Bifidobacterium triple absolute quantitative fluorescence PCR nucleic acid detection kit based on comparative genomics

Abstract

The present invention discloses a primer-probe combination and a detection kit thereof that can simultaneously detect Bifidobacterium longum subspecies long, Bifidobacterium longum subspecies infantis and Bifidobacterium breve. The present invention also discloses a triple absolute quantitative fluorescence PCR detection method of Bifidobacterium longum subspecies long, Bifidobacterium longum subspecies infantis and Bifidobacterium breve based on comparative genome. The primer-probe combination and the detection kit thereof of the present invention have good specificity and sensitivity, and the specificity can detect species and subspecies of Bifidobacterium, and the sensitivity reaches 5 copies / μl, which can be used for the detection of complex microecological community samples. The present invention realizes the detection of three target genes in a single well, greatly reduces the detection cost, and improves the detection efficiency. The primer-probe combination and the detection kit thereof of the present invention can not only achieve qualitative detection, but also realize triple absolute quantitative detection of Bifidobacterium longum subspecies long, Bifidobacterium longum subspecies infantis and Bifidobacterium breve at the species level.

Description

Technical Field

[0001] The invention belongs to the field of microbial detection, and in particular relates to a bifidobacterium triple absolute quantitative fluorescent PCR nucleic acid detection kit based on comparative genome. Background Art

[0002] Bifidobacterium is a genus of Gram-positive, non-motile, rod-shaped, sometimes bifurcated, strictly anaerobic bacteria. It is an important beneficial microorganism in the human intestine. Bifidobacterium can metabolize to produce short-chain fatty acids and lactic acid, which helps to lower the pH in the human intestine and maintain a slightly acidic intestinal environment, thereby inhibiting intestinal pathogens and promoting the colonization and growth of a variety of microorganisms related to human health. At the same time, Bifidobacterium has anti-inflammatory properties, which can promote the immune development of infants and young children, maintain the immune homeostasis of the human body, and enhance the intestinal barrier function of the human body.

[0003] In the first 6 months of infancy, the abundance of Bifidobacterium increases significantly with the enrichment of the diversity of the infant's intestinal flora, and it occupies a dominant position in the intestine. In the intestinal flora of infants, the abundance of Bifidobacterium longum subsp. infantis (B. longum subsp. infantis) and Bifidobacterium breve (B. breve) are detected at a higher abundance. With age, the structure of the intestinal flora gradually changes, but whether it is teenagers, adults, or the elderly and centenarians, Bifidobacterium longum (B. longum) has an abundance advantage in the Bifidobacterium genus. In the intestines of adults, the abundance of Bifidobacterium accounts for about 3-10% of the intestinal flora, and the long subsp. longum of Bifidobacterium longum (B. longum subsp. longum) can be found widely. Although the number of Bifidobacteria in the elderly is much lower than that in adults, Bifidobacterium longum subsp. longum is still the main species of Bifidobacterium.

[0004] Bifidobacterium longum has physiological functions such as preventing and treating constipation, inhibiting intestinal pathogens, regulating intestinal balance, lowering cholesterol, promoting digestion and absorption of nutrients, delaying aging and enhancing the body's immune activity.

[0005] Bifidobacterium breve can play an important role in the body's mucosal defense, helping to prevent infectious diseases, prevent necrotizing enterocolitis (NEC), promote the development of premature infants, and help improve allergic diseases such as rhinitis and asthma.

[0006] Previously, the detection of bifidobacteria mainly relied on traditional physiological and biochemical methods, but different species and subspecies are very similar in physiological and biochemical characteristics and genetic evolution, and cannot be distinguished. At present, the common polymerase chain reaction (PCR) method is widely used for qualitative detection, especially based on the traditional 16SrRNA gene, but the 16S rRNA gene is a common detection gene in bacterial species identification, and lacks sufficient resolution at the species and subspecies level below the bacterial genus level. On the other hand, although there are also studies abroad using new housekeeping genes (such as tuf genes, etc.) to replace the 16S rRNA gene to distinguish bifidobacteria, it is still impossible to distinguish subspecies with higher similarity. In recent years, my country's probiotics market has shown a continuous growth trend, and Bifidobacterium longum (B.longum) and Bifidobacterium breve (B.breve) as "star" species, occupy a large proportion of the probiotics market. In recent years, the life and health industry has received unprecedented attention, and the intestinal microecology has become a hot spot of concern in the life and health industry. Bifidobacterium, as one of the most representative of known probiotics, has also received widespread attention. Therefore, it is necessary to establish a universal method for the quantitative detection of Bifidobacterium longum subsp. infantis, Bifidobacterium longum subsp. longum, and Bifidobacterium breve that has better specificity, can be rapidly detected, and can be applied to various sample sources.

[0007] Comparative genomics is a discipline that compares known genes and genome structures based on species genome maps and whole genome sequencing results to explore gene functions, mechanisms of action, and species evolution. By comparing the genome sequences of species with different kinship, coding sequences, non-coding regulatory sequences, and sequences unique to a given species can be identified. Sequence alignment within the genome can help us understand the similarities and differences between different species in nucleotide composition, synteny, and gene order, and then obtain information on gene analysis prediction and positioning, biological evolutionary relationships, and other aspects. By comparing the genomes of different bifidobacteria, we can screen out core genes unique to each bifidobacterium species and subspecies, and then use these genes to detect bifidobacteria.

