A molecular marker combination, primer set, method and application thereof for rapid identification of Songpu carp

Abstract

The present invention discloses a molecular marker combination, a primer set, a method and an application thereof for quickly identifying Songpu carp, and belongs to the field of aquatic product variety identification. The molecular marker combination screened by the present invention includes four SNP sites SNP1-SNP4 located on the carp genome, and the upstream and downstream sequences thereof are respectively shown as SEQ ID NO.1-4. Four pairs of PCR amplification primers with sequences shown as SEQ ID NO.5-12 are designed according to the above SNP sites. The present invention also establishes a method for identifying Songpu carp based on the above molecular marker combination and primer set. The molecular marker combination, primer set and method in the present invention can be used to quickly, accurately and batch-wise identify and screen Songpu carp seedlings and parents in the seedling stage and parent stage, which is particularly suitable for the variety identification of small-sized fry, and can effectively solve the problem that carp varieties with similar appearances are difficult to distinguish. The present invention has high market promotion and application value.

Description

Technical Field

[0001] The invention relates to the field of aquatic product variety identification, and in particular to a molecular marker combination, a primer set and a method and application thereof for rapidly identifying Songpu carp. Background Art

[0002] Carp (Cypriuscarpio), belonging to the Cypriniformes and Cyprinidae, is an important freshwater farmed fish in my country. Its annual output accounts for about 11.3% of my country's freshwater farmed fish. In addition, it has formed a number of distinctive and economically valuable varieties under long-term artificial cultivation, and has accumulated rich carp germplasm resources. Songpu carp is a carp variety with the advantages of fast growth rate, cold resistance, and hypoxia resistance obtained through hybridization and breeding with Heilongjiang carp, red carp, scattered-scale mirror carp and German mirror carp as parents. It is widely cultivated in northern and high-altitude cold areas. However, in the process of introduction and breeding of aquaculture, it is difficult to accurately distinguish the varieties of fry and broodstock of carp varieties with similar appearance by appearance, resulting in the phenomenon of gradual introgression and mixed germplasm of carp germplasm from different sources, which affects the conservation and breeding of Songpu carp, and also affects the interests of farmers and consumers. Therefore, it is urgent to develop a new method with short development cycle, low cost, simple operation, and batch operation for the rapid identification of Songpu carp and its similar varieties. Summary of the invention

[0003] The purpose of the present invention is to provide a molecular marker combination, a primer set and a method and application thereof for quickly identifying Matsuura carp, so as to solve the problems existing in the above-mentioned prior art. The present invention screens a SNP molecular marker combination containing 4 SNP sites, which can quickly and specifically identify whether the carp to be tested is Matsuura carp.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a SNP molecular marker combination for identifying Songpu carp, comprising four SNP sites SNP1-SNP4 located on the carp genome;

[0006] The site information of SNP1-SNP4 is as follows:

[0007]

[0008] The registration accession number of the carp genome at NCBI is GCA_905221575.1.

[0009] The present invention also provides a primer set for amplifying the SNP molecular marker combination, comprising primers with the following sequences:

[0010]

[0011]

[0012] The invention also provides application of the primer set in preparing a kit for identifying Songpu carp.

[0013] The invention also provides a kit for identifying Songpu carp, comprising the primer set.

[0014] The present invention also provides the use of the SNP molecular marker combination, the primer set or the kit in any of the following:

[0015] (1) Identification of Songpu carp;

[0016] (2) screening carp fry;

[0017] (3) Screening high-purity carp parents.

[0018] Preferably, the identification of Songpu carp is to determine whether the carp to be tested is Songpu carp among four carps with similar appearances, namely Songpu carp, Jian carp, Yellow River carp and Dai carp.

[0019] The present invention also provides a method for identifying Songpu carp, comprising the following steps:

[0020] Extracting genomic DNA of the tested carp;

[0021] Using the genomic DNA as a template and the primer set to perform PCR amplification;

[0022] Sequencing, genotyping the four SNP sites of the SNP molecular marker combination, and obtaining the genotypes of the four SNP sites;

[0023] Determine whether the carp to be tested is Songpu carp based on the result of genotyping.

[0024] Preferably, the identification of Songpu carp is to determine whether the carp to be tested is Songpu carp among four carps with similar appearances, namely Songpu carp, Jian carp, Yellow River carp and Dai carp.

