A molecular marker associated with fat deposition traits in sheep and use thereof

Abstract

The application provides a molecular marker related to a fat deposition trait of sheep and application thereof. TM The application is characterized in that the molecular marker is designed according to a primer of an ABCC3 gene sequence, DNA is extracted from sheep blood, and a A / T polymorphic site is found at the 354th bp of an amplified fragment through PCR amplification, DNA sequencing and sequence analysis, and the AQP TM The application is characterized in that the molecular marker is designed according to a primer of an ABCC3 gene sequence, DNA is extracted from sheep blood, and a A / T polymorphic site is found at the 354th bp of an amplified fragment through PCR amplification, DNA sequencing and sequence analysis, and the AQP TM The application is characterized in that the molecular marker is designed according to a primer of an ABCC3 gene sequence, DNA is extracted from sheep blood, and a A / T polymorphic site is found at the 354th bp of an amplified fragment through PCR amplification, DNA sequencing and sequence analysis, and the AQP

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker related to sheep fat deposition traits and its application. Background Technology

[0002] The Hu sheep is a world-renowned dual-purpose breed for both meat and lambskin. The National Meat Sheep Genetic Improvement Plan (2015-2025) explicitly lists Hu sheep as a breeding ewe. Fat plays a crucial role in maintaining the balance of homeostatic metabolism in livestock. In mutton, fat mainly exists in the form of triglycerides, primarily distributed in subcutaneous fat, visceral fat, tail fat, and intramuscular fat. In recent years, with the continuous development of the social economy, people's demands for meat have increased, increasingly focusing on high quality and safety. Mutton has a unique flavor, is rich in nutrients, low in cholesterol and fat, and easily digested and absorbed; therefore, the market demand for mutton is growing. Adipose tissue is an important organ for energy metabolism; excessive fat deposition can cause obesity and a series of metabolic syndromes. In the breeding process, fat deposition increases feeding costs. The characteristics of sheep fat deposition are an important indicator of production performance; excessive fat deposition directly affects the quality of mutton and the economic benefits of sheep farms. Therefore, reducing fat deposition can improve the economic value of carcasses, increase feed efficiency, and save costs.

[0003] The ATP-binding cassette (ABC) transporter family is a large family of extracellular pumps that clear exogenous substances from somatic cells. ATP-binding cassette subfamily C member-3 (ABCC3) is an important transporter within this family, capable of transporting a variety of endogenous and exogenous compounds. The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across the extracellular and intracellular membranes.

[0004] Furthermore, ABCC3 has been confirmed to be expressed in most tumor cells, including lung cancer, pancreatic cancer, and glioma. Studies by ADAMSKA A et al. have found that ABCC3 expression is upregulated in cancer, promoting tumor development and progression, and can participate in tumor cell glycolysis and drug resistance mechanisms.

[0005] Currently, the mechanism of action of this gene in sheep fat deposition has not been reported, and its function is also unclear.

[0006] This invention, through the ABCC3The genes were sequenced and analyzed to explore the association between different genotypes and sheep fat deposition traits, aiming to provide genetic material for genetic improvement to reduce sheep fat deposition and accelerate the breeding process of a new fast-growing, low-fat, high-quality meat sheep breed with independent intellectual property rights. Summary of the Invention

[0007] The purpose of this invention is to provide a molecular marker associated with fat deposition traits in sheep and its application. This molecular marker is obtained by amplifying sheep fat deposition traits. ABCC3 The DNA sequence of the gene was obtained and sequenced. ABCC3 By analyzing the correlation between different genotypes of the polymorphic loci and fat deposition in sheep, a detection method for molecular markers containing polymorphic loci can be established, and these molecular markers can be applied to the breeding of new breeds that reduce fat deposition in sheep.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A molecular marker associated with sheep fat deposition traits, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein W at 354 bp is A or T, and this mutation results in A / T polymorphism of the molecular marker.

[0010] As described above, the application of molecular markers in screening for low-fat sheep breeding shows that when the genotype of the polymorphic locus is AA, its fat deposition is significantly lower than that of the TT genotype.

[0011] The application of a primer pair for detecting the above-mentioned molecular markers associated with sheep fat deposition traits in the screening of low-fat sheep breeding, preferably, the sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] The application of an AQP primer pair for detecting the above-mentioned molecular markers associated with sheep fat deposition traits in the screening of low-fat sheep breeding, preferably, the sequences of the AQP primers are shown in SEQ ID NO.4-6.

[0013] The application of a kit for detecting the above-mentioned molecular markers associated with sheep fat deposition traits in the screening of low-fat sheep breeding, preferably, the kit includes ordinary PCR primer pairs or AQP sequence pairs, the sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the sequences of the AQP primers are shown in SEQ ID NO.4-6.

