Application of a phosphate transporter gene mutant in rapeseed to arsenic stress resistance

Abstract

The present invention discloses an application of a rapeseed phosphate transporter gene mutant in arsenic stress resistance, specifically an application of a rapeseed BnPHT5;1bs gene or its orthologous gene in regulating plant arsenic stress resistance. The present invention also discloses a method for obtaining arsenic-resistant crops, the method comprising: using an Agrobacterium-mediated genetic transformation method to transform a CRISPR-Cas9 gene editing expression vector containing the rapeseed vacuolar phosphorus transporter gene BnPHT5;1bs according to claim 1 or 2 into a crop genome, and using CRISPR-Cas9 gene editing technology to obtain crop varieties with functional deletions of two homologous genes BnA09PHT5;1b and BnCnPHT5;1b as arsenic-resistant crops. The present invention improves the ability of plants to resist arsenic stress by eliminating the expression of PHT5;1bs.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and arsenic stress-resistant plant breeding, and particularly relates to application of a rapeseed phosphate transporter gene mutant in arsenic stress resistance. Background Art

[0002] Arsenic is a type of metalloid substance widely present in the natural environment. Arsenic is a non-essential element for plants and has a strong toxic effect. It can accumulate in the root tissue of plants to inhibit cell division and elongation. When it is transported to the aboveground part of the plant, it will cause a serious reduction in biomass. Arsenic can be divided into organic and inorganic forms. The inorganic form is further divided into pentavalent arsenic [As(V)] and trivalent arsenic [As(III)]. Arsenate (pentavalent arsenic) and phosphate have the same valence and similar chemical structure. The two will produce an antagonistic effect, allowing arsenic to competitively use phosphate transporters to enter the plant body, thereby affecting the plant's phosphorus-dependent metabolic pathways.

[0003] Brassica napus is an important oil crop that is sensitive to phosphorus. Its growth and development and seed quality are highly dependent on phosphorus nutrition. However, arsenic pollution is ubiquitous in agricultural production, mainly from pesticides and industrial wastewater pollution. It is of great significance to explore and apply gene resources related to resistance to arsenic stress from plants to improve the high yield and high quality of crops. For example, the Chinese patent with publication number CN115851819A discloses an application and method of a phosphate transporter in reducing the ability of rice to enrich, absorb and transport arsenic. The phosphate transporter is OsPht1;9 and / or OsPht1;10. By knocking out the genes encoding OsPht1;9 and OsPht1;10 proteins in rice, the tolerance of rice to arsenic is significantly enhanced, the inorganic arsenic content in rice grains and the arsenic content in stems and leaves are reduced, and the utilization of phosphorus nutrition and growth and development of rice are not affected. For example, Chinese patent publication number CN117089567A discloses that knocking out OsbHLH6 will significantly enhance the arsenic tolerance and drought resistance of rice.

[0004] Arsenic-resistant indicator plants can respond quickly to environmental pollution. Indicator plants can be used to monitor environmental pollution and evaluate environmental quality. Different indicator plants grow in different environments, so it is impossible to use one plant to detect pollution in all ecological environments. If a specific gene of a specific plant can be regulated to make it more sensitive to specific pollutants, the plant can be used specifically for pollution detection in a specific growth environment. Therefore, it is of great significance to discover and clone genes that regulate plant responses to environmental pollution, as well as to develop new environmental indicator plants that are sensitive to environmental pollution, especially crops such as rapeseed. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a rapeseed phosphate transporter gene mutant in arsenic stress resistance, and to improve the ability of plants to resist arsenic stress by eliminating the expression of PHT5;1bs.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] Application of rapeseed BnPHT5;1bs gene or its orthologous gene in regulating arsenic stress tolerance of crops.

[0008] The BnA09PHT5;1b gene sequence in the BnPHT5;1bs gene is the nucleotide sequence shown in SEQ ID NO.1, consisting of 4550bp, and encoding the amino acid sequence shown in SEQ ID NO.2; the BnCnPHT5;1b gene sequence in the BnPHT5;1bs gene is the nucleotide sequence shown in SEQ ID NO.3, consisting of 4230bp, and encoding the amino acid sequence shown in SEQ ID NO.4.

[0009] The method for regulating the resistance of plants to arsenic stress is to improve the ability of plants to resist arsenic stress by reducing the expression of BnPHT5;1bs gene or its orthologous gene.

[0010] Furthermore, the plant is a dicotyledonous plant.

[0011] Further preferably, the plant is Brassica napus.