[0025] Preferably, the judgment criterion is that the carp to be tested is judged to be Matsuura carp only when the results of the genotyping show that the genotype of the SNP1 site is AA, the genotype of the SNP2 site is AA, the genotype of the SNP3 site is TT and the genotype of the SNP4 site is TT.

[0026] The present invention also provides a method for screening carp fry, comprising the following steps:

[0027] For small fry, whole tissue sampling is performed, and the method for identifying Songpu carp is used to identify whether it is Songpu carp;

[0028] Alternatively, for large fry, fin rays are collected and the method for identifying Songpu carp is used to identify whether it is Songpu carp;

[0029] Only fish fry identified as Songpu carp are retained.

[0030] The present invention discloses the following technical effects:

[0031] The invention provides a molecular marker combination for rapidly identifying Songpu carp, corresponding primers and an identification method thereof, and by detecting the molecular marker combination, Songpu carp seedlings and parents can be rapidly, accurately and batch-wise identified and screened in the seedling stage and parent stage, and is particularly suitable for variety identification of small-sized fry, solving the problem of difficulty in distinguishing varieties with similar appearances, improving the quality of introduced breeding, and ensuring the interests of breeders and consumers, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0033] Figure 1 This is the genotyping diagram of the SNP1 site Chr23:28804637T>A marker;

[0034] Figure 2 This is the genotyping diagram of the marker SNP2 site Chr10:13554606C>A;

[0035] Figure 3 This is the genotyping diagram of the SNP3 site Chr24:8172005C>T marker;

[0036] Figure 4 This is the genotyping diagram of the SNP4 site Chr14:16301412G>T marker. DETAILED DESCRIPTION

[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0038] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0039] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0040] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0041] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0042] Example 1

[0043] 1. Screening and identification of SNP molecular markers specific to Songpu carp

[0044] (1) Carp individuals were collected from the Fangshan Scientific Experimental Base of the Chinese Academy of Fishery Sciences, including 60 Yellow River carp, 60 Jian carp, 60 Songpu carp, and 60 Dai carp. Fin ray tissues of 240 carp were sampled, temporarily placed on dry ice, and stored at -80°C for later use.

[0045] (2) The whole genome DNA of the fin ray tissues of 240 carp in step (1) was extracted using the phenol-chloroform extraction method, and the extracted whole genome DNA samples were then sent to Beijing Berry Genomics for DNA library construction and whole genome resequencing.

[0046] (3) Trimmomatic-0.39 software was used to perform quality control on the raw resequencing data to obtain clean data for each sample.

[0047] (4) Using the MEM algorithm of BWA software, the clean data was aligned to the carp reference genome (the reference genome version was GCA_905221575.1) to obtain an intermediate result file in sam format;

[0048] The samtools software was used to convert the sam files into bam files and merge the results, remove duplicate sequences and sort.

[0049] (5) Use GATK software to detect and type SNP sites in the bam file and generate a vcf file;

[0050] The vcftools software was used to perform quality control on the sites in the vcf file to obtain high-quality SNP sites that met the screening criteria. The quality control conditions were: minor allele frequency MAF>0.05; P-value>0.01 in the Hardy-Weinberg test; site missing rate<0.1; polymorphic information content PIC>0.2; population site heterozygosity rate<0.2. After quality control, the core SNP sites were obtained.

[0051] (6) The vcftools software was used to further screen the specific polymorphic sites of Matsuura carp based on the genotype differences of core SNP sites in different carp varieties. The screening criteria were: the homozygous mutation rate of polymorphic sites in Matsuura carp = 1, and the homozygous mutation rate of polymorphic sites in other carp varieties was < 0.1.

[0052] Four SNP sites with significant differences among varieties were screened (see Table 1 for site information), namely SNP1 (T / A), SNP2 (C / A), SNP3 (C / T) and SNP4 (G / T). The genotypes corresponding to the four SNP sites of Songpu carp are all homozygous mutations, that is, the genotype of SNP1 is AA, the genotype of SNP2 is AA, the genotype of SNP3 is TT, and the genotype of SNP4 is TT. Probability statistics show that the probability of homozygous mutations in the above four sites of Yellow River carp, Jian carp and Dai carp is less than 0.01%, and the theoretical probability of identifying Songpu carp in the four carp species using the above four sites is greater than 99.9%.

[0053] Table 1 Variety-specific homozygous SNP loci combination information of Songpu carp

[0054]

[0055] According to the upstream and downstream sequences of the four screened Songpu carp-specific homozygous mutation SNP sites (sequence information is shown in Table 2), corresponding primers were developed to verify the reliability of the sites in the Songpu carp population. The primer information is shown in Table 3.