[0014] A method for detecting the aforementioned molecular markers associated with sheep fat deposition traits includes the following steps:

[0015] 1) Amplify sheep genomic DNA using the above-mentioned ordinary PCR primer pairs, AQP primer pairs, or kits containing the above primer pairs;

[0016] 2) The polymorphic sites of the amplification products obtained in step 1) are identified by typing.

[0017] In step 2), the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0018] Furthermore, preferably, when using ordinary PCR primer pairs for amplification, the polymorphic sites of the amplification products are identified by direct sequencing.

[0019] Furthermore, preferably, when using AQP primer pairs for amplification, a C1000 Touch is used. TM The Thermal Cycler instrument detects fluorescence signals and displays typing results.

[0020] The above-described method, when applied to the detection of fat deposition traits in sheep, allows for the determination of the level of fat deposition in sheep by analyzing the types of polymorphic loci, thereby screening for low-fat sheep. When the genotype of the polymorphic locus is AA, its fat deposition is significantly lower than that of the TT genotype.

[0021] The application of the molecular marker PCR primer pairs, AQP primers, or kits described above in sheep breeding involves amplifying and detecting the genomic DNA of sheep using these primer pairs or kits to determine the genotype of the molecular markers in the sample to be tested. This allows for the selection of small-tailed sheep breeds with less fat deposition.

[0022] The beneficial effects of this invention are as follows:

[0023] This invention provides molecular markers associated with fat deposition traits in sheep and their A / T polymorphic sites. By detecting the genotype of these polymorphic sites, sheep can be effectively identified as low-fat sheep, providing an effective detection method for the breeding of low-fat sheep.

[0024] The method provided by this invention for detecting the aforementioned molecular markers related to sheep fat deposition traits can extract DNA from sheep blood or tissues at any stage, and use the primer pairs provided by this invention for typing to determine the type of fat deposition in the sheep. This method is easy to operate, fast, highly accurate, and low in cost, without waiting for the sheep to grow up. In contrast, existing technologies require waiting until the sheep is fully grown and then relying on phenotypes or slaughter characteristics to determine the degree of fat deposition, which is time-consuming and uneconomical.

[0025] This invention, through the detection of molecular markers and the genotype of the polymorphic site, can be used to select sheep with the AA homozygous gene as breeding stock for breeding purposes, thereby reducing fat deposition and helping to improve the economic benefits of sheep farming. Attached Figure Description

[0026] Figure 1 The sheep in Example 1 ABCC3 Gel electrophoresis image of gene fragments.

[0027] Figure 2 The sheep in Example 1 ABCC3 Sequencing results of gene mutation sites.

[0028] Figure 3 For the sheep in Example 1 ABCC3 AQP typing results of the gene amplification fragment. Detailed Implementation

[0029] This invention analyzes the Hu sheep ABCC3 The relationship between single nucleotide polymorphisms (SNPs) of genes and lipid deposition traits. In addition, [further research was conducted]. ABCC3 The expression levels of genes in sheep with different genotypes. This invention can provide valuable molecular markers for sheep breeding.

[0030] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0031] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this invention are of analytical grade or higher.

[0032] Example 1 ABCC3 Gene amplification

[0033] sheep ABCC3 Using the genetic DNA (GenBank accession number: NC_056064.1) as a template, a pair of primers, AF and AR, were designed using Oligo 7.0 software. The primer sequences are as follows:

[0034] AF (SEQ ID NO.2): 5' - CATCTGTTTGGCTGACCACT - 3'

[0035] AR (SEQ ID NO.3): 5'- TGAAGCACATTTCAGCGAAC - 3'

[0036] (2) ABCC3 Gene amplification and sequencing

[0037] The total volume of the PCR reaction was 35 μL, including: 17.5 μL of 2×PCR Master Mix, 1.1 μL of upstream primer AF (10 μmol / L), 1 μL of downstream primer AR (10 μmol / L), 1.4 μL of DNA template, and 14 μL of ddH2O. The DNA template was genomic DNA extracted from sheep blood.

[0038] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 54.4℃ annealing for 30 s, 72℃ extension for 30 s, for 36 cycles, and a final extension at 72℃ for 10 min.

[0039] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M: molecular weight 1500 marker, lanes 1-10: ABCC3 Gene amplification results. The amplified PCR fragment was sequenced. The nucleotide sequence of this amplified fragment is shown in SEQ ID NO.1, totaling 771 bp. A polymorphic site exists within this fragment, specifically at position 354 bp where W is either A or T, indicating that the amplified gene... ABCC3 The gene fragment (SEQ ID NO.1) exhibits an A / T polymorphism at position 354 bp (see [link]). Figure 2 (where A is type AA, B is type AT, and C is type TT).