[0012] The present invention also provides a method for obtaining arsenic-resistant crops, the method comprising: using an Agrobacterium-mediated genetic transformation method to transform a CRISPR-Cas9 gene editing expression vector (or knockout vector) containing the rapeseed vacuolar phosphorus transporter gene BnPHT5;1bs into the crop genome, and using CRISPR-Cas9 gene editing technology to obtain crop varieties with functionally deleted homologous genes BnA09PHT5;1b and BnCnPHT5;1b as arsenic-resistant crops.

[0013] Furthermore, the method for obtaining arsenic-resistant crops is:

[0014] (1) Constructing the BnPHT5;1bs-CRISPR gene editing expression vector and introducing it into the Agrobacterium strain by electroporation;

[0015] (2) sowing the crop seeds and culturing them in the dark;

[0016] (3) Activating the Agrobacterium containing the BnPHT5;1bs-CRISPR gene editing expression vector and using it as an infection solution;

[0017] (4) taking the hypocotyls of crop seedlings grown in dark culture as explants, placing them in an invading bacterial solution for infection, and then co-culturing them in dark conditions;

[0018] (5) After the co-cultivation, the explants are induced to callus, sprout, root and transplant to obtain arsenic-resistant crops.

[0019] The expression vector described in the present invention refers to any vector known in the prior art that can be expressed in plants. For example, vectors suitable for constructing the expression vector described in the present invention include, but are not limited to, PHSE401 (provided by Chen Qijun's research group at China Agricultural University).

[0020] Further preferably, in step (2): the crop seeds are soaked in alcohol and then disinfected with sodium hypochlorite solution, washed with sterile water and cultured in the dark; in step (4), the explant length is 0.5 cm to 1 cm, and the infection takes 10 min to 15 min.

[0021] Furthermore, the crop is a dicotyledonous plant.

[0022] Furthermore, the crop is Brassica napus. Under high arsenic concentration conditions, by comparing the wild type and mutant materials, the mutant has obvious tolerance (improved arsenic stress resistance) compared with the wild type, indicating that the method can quickly obtain stable inherited Brassica napus genetic materials; the BnPHT5; 1bs double mutant rapeseed obtained by the present invention has important application value in rapeseed arsenic stress resistance.

[0023] When the above-mentioned crop is Brassica napus, the two homologous genes BnA09PHT5;1b and BnCnPHT5;1b of Brassica napus are knocked out using CRISPR / Cas9 gene editing technology to obtain the double gene mutant lines of BnA09PHT5;1b and BnCnPHT5;1b. For details, please refer to Bei et al., 2022.

[0024] The arsenic-resistant crops obtained by the present invention can also be used as environmental indicator plants that are sensitive to arsenic pollution.

[0025] Compared with the prior art, the present invention has the following excellent effects: the present invention improves the ability of plants / crops to resist arsenic stress by eliminating the expression of PHT5;1bs, provides new germplasm resources for arsenic resistance of plants / crops (such as rapeseed), and provides new ideas for the creation or improvement of plants / crops that resist arsenic stress or arsenic pollution indicator plants / crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1:Gene editing type of BnPHT5;1b double mutant. Identification of rapeseed CRISPR-Cas9 mutants, two sgRNAs are located in the eighth exon of genes BnA09PHT5;1b and BnCnPHT5;1b, and the target editing status of the obtained double mutants: BnA09PHT5;1b and BnCnPHT5;1b.

[0027] Figure 2 :Analysis of arsenic transport activity of BnPHT5;1bs gene.

[0028] Figure 3 : Phenotypic differences between rapeseed BnPHT5;1bs mutant and wild type under arsenic stress.

[0029] Figure 4 : Biomass and root length of rapeseed BnPHT5;1bs mutant and wild type under arsenic stress. Each line has 10 different individuals, * and ** indicate P < 0.01 and P < 0.05 in Student's t test, respectively.

[0030] Figure 5 : Root morphology of rapeseed BnPHT5;1bs mutant and wild type under arsenic stress. DETAILED DESCRIPTION

[0031] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention. In the following embodiments, unless otherwise specified, all conventional methods are used; the reagents and materials, unless otherwise specified, can be obtained from commercial sources.

[0032] Example 1B Construction of nPHT5;1bs-CRISPR vector

[0033] The rapeseed BnPHT5;1bs double mutant was created using the sgRNA-Cas9 system of Chen Qijun's team from the College of Life Sciences of China Agricultural University. The specific experimental steps are as follows:

[0034] (1) Log in to the website http: / / crisp rh za ue d uc n / CRISPR 2 / and screen the targets. The sequence of target 1 is 5'-CGTGATACAGAGGAACAAGA-3', and the sequence of target 2 is 5'-TGTTCCTCTGTATCACGCAG-3'. Both target sites are located in the eighth exon region of the BnA09PHT5;1b and BnCnPHT5;1b genes. The gene editing type of the BnPHT5;1b double mutant is as follows Figure 1 shown.