[0008] Real-time quantitative PCR (qPCR) is a technology first introduced by Applied Biosystems in the United States in 1996. This technology not only realizes the leap from qualitative to quantitative PCR, but also has the characteristics of stronger specificity, effective solution to PCR contamination problems, high degree of automation, etc. compared with conventional PCR, it realizes real-time monitoring of PCR results and promotes the development of molecular diagnostic technology. Compared with ordinary PCR, fluorescent quantitative PCR has higher requirements for primer specificity and sensitivity. Generally, there are two determination methods: relative quantification and absolute quantification. Relative quantification is used to determine the difference in the amount of target genes in two or more different samples. The data obtained is the relative proportion of the content of the target gene in each sample. That is, the Ct value of the target gene in the experimental sample is compared with the Ct value of the control sample. The comparison result is expressed as the ratio or difference multiple of the amount of the target gene in the experimental sample to the amount of the target gene in the control sample. This method is the most common in the quantitative detection of mRNA levels. It studies the influence of physiological changes on gene expression levels. The method is simple and reliable, but it can only obtain the difference multiple of gene expression between different samples, and the true value of expression in each sample cannot be known. Absolute quantitative qPCR can accurately calculate the initial concentration of the target gene in the sample, such as the number of virus particles (DNA or RNA) in blood samples, the number of gene copies in cells, the content of specific genes or strains in microecological community samples, etc. The key to this method is to test a series of pre-prepared standard products with known target gene concentrations, so as to obtain the detection fluorescence values ​​corresponding to each concentration gradient, and thus fit the standard curve to accurately quantify the concentration of the target gene in the sample to be tested, so there are higher requirements for the design of primers and the preparation of standards.

[0009] The mainstream fluorescent quantitative PCR methods at present are SYBR Green I method and Tag Man probe method. SYBR Green I is a dye with green excitation wavelength, which can bind to all dsDNA double helix minor groove regions. Because the fluorescence emitted by SYBR Green I in the free state is weak, but when it binds to double-stranded DNA, the fluorescence will be greatly enhanced, and the increase of fluorescence signal is completely synchronized with the increase of PCR product. The advantage of this method is that it can monitor the amplification of any dsDNA sequence, the detection method is relatively simple, and the cost is low. However, it is precisely because the fluorescent dye can bind to any dsDNA, such as non-specific amplification products and primer dimers, which can also bind to the dye to produce fluorescent signals, so that the experiment produces false positive results, so its specificity is not as good as the probe method. TaqMan probe method is a highly specific quantitative PCR technology. Its working principle is that there is a pair of PCR primers and a probe in the PCR reaction system, the 5' end of the probe is labeled with a reporter group, and the 3' end is labeled with a fluorescent quencher group. The probe only specifically binds to the template, and its binding site is between the two primers. When the probe is intact, the fluorescent energy of the reporter group is absorbed by the quencher group, so the instrument cannot collect any signal. As the reaction progresses, the Taq enzyme encounters the probe and uses the activity of the 3′→5′ exonuclease to cut the probe, causing the fluorescent energy of the reporter group to not be absorbed by the quencher group, thus generating a fluorescent signal. Therefore, the intensity of the signal represents the number of copies of the template DNA.

[0010] Multiple fluorescence quantitative PCR (Multiple fluorescence quantitative PCR) technology is based on fluorescence quantitative PCR technology, using a combination of several different fluorescent groups, combined with the instrument's ability to detect fluorescence in different channels to achieve real-time quantitative detection of multiple targets. By labeling different fluorescent groups and corresponding quenching groups at the ends of different sequences, different TaqMan hydrolysis probes can be formed. By adding the above probes and corresponding amplification primers to the same reaction system, multiple targets can be detected together. Compared with conventional fluorescence quantitative PCR, which detects multiple targets simultaneously in a single reaction tube, multiple fluorescence quantitative PCR reduces the use of related reagents and consumables, and also greatly saves detection time.

[0011] Although multiplex PCR technology has shown great application potential in many fields such as clinical diagnosis, environmental monitoring, food safety, and gene expression analysis, the existing technology still has some significant limitations. Among them, the mutual interference between primers and the signal overlap of fluorescent markers are the main factors leading to reduced accuracy and repeatability. In addition, in order to ensure the specificity and sensitivity of the reaction, the control of the reaction conditions needs to be extremely precise, which increases the complexity of the experiment and the difficulty of operation. Summary of the invention

[0012] Purpose of the invention: The technical problem to be solved by the present invention is to provide a highly specific and sensitive primer-probe combination that can simultaneously detect Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve.

[0013] The technical problem that the present invention needs to solve is to provide a fluorescent quantitative PCR detection kit.

[0014] The final technical problem to be solved by the present invention is to provide a triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subspecies longum, Bifidobacterium longum subspecies infantis and Bifidobacterium breve based on comparative genome.

[0015] Technical solution: In order to solve the above technical problems, the present invention provides a primer-probe combination that can simultaneously detect Bifidobacterium longum subspecies long, Bifidobacterium longum subspecies infantis and Bifidobacterium breve, the primer pair probe combination comprising a forward primer lon / pF as shown in SEQ ID NO.1, a reverse primer lon / pR as shown in SEQ ID NO.2, a probe lon-P as shown in SEQ ID NO.3, a forward primer inf / pF as shown in SEQ ID NO.4, a reverse primer inf / pR as shown in SEQ ID NO.5, a probe inf-P as shown in SEQ ID NO.6, a forward primer bre / pF as shown in SEQ ID NO.7, a reverse primer bre / pR as shown in SEQ ID NO.8, and a probe bre-P as shown in SEQ ID NO.9.

[0016] The invention provides a fluorescent quantitative PCR detection kit, which comprises the primer-probe combination.

[0017] Wherein, the detection kit also includes a PCR positive standard quality control plasmid, and the sequence of the plasmid is shown as SEQ ID NO.10.

[0018] Wherein, the detection kit also includes BioSmart U+Super Multiple Probe qPCR PreMix and ddH2O.

[0019] The present invention also includes the use of the primer-probe combination and the detection kit in the simultaneous detection of Bifidobacterium longum subspecies longum, Bifidobacterium longum subspecies infantis and Bifidobacterium breve.