[0040] Among them, SEQ ID NO.1:

[0041] CATCTGTTTGGCTGACCACTAACTTTTGCTTTGGGCCCATCCCCGCATTTCAGGTCAATAGGCTTCTGTCTGTTGGGCTCTGTCTATATATACTCTGTATGTTGGTCTGTCTGTCTGTCTAATCTATCCATTGTGCATCCTCAGAACCTGGGTCCCTCCGTCCTGGCTGGAGTTGCTCTCATGATCTTGCTAATCCCACTCAACGGAGCTGTGGCTGTGAAGATGCGTGCCTTCCAGGTGGGTGCTAACAGACTGAGCTGTTCCTGCCTGGAGCCCTGGCCAGGTGCCTGGAGGAGTGCAGTCACTAACCTGGGCCTTACCCACTACCTTGCTTACTGAGTACAGATGGCTCTWAGCCACTTTCACAAACCTTAGCTTACTCTTGCCTTACAACCCTGAGAGGCTTTAGAAACATTCTCATTTTGCAACTAAGGAACCAAGGCCCAGAGAGATTACAGCAATCCAGAATCAGACAGAACTTGCCTCTTCTGGTCTAACGAGAGTTTCTCCACCACATTGCGCTTAGTGTAAATAGCCAGTCATTCAGTCCTTTATTGGCAAACATTTATTGAAGTCTTCCCTAGCCTCCCACTGTACACAAAATAAATGACAAATTTCCACTACCACCCACTAGGCCCCTGCTCACCTTTCAAACCCTCACCTCCTGGAATATGGCTAAATTTCAGCCAGTCTGGCCTTTCTTTTCTCCAAATCACCAAGCTCTGCATGCCTCCGGGCTACCATACATACTGTTCGCTGAAATGTGCTTCA。

[0042] DNA sequence homology search and identification:

[0043] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 100% homology with a partial sequence of the sheep ABCC3 gene DNA (GenBank accession number: NC_056064.1).

[0044] Example 2: Establishment of a Genotyping Detection Method

[0045] 1. Primer sequence design

[0046] AQP TM Genotyping systems, also known as allele-specific quantitative PCR based genotyping assays (AQP), are genotyping systems that combine PCR amplification technology with quantitative PCR technology. This system uses an endpoint method to read fluorescence values ​​and can detect SNPs, insertions, or deletions. It offers great flexibility, low detection costs, and is particularly suitable for large-scale screening projects, such as plant breeding research and pharmacogenomics research. AQP primer pairs were designed targeting the A / T polymorphism site of the amplified fragment in Example 1 for the specific detection of this polymorphism. The optimized nucleotide sequences of the designed AQP primer pairs include:

[0047] Forward primer A1 (SEQ ID NO.4) used to detect AlleleA: GAAGGTCGGAGTCAACGGATTAGCTAAGGTTTGTGAAAGTGGCTT;

[0048] Forward primer A2 (SEQ ID NO.5) used for detecting AlleleT: GAAGGTGACCAAGTTCATGCTTAAGCTAAGGTTTGTGAAAGTGGCTA;

[0049] Universal reverse primer C (SEQ ID NO.6): TTACCCACTACCTTGCTTACTGAGTACAGA.

[0050] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the AQP primer pair was diluted to 100 μmol / L and mixed with sterile water in a volume ratio of 12:12:30:46 (forward primer A1:forward primer A2:universal reverse primer C:sterile water) to prepare a primer mixture.

[0051] 2. Extracted genomic DNA and subjected to quality control.

[0052] Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. The extracted DNA must meet the following requirements: (1) Agarose gel electrophoresis shows a single DNA band without significant dispersion. (2) Nanodrop 2100 detection shows A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. DNA that does not meet these requirements needs to be extracted again until it meets the requirements. Based on the AQPTM detection technology and genome size calculation from Beijing Jiacheng Biotechnology Co., Ltd., the required DNA dosage is 10-20 ng / sample. The extracted genomic DNA is then diluted to a concentration of 10-20 ng / μL as a DNA template.

[0053] 3. Perform genotyping

[0054] Firstly, according to the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size calculations determined the DNA usage to be 10-20 ng / sample. The extracted genomic DNA was then diluted to a concentration of 10-20 ng / μL to serve as a DNA template.

[0055] Each primer in the AQP primer pair is 100 μmol / L and is mixed with sterile water in a volume ratio of 12:12:30:46 (primer A1:primer A2:primer C:stere water) to prepare a primer mixture for later use.

[0056] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2× Probe Mix, and 2 μL of DNA to each well of a 384-well plate. After adding the components, seal the plate, vortex, centrifuge, and place it on a C1000 Touch™ Thermal Cycler instrument for PCR amplification. The specific procedure is as follows:

[0057] Pre-denaturation at 95℃ for 10 minutes;

[0058] 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle;

[0059] 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.