[0035] (2) Primer design:

[0036] DT1-BsF:ATATATGGTCTCGATTGGTTCCTCTGTATCACCGCAGGTT

[0037] DT1-F0:TGGTTCCTCTGTATCACGCAGGTTTTAGAGCTAGAAATAGC

[0038] DT2-R0:AACTCTTGTTCCTCTGTATCACCAATCTCTTAGTCGACTCTAC

[0039] DT2-BsR:ATTATTGGTCTCGAAACTCTTGTTCCTCTGTATCACCAA

[0040] (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100 times as a template. DT1-BsF and DT2-BsR were normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20 times. The amplification system is shown in Table 1:

[0041] Table 1 Amplification system

[0042]

[0043]

[0044] PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 s, annealing at 55°C for 25 s, extension at 72°C for 25 s, 34 cycles; total extension at 72°C for 5 min.

[0045] (4) Purify and recover the PCR product and establish the restriction enzyme digestion-ligation system in Table 2:

[0046] Table 2 Enzyme digestion-ligation system

[0047] PCR fragment (626 bp) 2μL pHSE401 2μL 10×NEB T4 buffer 1.5μL 10×BSA 1.5μL BsaI(NEB) 1μL T4 ligase(NEB) / high concentration 1μL <![CDATA[ddH2O]]> 6μL Total 15μL

[0048] Reaction conditions: 37℃ for 5h, 50℃ for 5min, 80℃ for 10min.

[0049] (5) The ligation product was transformed into E. coli DH5α, and 5 μL of the transformed E. coli was taken for screening on a kana LB plate. Positive clone screening: U626-IDF+U629-IDR=726bp colony PCR identification, followed by sequencing using U626-IDF and 629-IDF primers. The vector with the correct sequencing was the CRISPR vector of BnPHT5;1bs.

[0050] U626-IDF primer sequence: TGTCCCAGGATTAGAATGATTAGGC

[0051] U629-IDF primer sequence: TTAATCCAAACTACTGCAGCCTGAC

[0052] U629-IDR primer sequence: AGCCCTCTTCTTTCGATCCATCAAC

[0053] (6) The correctly constructed plasmid vector was introduced into the Agrobacterium strain GV3101 by electroporation, and the positive single clone was selected and stored in a -80°C refrigerator. The genetic transformation method of rapeseed was the same as that in Example 2.

[0054] Example 2 Creation and positive identification of gene-edited rapeseed

[0055] In this embodiment, Brassica napus is taken as an example, and the constructed BnPHT5;1bs-CRISPR vector is used for genetic transformation of rapeseed, using Agrobacterium-mediated genetic transformation. The variety used for rapeseed transformation receptor in the present invention is Westar 10.

[0056] 1. Genetic transformation of transgenic rapeseed plants

[0057] The conversion method is as follows:

[0058] (1) Sowing: Soak rape Westar 10 seeds in 75% alcohol for 1 minute, then sterilize with 1% sodium hypochlorite solution for 15 minutes. Wash the seeds 3-5 times with sterile water in a clean bench, sow them in M0 medium, and culture them in the dark at 24°C for 6 days.

[0059] (2) Activation of Agrobacterium: After 3 days of sowing rapeseed seeds, inoculate Agrobacterium into 50 mL of liquid LB medium containing hygromycin, rifampicin and gentamicin, and culture in a shaking incubator at 28°C and 200 r / min for 12 h to allow Agrobacterium to grow to the logarithmic growth phase. Pour the cultured bacterial solution into two 50 mL sterile centrifuge tubes, centrifuge at 5000 r / min for 10 min, discard the supernatant, gently wash the bacteria with 1 mL of DM, add 10 mL of DM and use a pipette to aspirate, suspend and shake, and adjust the OD of the infected bacterial solution to 1. 600 Adjust the value to 0.6-0.8.

[0060] (3) Infection and co-cultivation of explants: After the infection solution is prepared, place it on ice to activate it as the working bacterial solution. At the same time, use sterile tweezers and a scalpel to vertically cut the hypocotyls of the seedlings cultured in the dark as explants. The optimal length of the explant is 0.5 cm to 1 cm. Place the cut explants in a dish containing the working bacterial solution and infect for 10 min to 15 min. Shake every few minutes during infection. After infection, transfer the explants to sterile filter paper, aspirate the excess infection solution, and then use sterile tweezers to place the explants on M1 culture medium. Co-cultivate at 24°C in the dark for 36 h to 48 h.