[0056] Table 2 Upstream and downstream sequence information of homozygous SNP mutation sites specific to Songpu carp

[0057]

[0058]

[0059] The sequence (5'-3') of the upstream and downstream base fragments of the SNP1 molecular marker is shown in SEQ ID NO.1. The molecular marker SNP1 is located at the 201st position of the nucleotide sequence shown in SEQ ID NO.1, and the base therein is T or A.

[0060] SEQ ID NO.1:

[0061] TGATGCATCTGTGGCCTGTTTCAGGACAGAGCAGATGTCTCCTCCTCTATTCCTCACGTTAAACATGAACCTCACTTCCTGCTCACTTATTGGGGAGAGAGGGAGAGGAAAATGCACAAATTAATTAGGCATTTAAAATCTGGAAATCAGCATTAAAATACATACTGTTTTAATAGAATAGCCATAGGACTAAAAGGTATW (W=T / A)GTTCACCCAAATATAAAAATTCTG TCATTATTTGAAAAATGTCCTGGTCTGTCCACACAACAAAGGTCAATATTCTTCAAAACATCAATGAAAGTTTGAAACAACATGATGGAGAGTAAATGATAACGTATTCTACATTTTTACATATCCCCTTAAATATAAATTGTGAATGGCTGCAATCATTGTGTTGGTTTTGACTTCTGGTGCAAATCCCACCAGATAAAACTGTTCCTTGTGCACTATGGCGATCACTTTGTCAGCT.

[0062] The sequence (5'-3') of the upstream and downstream base fragments of the SNP2 molecular marker is shown in SEQ ID NO.2. The molecular marker SNP2 is located at the 279th position of the nucleotide sequence shown in SEQ ID NO.2, and the base therein is C or A.

[0063] SEQ ID NO.2:

[0064] CCCCTGACATTTGTTTTTCTGCAGAACTCAAAAGAAGATACTTTAAAGAATGCTGGTAATCAAAACCAACAGGTTTGTTACATGTAGAGGACATAAAGGGAGTAAAATAATTTTCATTTTGGTTTATTTTTTATTTTTTTGTAAATAAATTGTTTTGTAAAATAAATATTCCTCATGCC ATCTTGGTCAAGCTAGTTATTTAATGGACTTTAAAACTGCTTTCATAATGAGATGTTTATAGATTTGTTAAGTCATGTTATTTATGTATTGTAATCTATATM(M=C / A)ATTAAAATGAAAGTAAATGTTTTGTCTAGGTAACGTTATAAATTTTAAATGAAATATTAATGAACAGT ATAGTAGATATAGAAATGAAACTGGGCTAAGTCTAGTGAGTCCGGCTTGGATGCGGCA GTGTCAGTAAGTTACACCATTGGTCTGGGGTGCGTTTCCCAAAACCAA.

[0065] The sequence (5'-3') of the upstream and downstream base fragments of the SNP3 molecular marker is shown in SEQ ID NO.3. The molecular marker SNP3 is located at the 280th position of the nucleotide sequence shown in SEQ ID NO.3, and the base at this position is C or T.

[0066] SEQ ID NO.3:

[0067] AAGCCATGAGGTGTTGGGAGTGTGTGTCATAGTCTAAGCATCTGACAATCACTTCCTCCTCCCTGTCATCTTTGTCTCCCGGTCTTTGTCCACATTTATTATTTTTGGAAGTCATTTGAAAATTTATAAAACCATGTTACATGAGGGAACCTGTCTGTCTCTCTCAGATCTGAATG CATTTCTGTGTGTATTTATATATACATAATAAATATAAACAGCACACTCATATATGTTATGTAAACAAAACATTTATTTTGGATGCGATTAATCGCGATAAATY(Y=C / T)GTTTGACAGCACTAGTAAAAACTATATGTCACACAGGTCAAAATTGCATTTGTTTATAGAGAGAAAAAACAGTTAAGTTGCATTTACAGACATTGCAAATGCTATAAACATGTATTTT GGTTCCCAACAAGTCATTTAAATTTAATGGTGTACAGAACAGGAACGAAAAGTGTCAAAAAAAAAAATATCGGATATATGTTTTAATACAGAAGAAAAGTTTGATATAATTTGAAATGGCTTTCCTGATGTTCAAACTGTGATTCTGTTCTGGTATGAGCTGGAATATTTCCATTGATTTCCAATGGAATGTAGACATGGATTTATTGCTGGCCACTTAAAAACAGTC.