[0020] The present invention includes a triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subspecies longum, Bifidobacterium longum subspecies infantis and Bifidobacterium breve based on comparative genome, comprising the following steps:

[0021] 1) extracting total DNA from the sample to be tested as a template, and constructing a triple qPCR reaction system with the primer-probe combination or the detection kit;

[0022] 2) establishing a standard curve according to the detection Ct value of the positive plasmid and the standard concentration of the positive plasmid; the sequence of the positive plasmid is shown in SEQ ID NO.10;

[0023] 3) The triple qPCR reaction system is subjected to a fluorescent quantitative PCR reaction. When there is a fluorescent signal in the fluorescent channel VIC in the sample well, the sample to be tested contains Bifidobacterium longum subsp. longum; when there is a fluorescent signal in the fluorescent channel FAM in the sample well, the sample to be tested contains Bifidobacterium longum subsp. infantis; when there is a fluorescent signal in the fluorescent channel CY5 in the sample well, the sample to be tested contains Bifidobacterium breve, and the concentration of the corresponding strain in the sample to be tested is calculated by substituting the Ct value of the sample to be tested into the standard curve.

[0024] The samples in step 1) include but are not limited to samples from environmental sources such as feces, breast milk, various foods and sewage, that is, microbial community samples containing Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve are all applicable.

[0025] Wherein, the multiplex qPCR reaction system in step 1) is as follows:

[0026]

[0027]

[0028] The qPCR experimental procedure is as follows: 95°C, 30; 95°C, 10s, 60°C, 30s; 40 cycles.

[0029] The instrument used is QuantStudio TM 5 Real-Time PCR Instrument (Thermo Fisher Scientific), VIC was selected as the fluorescence channel for detecting Bifidobacterium longum subsp. longum; FAM was selected as the fluorescence channel for detecting Bifidobacterium longum subsp. infantis; CY5 was selected as the fluorescence channel for detecting Bifidobacterium breve.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0031] 1. The present invention establishes a genome-specific sequence screening method for specific bacterial species through pan-genome and core genome analysis, and applies it to the design of specific primer pairs and probes for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve.

[0032] 2. The primer-probe combination and the detection kit thereof of the present invention have good specificity and sensitivity. The specificity can detect Bifidobacterium species and subspecies, and the sensitivity reaches 5 copies / μl, and can be used for the detection of complex microecological community samples.

[0033] 3. The primer-probe combination and detection kit thereof of the present invention realize the detection of three target genes in a single well, which greatly reduces the detection cost and improves the detection efficiency.

[0034] 4. The primer-probe combination and the detection kit of the present invention can not only achieve qualitative detection, but also realize triple absolute quantitative detection of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve at the species level. In addition, any quantitative detection can also be performed separately as needed. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a pan-genome and core genome analysis diagram of 266 bacterial genomes (blue is the pan-genome, orange is the core genome;

[0036] Figure 2 This is the result of single-plex PCR primer screening;

[0037] Figure 3 This is the result of multiplex PCR primer screening;

[0038] Figure 4 The BLAST comparison and verification results of three pairs of primers are shown;

[0039] Figure 5 Specific validation of Bifidobacterium longum subspecies longum;

[0040] Figure 6 Specific validation of Bifidobacterium longum infantis subspecies;

[0041] Figure 7 Bifidobacterium breve specificity validation;

[0042] Figure 8 Sensitivity test results of Bifidobacterium longum subsp. longum;

[0043] Fig. 9 Sensitivity test results of Bifidobacterium longum subsp. infantis;

[0044] Fig.10 Bifidobacterium breve sensitivity test results;

[0045] Fig.11 Amplification curve of single-plex absolute quantitative PCR of Bifidobacterium longum subsp. longum;

[0046] Fig.12 Standard curve corresponding to single-plex absolute quantitative PCR of Bifidobacterium longum subsp. longum;

[0047] Fig.13 Amplification curve of single-plex absolute quantitative PCR of Bifidobacterium longum subsp. infantis;

[0048] Fig.14 Standard curve corresponding to single-plex absolute quantitative PCR of Bifidobacterium longum subsp. infantis;

[0049] Fig.15 Amplification curve of single-plex absolute quantitative PCR of Bifidobacterium breve;

[0050] Fig.16 Standard curve of single-plex absolute quantitative PCR of Bifidobacterium breve;

[0051] Fig.17 Amplification curves of multiple absolute quantitative PCR standards of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve;

[0052] Fig.18 Standard curve of multiple absolute quantitative PCR standards of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve;

[0053] Fig.19 Standard curve of Bifidobacterium longum subsp. longum in multiplex absolute quantitative PCR;

[0054] Fig. 20 Standard curve of Bifidobacterium longum subsp. infantis in multiplex absolute quantitative PCR;

[0055] Fig.21 Standard curve of Bifidobacterium breve in multiplex absolute quantitative PCR;

[0056] Fig. 22 Amplification curves of absolute quantitative PCR and multiplex absolute quantitative PCR samples. DETAILED DESCRIPTION

[0057] Example 1 Design of specific primers for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve based on comparative genomics analysis

[0058] 1. Download bacterial genome data from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), including Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium breve, other Bifidobacteria, representative bacteria other than Bifidobacterium, etc. Use bioinformatics analysis tools such as GTDB-tk, GNUC, CheckM, and Prokka to perform quality control and annotation classification on the genome.

[0059] 2. The pan-genome and core genome analysis of the microbial genome data used was performed using Roary software to determine the pan-genome of the above-mentioned microorganisms and the core genomes of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, and to screen out specific genes unique to the core genomes of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, which should not exist in the genomes of other bacteria.

