Application of overexpression of SlMYB52 gene in promoting tomato dwarfing

Abstract

The present invention belongs to the field of modern agricultural industry, and specifically relates to the application of overexpression of SlMYB52 gene in promoting tomato dwarfing. The present invention constructs tomato SlMYB52 gene knockout and overexpression plants by genetic means, and regulates the expression level of SlMYB52 protein to study its regulatory mechanism on tomato plant height. The results show that overexpression of SlMYB52 gene can significantly reduce the plant height of tomatoes, while the plant height of tomatoes is increased after knocking out SlMYB52 gene. In the field of modern agricultural industry, the cultivation of dwarf tomatoes can bear fruit early, increase yield, improve quality, reduce input, and improve land utilization, which is of great significance and wide application value for promoting the commercialization of tomatoes and the process of modern breeding.

Description

Technical Field

[0001] The invention belongs to the field of modern agricultural industry, and specifically relates to the application of overexpressing SlMYB52 gene in promoting tomato dwarfing. Background Art

[0002] Tomato (Solanum lycopersicum L.) belongs to the genus Solanaceae, native to South America, and is one of the most widely grown vegetable crops in the world. There are many varieties of tomatoes, which can be used as both vegetables and fruits. Its fruit is rich in nutrients, containing considerable organic acids such as malic acid and citric acid, as well as nutrients such as carotenoids, vitamin B1, and lycopene. It is favored by consumers for its unique flavor and nutritional value. my country is the world's largest tomato producer. According to statistics, my country's tomato planting area and output are both ranked first in the world, accounting for more than 1 / 3 of the global output. In 2022, the planting area was 1.1692 million hectares, of which facility tomatoes accounted for nearly 60%. Early spring protected tomato dwarfing and dense planting is a simple and easy cultivation method with high economic benefits. It has the advantages of early fruiting and high yield, and is also easy to mechanized management. It can reduce the cost of tomato production, improve land utilization, and improve economic benefits. Its yield can be increased by about 20%, and the harvest is concentrated. Due to early maturity and concentrated listing, the economic benefits are considerable, which is very beneficial to proper land leisure and crop rotation. However, this cultivation technology has very high requirements for the selection of tomato varieties, which need to be selected with strong resistance, early maturity, and the characteristics of dwarf plant height suitable for dense planting. Therefore, it is urgent to explore the regulatory effect and molecular mechanism of tomato plant height, find the key genes for improving tomato plant height, and lay the foundation for cultivating new tomato germplasm with strong resistance and suitable for dwarfing and dense planting. It has important theoretical and practical significance for promoting simplified and efficient cultivation of tomatoes, promoting sustainable and healthy development of agriculture, helping farmers increase income, and revitalizing rural areas. Summary of the invention

[0003] The purpose of the first aspect of the present invention is to provide an application of overexpressing the SlMYB52 gene in promoting tomato dwarfing.

[0004] The object of the second aspect of the present invention is to provide the application of a1) to a3) in at least one of b1) to b4).

[0005] The third aspect of the present invention aims to provide a use of a SlMYB52 protein inhibitor in at least one of d1) to d8).

[0006] The fourth aspect of the present invention aims to provide a method comprising the step of reducing the expression level of SlMYB52 protein in tomatoes.

[0007] The fifth aspect of the present invention aims to provide a method comprising the step of increasing the expression level of SlMYB52 protein in tomatoes.

[0008] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides the use of overexpressing the SlMYB52 gene in regulating salt stress resistance of tomatoes.

[0010] The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO: 1.

[0011] The second aspect of the present invention provides the use of a1) to a3) in at least one of b1) to b4):

[0012] a1) S1MYB52 protein;

[0013] a2) biological materials related to SlMYB52 protein;

[0014] a3) an agent for targeting and upregulating the expression of S1MYB52 protein;

[0015] b1) reduce the plant height of tomatoes;

[0016] b2) Cultivating tomato varieties;

[0017] b3) preparing a product for reducing the plant height of tomatoes;

[0018] b4) preparing products of cultivated tomato varieties.

