonies and inhibit cell proliferation for a long time.

[0205] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of a substance that inhibits the activity and / or expression of GALNT7 protein in the preparation of a product for increasing the sensitivity of breast cancer cells to breast cancer chemotherapy drugs; The breast cancer chemotherapy drug is cisplatin; The substance that inhibits the activity and / or expression of GALNT7 protein is GALNT7 siRNA or GALNT7 sgRNA; The nucleotide sequence of GALNT7 siRNA is shown in SEQ ID NO:4 or SEQ ID NO:5; The nucleotide sequence of GALNT7 sgRNA is shown in SEQ ID NO: 1 or SEQ ID NO: 2; The subtype of breast cancer is ER+ breast cancer subtype.

Images