[0060] 266 genomes were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) after screening. Figure 1 , of which there are 252 bifidobacterium genomes, 24 genomes of Bifidobacterium longum subsp. longum, 27 genomes of Bifidobacterium longum subsp. infantis, and 49 genomes of Bifidobacterium breve. Through core genome and pan-genome analysis, 7 gene clusters unique to Bifidobacterium longum subsp. longum, 16 gene clusters unique to Bifidobacterium longum subsp. infantis, and 67 gene clusters unique to Bifidobacterium breve were obtained, and the similarity (>99%) and completeness (>99%) of each gene cluster in the genome used by each bifidobacterium were calculated one by one. Finally, 1 candidate gene cluster was obtained for each of the three bifidobacteria, totaling 3.

[0061] Bifidobacterium longum subsp. longum unique gene cluster group_8426hypothetical protein:

[0062] NCBI GenBank accession number: GCA_000196555.1 (2219546-2215710)

[0063] The unique gene cluster bceA_1 of Bifidobacterium longum subsp. infantis:

[0064] NCBI GenBank accession number: GCA_900637215.1 (504790-505437)

[0065] Bifidobacterium breve group_13489hypothetical protein:

[0066] NCBI genbank accession number: GCA_001025175.1 (258622-260475) 3. Primers and probes were designed for the three gene clusters screened above through NCBI.

[0067] Primers were designed for the three gene clusters screened above through NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome), and three pairs of primers were designed for each gene cluster. The primer information is as follows.

[0068] Table 1: Primers designed for the three gene clusters screened above

[0069]

[0070]

[0071] The amplified fragments are as follows:

[0072] Lon-1 detection sequence 157bp:

[0073] 5'-ACCAAGTTCCAGCCCACAGCCGATCCGGGCAAGAACGCTAGCGATTACTTCCAGCCATATTGGTATGCCAAGAACGCCAATGATAATGGCGGCACACACATCCAAGCGCACGGTGGCCAAGTGGTCAAGGTTGGCGACGCCTACTACTGGTATGGCG-3'

[0074] Lon-2 detection sequence 224bp:

[0075] 5'-GGCAGGTGTGGATTACCTGCCTACCATCGGCCAAGTGCCGACATACACCAAGTTCCAGCCCACAGCCGATCCGGGCAAGAACGCTAGCGATTACTTCCAGCCATATTGGTATGCCAAGAACGCCAATGATAATGGCGGCACACACATCCAAGCGCACGGTGGCCAAGTGGTCAAGGTTGGCGACGCCTACTACTGGTATGGCGAAGACCGTTCTAACGGTTACG-3'

[0076] Lon-3 detection sequence 222bp:

[0077] 5’-TCGGCCAAGTGCCGACATACACCAAGTTCCAGCCCACAGCCGATCCGGGCAAGAACGCTAGCGATTACTTCCAGCCATATTGGTATGCCAAGAACGCCAATGATAATGGCGGCACACACATCCAAGCGCACGGTGGCCAAGTGGTCAAGGTTGGCGACGCCTACTACTGGTATGGCGAAGACCGTTCTAACGGTTACGACAACAGCCCCGGTGTTCATGCTT-3’

[0078] Inf-1 detection sequence 149bp:

[0079] 5’-CGGTCTTCTACAGGAAGCGGATGGTGGACGACTTATGATCGATCGCGAAAATGTCACGCACGCGACAGCCAGAAGACGTAGACGATTCTGGCATGACACGGCCTCGTTCATCCTTCAGGACTACGGCATTATGGACGAGGAAAGCGTGG-3’

[0080] Inf-2 detection sequence 223bp:

[0081] 5’-GCGGAAAGACCACGCTGTTGCACACACTCGGTCTTCTACAGGAAGCGGATGGTGGACGACTTATGATCGATCGCGAAAATGTCACGCACGCGACAGCCAGAAGACGTAGACGATTCTGGCATGACACGGCCTCGTTCATCCTTCAGGACTACGGCATTATGGACGAGGAAAGCGTGGCTTTCAATGTCTCCATGCAGCTTGGACCATTTGGACAACGTGCGGG-3’

[0082] Inf-3 detection sequence 219bp:

[0083] 5’-TCACTGGCCCCAGCGGATGCGGAAAGACCACGCTGTTGCACACACTCG GTCTTCTACAGGAAGCGGATGGTGGACGACTTATGATCGATCGCGAAAATGTCACGCACGCGACAGCCAGAAGACGTAGACGATTCTGGCATGACACGGCCTCGTTCATCCTTCAGGACTACGGCATTATGGACGAGGAAAGCGTGGCTTTCAATGTCTCCATGCAGCTTG-3’

[0084] Bre-1 detection sequence 179bp:

[0085] 5’-AATCTGAGTGAGCGGTTGCCGCAACGTCATCACGGCAAGGTCAAGATAC TTAAAGGTTCCGTATACACACGGCGTCGCATTGTGGTGGGCTGCTTGGGCG TGCTGCTGTTGGTCGAATTGTTCCAGCTGCTCTGGCCGTCCGACAAATTCTT CCCGCTCGCCACACTTGACGGTCATGC-3’

[0086] Bre-2 detection sequence 247bp:

[0087] 5’-CCCTGCTGCGCTTCTTCCAGAATCTGAGTGAGCGGTTGCCGCAACGTCA TCACGGCAAGGTCAAGATACTTAAAGGTTCCGTATACACACGGCGTCGCATTGTGGTGGGCTGCTTGGGCGTGCTGCTGTTGGTCGAATTGTTCCAGCTGCTCTGGCCGTCCGACAAATTCTTCCCGCTCGCCACACTTGACGGTCATGCCGTGGGTGGGCAGAGTTCGCAGCAGGCTGCTGAGACGCTTAACGCCGC-3’

[0088] Bre-3 detection sequence 248bp:

[0089] 5'-GCCAGCTGCGCCTTGATTGGCAGGCCCTGCTGCGCTTCTTCCAGAATCT GAGTGAGCGGTTGCCGCAACGTCATCACGGCAAGGTCAAGATACTTAAAGGTTCCGTATACACACGGCGTCGCATTGTGGTGGGCTGCTTGGGCGTGCTGCTGTTGGTCGAATTGTTCCAGCTGCTCTGGCCGTCCGACAAATTCTTCCCGTCCGCCACACTTGACGGTCATGCCGTGGGTGGGCAGAGTTCGCAGCAG-3'

[0090] 4. Primer screening and verification

[0091] 4.1) Primer screening: In multiplex PCR, the mutual interference between primers can easily affect the test results. Therefore, in the early stage of primer design, it is necessary to minimize the non-specific binding of primers. In order to screen out primers with good specificity from the above primers, PCR tests are performed on these primers to observe the generation of primers (i.e. non-specific binding).

[0092] (4.1.1) Single-plex PCR primer screening: For the above 9 primer pairs, single-plex PCR primer tests were performed to observe the generation of primer dimers. The DNA templates of the PCRs of the primer pairs Lon-1, lon-2, and lon-3 were extracted from the long subspecies of Bifidobacterium longum (strain dipro-X from the Di Fu Le Microbiological Immunometabolism Laboratory, with a collection number of CGMCC No. 29384). The DNA templates of the PCRs of the primer pairs Inf-1, inf-2, and inf-3 were extracted from the long subspecies of Bifidobacterium infantis (strain dipro-F from the Di Fu Le Microbiological Immunometabolism Laboratory, with a collection number of CGMCC No. 29343). The DNA templates of the PCRs of the primer pairs Bre-1, bre-2, and bre-3 were extracted from the breve subspecies of Bifidobacterium (public strain number: Bifidobacterium breve JCM 1192). The amplification system and procedure are as follows:

[0093] PCR amplification system:

[0094] Reactant Name Dosage 2×Taq PCR Mix 12.5μl Forward primer (10 μM) 1μl Reverse primer (10 μM) 1μl DNA template 1μl <![CDATA[ddH2O]]> Make up to 25.0 μl

[0095] PCR amplification procedure:

[0096]

[0097] like Figure 2As shown, among the three pairs of primers for detecting Bifidobacterium longum subsp. longum, the Lon-1 primer pair had no obvious primer dimers and had a better effect; the three pairs of primers for detecting Bifidobacterium breve all had certain primer dimers; among the three pairs of primers for detecting Bifidobacterium longum subsp. infantis, the Inf-1 primer pair had no obvious primer dimers.

[0098] (4.1.2) Multiplex PCR combination screening primers: Multiplex PCR was performed on the primer combinations with less primer dimer production in the above screening results, wherein the primer pair Lon-1 for detecting Bifidobacterium longum subsp. longum and the primer pair Inf-1 for detecting Bifidobacterium longum subsp. longum were combined with the three primer pairs of Bifidobacterium breve to observe the production of primer dimers. Combination 1: Lon-1+Inf-1+Bre-1; Combination 2: Lon-1+Inf-1+bre-2; Combination 3: Lon-1+Inf-1+bre-3; The DNA templates for PCR were extracted from three strains of Bifidobacterium longum subspecies longum (strain dipro-X from Difule Microbial Immunometabolism Laboratory, deposit number: CGMCC No.29384), Bifidobacterium longum subspecies infantis (strain dipro-F from Difule Microbial Immunometabolism Laboratory, deposit number: CGMCC No.29343), and Bifidobacterium breve (public strain: Bifidobacterium breve JCM 1192) (Bifidobacterium longum subspecies longum DNA template (49.3ng / μl), Bifidobacterium longum subspecies infantis DNA template (23.9ng / μl), and Bifidobacterium breve DNA template (28.3ng / μl)), each 1μl. The amplification system and procedure are as follows:

[0099] PCR amplification system:

[0100] Reactant Name Dosage 2×Taq PCR Mix 12.5μl lon / pF(10μM) 1μl lon / pR(10μM) 1μl inf / pF(10μM) 1μl inf / pR(10μM) 1μl Bifidobacterium breve forward primer (10 μM) 1μl Bifidobacterium breve reverse primer (10 μM) 1μl Bifidobacterium longum subsp. longum DNA template 1μl Bifidobacterium longum subsp. infantis DNA template 1μl Bifidobacterium breve DNA template 1μl <![CDATA[ddH2O]]> Make up to 25.0 μl

[0101] PCR amplification procedure:

[0102]

[0103] like Figure 3 As shown in the figure, among the three primer combinations, primer dimers in combination 1 are the least. In summary, primer combination 1 has the best effect.

[0104] The three pairs of primers Lon-1, Inf-1, and Bre-1 of the above-screened primer combination 1 were used to design probes using Primer3 (https: / / primer3.org / ). The sequences of the primer probe combination are shown in Table 2.

[0105] Table 2: Corresponding probes of the three pairs of primers screened

[0106]

[0107]

[0108] 4.2) BLAST comparison to verify primer specificity: In order to verify the specificity of the self-designed primers of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, the self-designed primers were subjected to primer BLAST on NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi). If the BLAST matching results are all genes from Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, it proves that the self-designed primers have good specificity in theory. Figure 2-Figure 4 The BLAST comparison verified the results. The BLAST matching results of the three pairs of primers were Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, respectively, indicating that the three pairs of primers theoretically have good specificity for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, respectively.