[0019] Preferably, the biomaterial comprises at least one of c1) to c12):

[0020] c1) a nucleic acid molecule encoding a S1MYB52 protein;

[0021] c2) an expression cassette containing the nucleic acid molecule described in c1);

[0022] c3) a recombinant vector containing the nucleic acid molecule described in c1);

[0023] c4) a recombinant vector containing the expression cassette described in c2);

[0024] c5) a recombinant cell containing the nucleic acid molecule described in c1);

[0025] c6) a recombinant cell containing the expression cassette described in c2);

[0026] c7) a recombinant cell containing the recombinant vector described in c3);

[0027] c8) a recombinant cell containing the recombinant vector described in c4);

[0028] c9) a recombinant microorganism containing the nucleic acid molecule described in c1);

[0029] c10) a recombinant microorganism containing the expression cassette described in c2);

[0030] c11) a recombinant microorganism containing the recombinant vector described in c3);

[0031] c12) A recombinant microorganism containing the recombinant vector described in c4).

[0032] Preferably, the tomato variety comprises the following characteristics: the plant height of tomatoes is reduced.

[0033] The third aspect of the present invention provides the use of SlMYB52 protein inhibitor in at least one of d1) to d4):

[0034] d1) Increase the plant height of tomatoes;

[0035] d2) Cultivating tomato varieties;

[0036] d3) preparing a product for increasing tomato plant height;

[0037] d4) preparing a product of cultivated tomato variety.

[0038] Preferably, the tomato variety comprises the following characteristics: the plant height of tomatoes is increased.

[0039] Preferably, the SlMYB52 protein inhibitor comprises at least one of a substance that inhibits the activity of the SlMYB52 protein, a substance that degrades the SlMYB52 protein, and a substance that reduces the expression level of the SlMYB52 protein.

[0040] Preferably, the substance that reduces the expression level of SlMYB52 protein comprises at least one of e1) to e13):

[0041] e1) at least one of siRNA, dsRNA, miRNA, ribozyme, shRNA, and CRISPR / Cas system targeting S1MYB52 protein;

[0042] e2) a nucleic acid molecule encoding e1);

[0043] e3) an expression cassette comprising the nucleic acid molecule described in e2);

[0044] e4) a recombinant vector comprising the nucleic acid molecule described in e2);

[0045] e5) a recombinant vector comprising the expression cassette described in e3);

[0046] e6) a transgenic cell comprising the nucleic acid molecule described in e2);

[0047] e7) a transgenic cell comprising the expression cassette described in e3);

[0048] e8) a transgenic cell comprising the recombinant vector described in e4);

[0049] e9) a transgenic cell comprising the recombinant vector described in e5);

[0050] e10) a recombinant microorganism containing the nucleic acid molecule described in e2);

[0051] e11) a recombinant microorganism containing the expression cassette described in e3);

[0052] e12) a recombinant microorganism containing the recombinant vector described in e4);

[0053] e13) A recombinant microorganism containing the recombinant vector described in e5).

[0054] Preferably, the SlMYB52 protein inhibitor comprises a CRISPR / Cas system targeting the SlMYB52 protein, and the CRISPR / Cas system comprises sgRNA.

[0055] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 4.

[0056] Preferably, the CRISPR / Cas system targeting SlMYB52 protein further comprises Cas protein and / or biological material associated with Cas protein; the biological material comprises: at least one of: f1) to f12): f1) a nucleic acid molecule encoding Cas protein; f2) an expression cassette comprising the nucleic acid molecule of f1); f3) a recombinant vector comprising the nucleic acid molecule of f1); f4) a recombinant vector comprising the expression cassette of f2); f5) a transgenic cell comprising the nucleic acid molecule of f1); f6) a transgenic cell comprising the expression cassette of f2); f7) a transgenic cell comprising the vector of f3); f8) a transgenic cell comprising the vector of f4); f9) a recombinant microorganism containing the nucleic acid molecule of f1); f10) a recombinant microorganism containing the expression cassette of f2); f11) a recombinant microorganism containing the recombinant vector of f3); f12) a recombinant microorganism containing the recombinant vector of f4).

[0057] Preferably, the Cas protein comprises a Cas9 protein.

[0058] A fourth aspect of the present invention provides a method comprising: a step of reducing the expression level and / or activity of the SlMYB52 protein in tomatoes.

[0059] Preferably, the method is at least one of g1) to g2): g1) a method for increasing the plant height of tomatoes; g2) a method for cultivating tomato varieties.

[0060] Preferably, the tomato variety comprises the following characteristics: increased plant height.