[0060] After amplification, fluorescence signals were detected and genotyping was performed using a C1000 Touch™ Thermal Cycler instrument at 37°C. Some results are shown below. Figure 3 As shown in the figure. HEX is the horizontal axis and FAM is the vertical axis. In the figure, each graph represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "TT"; the green triangle near the middle indicates that the locus is heterozygous genotype "AT"; and the orange dot near the right indicates that the locus is homozygous genotype "AA".

[0061] 4. Application of the molecular markers of this invention in the correlation analysis of sheep fat deposition

[0062] The experiment examined the polymorphism of 906 Hu sheep, determined their genotypes, and established the least squares model as described below. SPSS software was used to perform association analysis between genotype and fat deposition traits.

[0063] Yijk=μ+ Genotypei + Pj+ Sk+ εijk

[0064] Where Yijk is the observed value of fat deposition, μ is the population mean, Genotypei is the genotype effect, Pj is the batch effect, Sk is the seasonal effect, and εijk is the random error. It is assumed that εijk are independent and follow N(0, σ) 2 )distributed.

[0065] Genotyping results showed that among the 906 individuals, there were 232 individuals with the AA genotype, 413 individuals with the AT genotype, and 261 individuals with the TT genotype. The results of the genotype-trait association analysis are shown in Table 1. In the table, tail fat relative to body weight is the ratio of tail fat weight to live weight before slaughter; tail fat relative to carcass weight is the ratio of tail fat weight to carcass weight; perirenal fat relative to body weight is the ratio of perirenal fat weight to live weight before slaughter; perirenal fat relative to carcass weight is the ratio of perirenal fat to carcass weight; mesenteric fat relative to body weight is the ratio of mesenteric fat to live weight before slaughter; and mesenteric fat relative to carcass weight is the ratio of mesenteric fat to carcass weight. P Values ​​and significance were obtained using SPSS software analysis.

[0066] Table 1. Association analysis between ABCC3 gene polymorphism and fat deposition trait in sheep.

[0067]

[0068] Note: Different superscript letters between data in the same row indicate significant differences. P <0.05), where highly significant differences are indicated by: P <0.01, marked with the same letter or no letter, indicates that the difference is not significant. P >0.05).

[0069] The results showed that the mutation site at position 354 bp shown in SEQ ID NO.1 was significantly associated with fat deposition in sheep. Sheep carrying the AA genotype had significantly less fat deposition than sheep carrying the TT genotype (P<0.01). This indicates that the A allele is the dominant allele. The A>T mutation at this site can serve as a potential molecular marker affecting fat deposition in sheep (P<0.01). Selecting the AA genotype for breeding during the stocking process can reduce fat deposition during sheep growth, resulting in a superior flock with lower fat deposition, i.e., low-fat sheep.

Claims

1. The application of primers for detecting molecular markers associated with fat deposition traits in Hu sheep in the screening of low-fat Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where W at 354 bp is A or T, and this mutation leads to the A / T polymorphism of the molecular marker; when the genotype of the polymorphic site is AA, its lipid deposition is significantly lower than that of TT.

2. The application of a primer pair for detecting molecular markers associated with fat deposition traits in Hu sheep in the screening of low-fat Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where W at 354 bp is A or T, and this mutation leads to the A / T polymorphism of the molecular marker; when the genotype of the polymorphic site is AA, its lipid deposition is significantly lower than that of TT; the sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. The application of an AQP primer pair for detecting molecular markers associated with fat deposition traits in Hu sheep in the screening of low-fat Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where W at 354bp is A or T, and this mutation leads to the A / T polymorphism of the molecular marker; when the genotype of the polymorphic site is AA, its lipid deposition is significantly lower than that of TT; the sequences of the AQP primer pair are shown in SEQ ID NO.4-6.

4. The application of a kit for detecting molecular markers associated with fat deposition traits in Hu sheep in the screening of low-fat Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where W at 354 bp is either A or T, and this mutation leads to A / T polymorphism of the molecular marker; when the genotype of the polymorphic site is AA, its lipid deposition is significantly lower than that of TT; the kit includes ordinary PCR primer pairs or AQP sequence pairs, the sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the sequences of the AQP primer pairs are shown in SEQ ID NO.4-6.

5. The application of a method for detecting molecular markers associated with fat deposition traits in Hu sheep in the detection of fat deposition traits in Hu sheep, characterized in that, It includes the following steps: 1) Amplify the genomic DNA of Hu sheep using standard PCR primer pairs, AQP primer pairs, or kits containing the aforementioned primer pairs; 2) Genotyping the site at the 354 bp of the molecular marker in the amplification product obtained in step 1); when the genotype at this site is AA, the lipid deposition is significantly lower than that of the TT genotype. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where W at 354 bp is either A or T.

6. The application as described in claim 5, characterized in that, When amplification was performed using the ordinary PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, the polymorphic sites of the amplification products were identified by direct sequencing.

Images