[0109] 4.3) qPCR verification of the specificity of primers and probes for positive / negative samples: In order to verify the specificity of the self-designed primers and probes for Bifidobacterium longum subspecies long, Bifidobacterium longum infantis subspecies, and Bifidobacterium breve, according to the instructions of the bacterial genomic DNA extraction kit (Takara, China), the self-designed primers and probes were directed to Bifidobacterium longum subspecies long (Di Fu Le Microbial Immunometabolism Laboratory strain dipro-X, preservation number: CGMCC No. 29384), Bifidobacterium longum infantis subspecies (Di Fu Le Microbial Immunometabolism Laboratory strain dipro-F, preservation number: CGMCC No. 29343), Bifidobacterium breve (public strain: Bifidobacterium breve JCM 1192) and other bifidobacterium species (Bifidobacterium animalis subspecies animalis (public strain: Bifidobacterium animalis subsp. animalis JCM 1190), Bifidobacterium animalis subsp. lactis (public strain: Bifidobacterium animalis subsp. BB12), Bifidobacterium adolescentis (public strain: Bifidobacterium breve JCM 1192), Bifidobacterium pseudocatenulatum (public strain: Bifidobacterium eriumpseudocatenulatum JCM 1200), and Bifidobacterium bifidum (public strain: Bifidobacterium bifidum JCM1255)) were used to extract genomic DNA for qPCR testing (Bifidobacterium longum subsp. longum DNA template (49.3 ng / μl), Bifidobacterium longum subsp. infantis DNA template (23.9 ng / μl), Bifidobacterium breve DNA template (28.3 ng / μl), Bifidobacterium animalis subsp. animalis DNA template (35.3 ng / μl), Bifidobacterium animalis subsp. lactis DNA template (38.4 ng / μl), Bifidobacterium adolescentis DNA template (29.6 ng / μl), Bifidobacterium pseudocatenulatum DNA template (30.4 ng / μl), and Bifidobacterium bifidum DNA template (28.7 ng / μl)). If there is an amplification curve only in the fluorescence channel corresponding to Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, and there is no amplification curve in the detection wells using other bifidobacterium species as amplification templates and the negative sample wells, it means that the self-designed primers and probes have good specificity for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve.

[0110] Experimental method: According to the configuration of the amplification system below, the templates are the extracted genomic DNA of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium breve, Bifidobacterium animalis subsp. animalis subsp. lactis, Bifidobacterium adolescentis, Bifidobacterium pseudocatenulatus, and Bifidobacterium bifidum, and the amplification is carried out under the amplification program shown below.

[0111] qPCR amplification system:

[0112] Reactant Name Dosage BioSmart U+Super Multiple Probe qPCR PreMix 4μl Primer lon / pF 0.4μl Primer lon / pR 0.4μl Probe lon-P 0.4μl Primer inf / pF 0.4μl Primer inf / pR 0.4μl Probe inf-P 0.4μl Primer bre / pF 0.4μl Primer bre / pR 0.4μl Probe bre-P 0.4μl DNA template 1μl <![CDATA[ddH2O]]> Make up to 20.0 μl

[0113] qPCR amplification procedure:

[0114]

[0115] As shown in Figures 5-7, Bifidobacterium longum subsp. longum ( Figure 5 ), Bifidobacterium longum subsp. infantis ( Figure 6 ), Bifidobacterium breve ( Figure 7 ) showed amplification in the corresponding fluorescence channels, while other negative samples showed no amplification trend. The three pairs of self-designed primers and probes had good specificity.

[0116] 4.4) qPCR detection of target fragments at different copy number levels, the amplification system and amplification procedure are the same as step 3) to verify the sensitivity of primers and probes: In order to verify the sensitivity of the self-designed primers and probes for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, the self-designed primers and probes were used for different concentrations of target genes (10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 qPCR test was performed at 10 copies / μl, 10 copies / μl, and 5 copies / μl to evaluate its sensitivity level.

[0117] from Figure 8-10 It can be seen that the long Bifidobacterium longum subsp. Figure 8 ), Bifidobacterium longum subsp. infantis ( Fig. 9 ), Bifidobacterium breve ( Fig.10 ) The primers and probes have good sensitivity, reaching 5 copies / μl.

[0118] 5. Construction of standard plasmid for qPCR

[0119] The standard plasmid is a plasmid with a target detection fragment for quantitative detection of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve, and is the basis for qPCR absolute quantitative detection. The preparation method of the plasmid is also disclosed in the present invention.

[0120] Preparation of Insert and Backbone: Use Snapgene software (https: / / www.snapgene.com / ) to design primers for generating Insert and Backbone fragments, see Table 2. When designing primers, pay attention to the need to design sticky ends on the primers to facilitate the smooth progress of subsequent Insert-Backbone recombination. 1) Delete the ccdB gene in the plasmid pEcgRNA (to avoid affecting the growth of subsequent competent cells) to generate a linearized Backbone; list the Insert (the target sequence fragment to be inserted). 2) Use the Gibson Assembly method in the Snapgene software to insert the Insert into the end of the Backbone fragment to form a new circular plasmid, and set the primer parameters (Tm value, Overlap length). 3) Generate primers for amplification and recombination of the Insert and Backbone fragments, and check whether the primers are qualified. 4) Synthesize primers, and use the primers to amplify the Insert and Backbone fragments with sticky ends, and perform agarose gel electrophoresis and DNA sequence recovery and purification.

[0121] Insert-Backbone sequence recombination: DNA recombinase of ClonExpress Ultra One Step Cloning Kit (Novozymes, China) was used to perform DNA sequence recombination on Insert and plasmid Backbone sequences. The recombination operation was performed according to the instructions of the recombinase. After obtaining the recombinant product, it was stored at 4°C for subsequent transformation of competent cells.