[0068] The sequence (5'-3') of the upstream and downstream base fragments of the SNP4 molecular marker is shown in SEQ ID NO.4. The molecular marker SNP4 is located at the 186th position of the nucleotide sequence shown in SEQ ID NO.4, and the base therein is G or T.

[0069] SEQ ID NO.4:

[0070] ACGTGAGGGAAGAACGGAACACATTTCCTTATTGCTTTAATTCTGTGCACTCTGCTGATCTTTTATTTTCCCAGTTGCTGCGAGGTGGAAAACTATCTCAAGGACACCTGCTAATCTTGCTTTTGCTTATGTTTAAGTCGTCGGATCCTAGCACATGGGATAATTTCCTCATCACGATTGTTTCCK (K=G / T)TACCTATTTACGACGAAGTGGGCTGTTACCGTGCAGAACCTTTT TCTGTTCACAATCATTAGGTGCGGGAAAATGAGATTCCTGAATCATTAGACGAGGGGGGATTTTTGTTGGAGGGGCAAGAACAATAGACTGCTTTTGTTAGCACTTCTGTCTGGGTGTAAGAAACCATCACAATTAC GCACACTGAAACCGTTGTAATTACGGTGAGAGCATTCGTCTTTTTTCTTCCCATTAAAGCTTCTCCGCGTATCGCCGAGAAACACTTATAGTCCACTGAACGGGAGACATTACTGGAGCTGTTTTTCATCCGGCTCG.

[0071] Table 3 Primer information developed based on 4 SNP sites

[0072]

[0073] 2. Reliability verification of Songpu carp-specific SNP loci

[0074] Sixteen carps each of Jian carp, Songpu carp, Yellow River carp and Dai carp were selected, and the genotyping of the four developed SNP loci was performed using Sanger sequencing.

[0075] The specific steps include:

[0076] (1) extracting genomic DNA of the carp to be tested;

[0077] (2) using the DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NO.5 to SEQ ID NO.12 as primers, respectively, to perform PCR amplification on SNP1 to SNP4 to obtain PCR amplification products;

[0078] The PCR amplification reaction system includes 20 μL of 2×EsTaq Master Mix, 2 μL of 50 ng / μL genomic DNA, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, and 16 μL of sterile water in a volume of 40 μL.

[0079] The reaction procedure of the PCR amplification includes the following sub-steps: ① 94° C., 4 min, ② 94° C., 30 s, ③ 60° C., 30 s, ④ 72° C., 45 s, ⑤ 72° C., 10 min, wherein sub-steps ② to ④ are 30 cycles.

[0080] (3) performing Sanger sequencing on the PCR amplification product obtained in step (2) to determine the genotype of the four SNP sites of the carp to be tested;

[0081] (4) Calculate the genotype frequencies of the four SNP loci in Songpu carp, Jian carp, Yellow River carp and Dai carp populations.

[0082] (5) Combining the sequencing typing results and carp species, it was found that Songpu carp had homozygous mutations at all four SNP sites, that is, the genotyping results of SNP1 site were all AA, the genotyping results of SNP2 site were all AA, the genotyping results of SNP3 site were all TT, and the genotyping results of SNP4 site were all TT. The proportion of homozygous mutations in the genotyping results of Jian carp at SNP1-SNP4 sites was 0; the proportion of homozygous mutations in the genotyping results of Yellow River carp at SNP1-SNP4 sites was 0, 0, 0, and 6.25%; the proportion of homozygous mutations in the genotyping results of Dai carp at SNP1-SNP4 sites was 6.25%, 0, 0, and 12.5%.

[0083] When the genotyping results of the SNP1-SNP4 loci were all homozygous mutations, the proportion of carp identified as Matsuura carp was 100%; among all carp identified as non-Matsuura carp, the two loci with the largest number of homozygous mutations detected in a single individual were homozygous mutations. This verification result is consistent with the data analysis results in the screening of the above-mentioned SNP molecular markers, indicating that the developed SNP loci can effectively identify Matsuura carp among the four carp varieties. The genotypes and varieties of the detected carp individuals at the SNP1-SNP4 loci are shown in Table 4, the genotype frequencies of different carp varieties at the SNP1-SNP4 loci are shown in Table 5, and the genotyping results of the detected carp individuals at the SNP1-SNP4 loci are shown in Table Figure 1 , Figure 2 , Figure 3 and Figure 4 shown.