[0061] (4) Callus induction: After co-cultivation, the explants were transferred to M2 medium for callus induction for 15 days at 24°C with a photoperiod of 16 h light / 8 h dark. The conditions for differentiation and rooting culture were the same as in this stage.

[0062] (5) Inducing budding: The calli were transferred to M3 medium for differentiation culture, and subcultured every two weeks until budding occurred.

[0063] (6) Root induction and transplanting: After the buds have differentiated and a clear growth point can be seen, the buds are carefully cut off from the callus with sterile tweezers and a scalpel, and the excess callus is removed as much as possible, and then transferred to M4 medium for rooting. The rooted plants are transplanted into nutrient soil, and the T0 generation regenerated plants are bagged and self-pollinated to obtain T1 generation seeds.

[0064] The culture medium formula and number used in the genetic transformation step are shown in Table 3.

[0065] Table 3 Culture medium formula and number used in genetic transformation step

[0066]

[0067]

[0068] Note: MS stands for Murashige and Skoog Stock.

[0069] 2. Positive identification of transgenic rapeseed

[0070] The method for screening transgenic rapeseed seedlings is: take leaves of T0 generation plants, extract genomic DNA using the CTAB method, amplify BnA09PHT5;1b and BnCnPHT5;1b editing region fragments by PCR, and sequence and identify positive rapeseed lines. The primer sequences used to detect the edited gene are as follows:

[0071] BnA09PHT5;1b detection primers:

[0072] The forward primer is 5'-TGTTTTAAAAGAGGAAACCTTTGTTGC'

[0073] The reverse primer is 5'-AGGATCAAGTCCATAAAAATCATGTTA'

[0074] BnCnPHT5;1b detection primers:

[0075] The forward primer is 5'-GCTTAAACTCTTGTGAAACGTTTAAAC'

[0076] The reverse primer is 5'-GTCAGATAAACTTCTATCAATAAAAT'

[0077] The reaction system used for PCR amplification identification is: 5 μL 2× Master Mix (TSINGKE#TSE001), 0.2 μL 10 μM forward primer, 0.2 μL 10 μM reverse primer, 1 μL genomic DNA, 3.6 μL ddH2O.

[0078] The reaction procedure used for PCR amplification identification was: pre-denaturation, 94°C for 5 min; denaturation, 94°C for 30 sec; annealing, 55°C for 30 sec; extension, 72°C for 40 sec; re-extension, 72°C for 10 min; and the three steps of denaturation to extension were cycled 34 times.

[0079] The PCR products of the amplified target fragments were sequenced, and their editing was analyzed using control target sites. The sequencing results showed that two independent mutant strains of BnPHT5;1bs were obtained (#23 and #54). Among them, the BnA09PHT5;1b gene of the #23 double mutant was a single base "a" insertion and a single base mutation "GC", and the BnCnPHT5;1b gene was a two-editing "a" and "t" insertion mutation; the BnA09PHT5;1b gene of the #54 double mutant was a single base "g" insertion and a single base mutation "GC", and the BnCnPHT5;1b gene was a three-editing mutation: "CA", "AG", "GC" ( Figure 1 ).

[0080] Example 3: Analysis of Arsenic Transport Activity of Brassica napus BnPHT5;1bs

[0081] The vectors connected to AtPHT1;1, AtPHT5;1, BnA09PHT5;1b and BnCnPHT5;1b were respectively transferred into BY4741 for expression. The strains were diluted 10 times in sequence and spotted on YNB medium (pH=5.6) containing 0mM, 0.5mM, 1mM and 2mM arsenate, and cultured at 30℃ for 5 days. Figure 2 As shown in the figure, the results showed that arsenic stress severely inhibited the growth of yeast strains containing AtPHT1;1, while the growth inhibition effect of yeast strains containing AtPHT5;1 (without arsenic transport activity), BnA09PHT5;1b, and BnCnPHT5;1b was not obvious ( Figure 2 ), indicating that BnPHT5;1bs protein does not have arsenic transport activity.