[0122] Plasmid transformation competent cells and verification: 1) Take out the E. coli competent cells DH5α (Novozyme, China) at -80℃ and thaw on ice. Take 10μl of the above-mentioned recombinant plasmid, add it to 100μl competent cells, flick the tube wall to mix, and let it stand for 30min. 2) After heat shock in a 42℃ water bath for 45s, place it on ice for 2-3min. 3) Add 900μl LB culture medium, place it in a shaker, and culture it at 37℃ for 1h. 4) Take out the culture solution, centrifuge it at 5000r / min for 3-5min, discard 900μl of supernatant and resuspend the bacteria, and use a sterile stick to spread it on the prepared LB solid culture medium with spectinomycin. 5) Place the culture dish in a 37℃ constant temperature incubator for culture. 6) After 12-16 hours of culture, remove the culture dish, randomly pick more than 8 single colonies, and perform colony PCR to verify the recombination and transformation results. If a band of the corresponding size can be observed by agarose gel electrophoresis, it proves that the plasmid sequence has been successfully recombined and transformed into competent cells. No band indicates that the plasmid recombination or transformation of competent cells has failed. In addition, the single colony can be liquid-cultured, and the plasmid DNA can be extracted and sequenced to verify the recombination and transformation results.

[0123] Plasmid DNA extraction and concentration measurement: The single colonies verified as positive, i.e., the single colonies with successful recombination and transformation, were cultured in LB liquid medium with spectinomycin for 12-16 hours, and the plasmid was extracted from the culture medium using a plasmid DNA mini-extraction kit (Novozyme, China). The DNA concentration of the extracted plasmid DNA was measured using a nucleic acid quantifier, and the concentration was 50.6 ng / μl.

[0124] Standard concentration plasmid preparation: Use the following formula to convert plasmid DNA concentration to plasmid copy number:

[0125] N=6.02*10 23 *(OD 260 ) / MW

[0126] MW(dsDNA)=number of bases*660

[0127] Where N represents the number of copies / μl, MW represents the average molecular weight (Dalton, i.e., g / mol), OD 260 Represents the absorbance at wavelength 260 (ng / μl). After conversion to copy number, the plasmid was gradiently diluted to 10 8 copies / μl, 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 The concentration of copies / μl is used as a standard for qPCR absolute quantitative detection. The sequence of the plasmid pEcgRNA-lon / inf / bre constructed in the present invention is as follows: SEQ ID NO.10:

[0128]

[0129] Table 3: Primer information for plasmid construction

[0130]

[0131]

[0132] Among them, Insert primers are primers containing complementary homologous fragments on the plasmid for extracting and detecting inserted fragments. The purpose is to simultaneously match the sequences of the plasmid and the inserted fragment so as to connect the target fragment to the target position on the plasmid through PCR amplification.

[0133] Example 2 qPCR absolute quantitative test of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve in real samples

[0134] 1. According to the instructions of the Fecal Microbiome Total DNA Extraction Kit (TIANGEN, China), the total DNA of the microecological communities in the fecal samples of the populations in Table 4 was extracted, and the DNA concentration was measured and stored in a -20°C refrigerator for future use.

[0135] Table 4: Sample source information

[0136] serial number gender Age (month) area Extracted DNA concentration (ng / μl) JD-64 male 4.3 Shanghai 45.3 JD-69 male 9.2 Shanghai 62.3 JD-70 male 3.4 Shanghai 55.4 JD-77 female 4.7 Shanghai 65.2 JD-83 female 6.7 Shanghai 52 JD-84 female 16.0 Shanghai 85.4 JD-86 female 16.0 Shanghai 33 JD-87 female 6.4 Shanghai 45.2 JD-68 male 9.5 Shanghai 56.8 JD-73 male 2.6 Shanghai 46.3 JD-58 female 12.6 Shanghai 29.2 JD-63 female 18.6 Shanghai 53.5 JD-67 male 2.7 Shanghai 64.5 YH-173 female 12.4 Shanghai 36.4 YH-175 female 9.9 Shanghai 34.6

[0137] 2. Single-plex qPCR absolute quantitative test: The self-designed primer pairs Lon-1, Inf-1, and Bre-1 were used to generate the plasmids with different copy number concentration gradients (10 8 copies / μl, 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl) as the standard, and the instrument used was QuantStudio TM 5Real-Time PCRInstrument (Thermo Fisher Scientific), the probe method qPCR absolute quantitative detection experiment of three bifidobacteria was performed separately on the extracted fecal samples, and the amplification procedure was referred to the single-plex qPCR experimental system and experimental procedure. A standard curve was established according to the detection Ct value of the standard positive plasmid, and the validity of the standard curve was checked. According to the standard curve, the copy number of Bifidobacterium longum subspecies long, Bifidobacterium longum infantis subspecies, and Bifidobacterium breve represented by the target fragment in the total DNA sample of the fecal microbiome was further calculated (Table 8). At the same time, check whether the results of the qPCR amplification curve, standard curve, etc. are normal.

[0138] Table 5 Single-plex qPCR experimental system (20 μl)

[0139]

[0140] Table 6 qPCR experimental procedures:

[0141]

[0142] Figure 11-16 :Amplification curves and corresponding standard curves of single-plex absolute quantitative PCR of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve. The results showed that the plasmid standards at each copy number concentration had good amplification performance, and the established standard curves had good linearity, R 2 All reached 0.998 and above.

[0143] 3. Multiplex qPCR absolute quantitative test: The self-designed primers mentioned above were used, and the plasmids with different copy number concentration gradients prepared above were used as standards. The instrument used was QuantStudio TM 5Real-Time PCR Instrument (ThermoFisher Scientific), perform 3 multiple probe qPCR experiments on the extracted fecal samples for bifidobacteria, refer to the multiple qPCR experimental system and the above qPCR experimental procedures. Establish a standard curve based on the detection Ct value of the standard positive plasmid, and check the validity of the standard curve. According to the standard curve, further calculate the copy number of Bifidobacterium longum subspecies long, Bifidobacterium longum infantis subspecies, and Bifidobacterium breve represented by the target fragment in the total DNA sample of the fecal microbiome (Table 8). At the same time, check whether the results of the qPCR amplification curve, standard curve, etc. are normal.