[0084] Table 4 Genotypes and species of carp individuals detected at SNP1-SNP4 loci

[0085]

[0086]

[0087]

[0088] Table 5 Genotype frequencies of SNP1-SNP4 in four carp breeds

[0089]

[0090] Example 2

[0091] The method for molecular identification, screening and parent selection of Songpu carp seedlings using the variety-specific SNP molecular markers for identifying Songpu carp comprises the following specific steps:

[0092] (1) Randomly select 50-100 carps to be tested and use different sampling strategies for sampling;

[0093] Specifically: for small fry (total length 1-2cm), whole tissue sampling is performed for identification of the fry of the group; for large fry (total length 5-15cm), fin rays are collected for species identification of the fry; for adult carp, fin rays are collected for parent selection.

[0094] (2) The sample DNA was extracted by the phenol-chloroform extraction method as a template, and the nucleotide sequences shown in SEQ ID NO.5-SEQ ID NO.12 were used as primers to perform PCR amplification to obtain PCR amplification products; the PCR amplification products were subjected to Sanger sequencing to determine the genotypes of the four SNP sites in each individual.

[0095] (3) When the genotyping results of the sample show that the genotype of the SNP1 site is AA, the genotype of the SNP2 site is AA, the genotype of the SNP3 site is TT, and the genotype of the SNP4 site is TT, the individual is identified as Songpu carp.

[0096] Using the above-mentioned genotype combination and its typing results, the purity of Songpu carp seedlings and parents can be identified and screened.

[0097] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for amplifying and identifying a SNP molecular marker combination of Songpu carp, characterized in that: Primers included are as follows: Wherein, the SNP molecular marker combination for identifying Songpu carp is 4 SNP sites SNP1-SNP4 located on the carp genome; The site information of SNP1-SNP4 is as follows: The registration accession number of the carp genome at NCBI is GCA_905221575.

1.

2. Use of the primer set as claimed in claim 1 in preparing a kit for identifying Songpu carp.

3. A kit for identifying Songpu carp, characterized in that: Comprising the primer set of claim 1.

4. Use of the primer set according to claim 1 or the kit according to claim 3 in any of the following: (1) Identification of Songpu carp; (2) screening carp fry; (3) Screening high-purity carp parents; in, The identification of Songpu carp is to determine whether the carp to be tested is Songpu carp among four carps with similar appearances, namely, Songpu carp, Jian carp, Yellow River carp and Dai carp; The method of screening carp fry is to screen the fry of Songpu carp from four carps with similar appearances, namely, Songpu carp, Jian carp, Yellow River carp and Dai carp; The method of screening carp high-purity parents is to screen the high-purity parents of Songpu carp from four carps with similar appearances, namely, Songpu carp, Jian carp, Yellow River carp and Dai carp; The carp to be tested is determined to be Songpu carp only when the result of genotyping the carp to be tested according to the kit shows that the genotype of SNP1 site is AA, the genotype of SNP2 site is AA, the genotype of SNP3 site is TT and the genotype of SNP4 site is TT.

5. A method for identifying Songpu carp, characterized in that: The following steps are involved: Extracting genomic DNA of the tested carp; Using the genomic DNA as a template, PCR amplification is performed using the primer set as claimed in claim 1; Sequencing, genotyping the four SNP sites of the SNP molecular marker combination described in claim 1, and obtaining the genotypes of the four SNP sites; Determine whether the carp to be tested is Songpu carp according to the result of genotyping; Wherein, the identification of Songpu carp is to determine whether the carp to be tested is Songpu carp among four carps with similar appearances, namely, Songpu carp, Jian carp, Yellow River carp and Dai carp; The determination criterion is that the carp to be tested is determined to be Songpu carp only when the results of the genotyping show that the genotype of the SNP1 site is AA, the genotype of the SNP2 site is AA, the genotype of the SNP3 site is TT, and the genotype of the SNP4 site is TT.

6. A method for screening carp fry, characterized in that: The following steps are involved: For small fry, whole tissue sampling is performed to identify whether it is Songpu carp using the method as claimed in claim 5; Alternatively, for large fry, fin rays are collected and the method as claimed in claim 5 is used to identify whether it is Songpu carp; Only fish fry identified as Songpu carp were retained; Among them, the screening of carp fry is to select the fry of Songpu carp from four carps with similar appearance, namely Songpu carp, Jian carp, Yellow River carp and Dai carp.

Images