[0082] Example 4: Phenotypic analysis of sensitivity of BnPHT5;1bs double mutant strain to arsenic stress

[0083] The seeds of the wild-type Westar 10, BnPHT5; 1b#23 and BnPHT5; 1b#54 interference strains were disinfected with 5% NaClO and then sown on a gauze net placed on the surface of pure water for germination. On the 5th day of germination, seedlings with consistent growth were selected and transplanted to normal Hoagland culture medium for 5 days. After that, they were treated with 0μM and 400μM Na2HAsO4·7H2O[As(V)] for 7 days, and their phenotypes were observed. The results showed that WT grew normally under normal growth conditions compared with the BnPHT5; 1b double mutant strain, and the phenotypes were significantly different ( Figure 3 ); Under arsenic stress, most of the wild-type seedlings showed significant yellowing of cotyledons, while the BnPHT5;1b double mutant lines (BnPHT5;1b#23 and BnPHT5;1b#54) were less stressed, with most of their cotyledons still green ( Figure 3 ).

[0084] Example 5: Analysis of biomass, root length and root morphology of rapeseed BnPHT5;1bs mutant strain and wild type under arsenic stress

[0085] The seeds of wild-type Westar 10, BnPHT5;1b#23 and BnPHT5;1b#54 were disinfected with 5% NaClO and then sown on a gauze net placed on the surface of pure water for germination. On the 5th day of germination, seedlings with consistent growth were selected and transplanted to normal Hoagland culture medium for 5 days. Then, they were treated with 0μM and 400μM Na2HAsO4·7H2O[As(V)] for 7 days. The fresh weight of the aboveground part and root of rapeseed was measured using a 1 / 10,000 balance. The results showed that the aboveground and root biomass of WT were greater than those of BnPHT5;1b double mutants, and the root length was longer. Under arsenic stress, the aboveground and root biomass of WT were less than those of BnPHT5;1b double mutants, and the root length was significantly lower than that of BnPHT5;1b double mutants ( Figure 4 ). Using a root scanner to observe the root morphology of WT and BnPHT5;1b double mutant strains under arsenic stress, it was found that the roots of BnPHT5;1b double mutant strains were longer and more developed than those of WT ( Figure 5 ).

[0086] Based on the above results, it is confirmed that the BnPHT5;1bs gene is involved in the response to arsenic stress. Therefore, genetic engineering techniques such as CRISPR-Cas9 gene editing technology can be used to mutate the gene and reduce its expression level, thereby improving the plant's tolerance to arsenic stress; or by overexpressing BnPHT5;1bs, the plant's sensitivity to arsenic can be increased.

[0087] In summary, the BnPHT5;1bs double mutant can be used in genetic breeding to improve plant tolerance to arsenic stress.

Claims

1. Application of the BnPHT5;1bs gene of Brassica napus in regulating arsenic stress resistance of Brassica napus, characterized in that: The BnPHT5;1bs gene is composed of the BnA09PHT5;1b gene and the BnCnPHT5;1b gene; the BnA09PHT5;1b gene sequence in the BnPHT5;1bs gene is the nucleotide sequence shown in SEQ ID NO.1, encoding the amino acid sequence shown in SEQ ID NO.2; the BnCnPHT5;1b gene sequence in the BnPHT5;1bs gene is the nucleotide sequence shown in SEQ ID NO.3, encoding the amino acid sequence shown in SEQ ID NO.4; The method for regulating the resistance of Brassica napus to arsenic stress is to improve the ability of Brassica napus to resist arsenic stress by reducing the expression of BnPHT5;1bs gene.

2. The use according to claim 1, characterized in that: The CRISPR-Cas9 gene editing expression vector containing the Brassica napus BnPHT5;1bs gene of claim 1 is transformed into the crop genome using an Agrobacterium-mediated genetic transformation method, and the CRISPR-Cas9 gene editing technology is used to obtain crop varieties with functional deletions of two homologous genes, BnA09PHT5;1b and BnCnPHT5;1b, as arsenic-resistant crops, wherein the crop is Brassica napus.

3. The use according to claim 2, characterized in that: The method for obtaining the arsenic-resistant crop is: (1) Constructing the BnPHT5;1bs-CRISPR gene editing expression vector and introducing it into the Agrobacterium strain by electroporation; (2) Sowing the crop seeds and culturing them in the dark; (3) Activate the Agrobacterium containing the BnPHT5;1bs-CRISPR gene editing expression vector and use it as the infection solution; (4) Take the hypocotyls of crop seedlings grown in dark culture as explants, place them in the infective bacterial solution, and then co-culture them in dark conditions; (5) After the co-cultivation, the explants are induced to callus, bud, root and transplant to obtain arsenic-resistant crops.

4. The use according to claim 3, characterized in that In step (2): the crop seeds are soaked in alcohol and then disinfected with a sodium hypochlorite solution, washed with sterile water and cultured in the dark; in step (4), the explant length is 0.5 cm to 1 cm, and the infection takes 10 min to 15 min.

Images