[0144] Table 7 Multiplex qPCR experimental system (20 μl)

[0145]

[0146] Figure 17-21 :Amplification curves and corresponding standard curves of triple absolute quantitative PCR of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve. The results showed that even in the case of triple PCR, the plasmid standards at each copy number concentration still had good amplification performance, and the established standard curve had a good linear relationship, R 2 All reached 0.999 and above.

[0147] 4. Result processing: A standard curve was constructed based on the Ct value of the plasmid standard, and then the content of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve in the corresponding real sample was calculated according to the following calculation formula using the standard curve equation and the Ct value of the DNA sample test (Table 8). The data of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve under single absolute quantification and multiple absolute quantification were compared to see if they matched.

[0148] Calculation formula:

[0149] Bifidobacterium content in the sample to be tested = copy number concentration of target fragment qPCR quantitative conversion / (ratio of DNA detection amount to total DNA of sample microbiome * sample mass used to extract total DNA of microbiome)

[0150] The unit of the target fragment content in the sample is copy / g, the unit of the copy number concentration converted by qPCR quantification is copy / μl, and the unit of the sample mass is g.

[0151] Table 8: Comparison of the values ​​of 16 samples detected by single-plex absolute quantitative PCR and multiplex absolute quantitative PCR for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve

[0152]

[0153] Fig. 22 : Amplification curves of 16 samples for detection of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, and Bifidobacterium breve by singleplex absolute quantitative PCR and multiplex absolute quantitative PCR.

[0154] From the results in the above table, it can be seen that high concentrations of Bifidobacterium longum subsp. longum were detected in the four samples of JD-69, JD-84, JD-86 and JD-68. The concentration of Bifidobacterium longum subsp. longum in JD-83 was low and was detected in multiple PCR; different concentrations of Bifidobacterium longum subsp. longum were detected in the samples of JD-64, JD-69, JD-70, JD-83, JD-84, JD-86, JD-58, JD-67, YH-173 and YH-175; different concentrations of Bifidobacterium breve were detected in the samples of JD-69, JD-77, JD-83, JD-84, JD-86, JD-68, JD-63, YH-173 and YH-175. In addition, judging from the test results, there is no significant difference between the results detected by the multiplex absolute quantitative qPCR detection technology of the present invention and the results detected by the single-plex absolute quantitative qPCR detection technology, and the detection cost is greatly reduced and the detection efficiency is improved.

Claims

1. A primer-probe combination capable of simultaneously detecting Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve, characterized in that: The primer pair probe combination includes the forward primer lon / pF shown in SEQ ID NO.1, the reverse primer lon / pR shown in SEQ ID NO.2, the probe lon-P shown in SEQ ID NO.3, the forward primer inf / pF shown in SEQ ID NO.4, the reverse primer inf / pR shown in SEQ ID NO.5, the probe inf-P shown in SEQ ID NO.6, the forward primer bre / pF shown in SEQ ID NO.7, the reverse primer bre / pR shown in SEQ ID NO.8, and the probe bre-P shown in SEQ ID NO.

9.

2. A fluorescent quantitative PCR detection kit, characterized in that: The detection kit comprises the primer-probe combination according to claim 1.

3. The detection kit according to claim 2, characterized in that The detection kit also includes a positive standard quality control plasmid, and the sequence of the positive standard quality control plasmid is shown in SEQ ID NO.

10.

4. The detection kit according to claim 2, characterized in that The detection kit also includes BioSmart U+Super Multiple Probe qPCR PreMix and ddH2O.

5. Use of the primer-probe combination according to claim 1 and the detection kit according to any one of claims 2 to 4 in the simultaneous detection of Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve.

6. A triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve based on comparative genome, characterized in that: The following steps are involved: 1) extracting total DNA from the sample to be tested as a template, and constructing a triple qPCR reaction system using the primer-probe combination of claim 1 or the detection kit of any one of claims 2 to 4; 2) establishing a standard curve according to the detection Ct value of the positive standard quality control plasmid and the standard concentration of the positive standard quality control plasmid; the sequence of the positive standard quality control plasmid is shown in SEQ ID NO.10; 3) The triple qPCR reaction system is subjected to a fluorescent quantitative PCR reaction. When there is a fluorescent signal in the fluorescent channel VIC in the sample well, the sample to be tested contains Bifidobacterium longum subsp. longum; when there is a fluorescent signal in the fluorescent channel FAM in the sample well, the sample to be tested contains Bifidobacterium longum subsp. infantis; when there is a fluorescent signal in the fluorescent channel CY5 in the sample well, the sample to be tested contains Bifidobacterium breve, and the concentration of the corresponding strain in the sample to be tested is calculated by substituting the Ct value of the sample to be tested into the standard curve.

7. The triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve based on comparative genome according to claim 6, characterized in that: It is characterized in that The sample in step 1) is a sample from human feces, breast milk, various foods or sewage.

8. The triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve based on comparative genome according to claim 6, characterized in that: The triple qPCR reaction system in step 1) is as follows:

9. The triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve based on comparative genome according to claim 6, characterized in that: The standard concentration of the positive standard quality control plasmid in step 2) is 10 2 ~10 8 Copies / μl.

10. The triple absolute quantitative fluorescence PCR detection method for Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis and Bifidobacterium breve based on comparative genome according to claim 6, characterized in that: The experimental procedure of fluorescent quantitative PCR in step 3) is as follows: 94-96°C, 30s; 94-96°C, 10s, 58-62°C, 30s; 40 cycles.

Images