[0061] Preferably, the tomato variety comprises the following characteristics: plant height is increased relative to a reference level; the reference level is the level of the wild type.

[0062] Preferably, the step of reducing the expression level and / or activity of the SlMYB52 protein in tomatoes is to introduce at least one of h1) to h3) into tomato tissues and / or tomato cells.

[0063] h1) the above-mentioned sgRNA; h2) the biological material of the above-mentioned sgRNA; h3) the above-mentioned CRISPR / Cas system.

[0064] Preferably, the introduction method includes various conventional or specific genetic transformation methods such as using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0065] A fifth aspect of the present invention provides a method comprising: a step of increasing the expression level and / or activity of the SlMYB52 protein in tomatoes.

[0066] Preferably, the method is at least one of i1) to i2): i1) a method for reducing the plant height of tomatoes; i2) a method for cultivating tomato varieties.

[0067] Preferably, the tomato variety comprises the following characteristics: reduced plant height.

[0068] Preferably, the tomato variety comprises the following characteristics: plant height is reduced relative to a reference level; the reference level is the level of the wild type.

[0069] Preferably, the step of increasing the expression level and / or activity of the SlMYB52 protein in tomatoes is to introduce a nucleic acid molecule encoding the SlMYB52 protein into tomato tissues or tomato cells.

[0070] The beneficial effects of the present invention are:

[0071] The present invention first discovered the application of tomato SlMYB52 in tomato variety breeding. SlMYB52 can regulate tomato salt tolerance, biomass accumulation, photosynthesis level, plant height, number of lateral buds and other aspects. The present invention first constructed transgenic plants with overexpression and gene knockout of tomato SlMYB52 gene, and conducted functional studies. It was found that the SlMYB52 gene can regulate the plant height of tomatoes. The SlMYB52 gene provided by the present invention provides gene resources for cultivating new dwarf tomato varieties, and has good potential application value. In the field of modern agricultural industry, the cultivation of dwarf tomatoes can promote the promotion and application of early spring dwarfing and dense planting cultivation technology, which is of great significance for early fruiting, centralized listing, improving land utilization, reducing input, increasing yield, and promoting efficient cultivation of tomatoes. It is also of great significance and wide application value for promoting the commercialization of tomatoes and the process of modern breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 These are the results of Western Blot detection of genes and proteins of the tomato strain overexpressing the SlMYB52 gene in Example 3 of the present invention; wherein A is the expression level of the tomato SlMYB52 gene, and B is the expression level of the tomato SlMYB52 protein.

[0073] Figure 2 The sequencing results of the sgRNA sequence of the mutant myb52 plant and the expression level of the SlMYB52 gene of the mutant material in Example 3 of the present invention are shown; A is a simplified diagram of the sequencing results of the sgRNA sequence of the mutant myb52 plant, and B is the expression level of the tomato SlMYB52 gene.

[0074] Figure 3 These are the expression changes and protein accumulation changes of the SlMYB52 gene in tomatoes under salt stress treatment at different times in Example 1 of the present invention; wherein A is the expression level of the SlMYB52 gene in tomatoes under salt stress, and B is the expression level of the SlMYB52 protein in tomatoes under salt stress.

[0075] Figure 4 The aboveground growth phenotype, fresh weight and dry matter accumulation level of the wild-type plants, overexpressing plants MYB52-OE and mutant myb52 plants in Example 1 of the present invention after 7 days of normal and salt stress treatment; wherein A is the aboveground growth of tomatoes, B is the aboveground fresh weight level of tomatoes, C is the decrease ratio of aboveground fresh weight of tomatoes of the three materials under salt stress, D is the aboveground dry weight level of tomatoes, and E is the decrease ratio of aboveground biomass of tomatoes of the three materials under salt stress.

[0076] Figure 5These are the statistical results of plant height of wild-type plants, overexpression plants MYB52-OE and mutant myb52 plants in Example 1 of the present invention after normal and salt stress treatment for 7 days; wherein A is the statistical result of tomato plant height, and B is the reduction ratio of tomato plant height of the three materials under salt stress.

[0077] Figure 6 The figures are the root growth phenotype, fresh weight and dry matter accumulation level of the wild-type plants, the overexpressing plants MYB52-OE and the mutant myb52 plants in the embodiments of the present invention after 7 days of normal and salt stress treatment; wherein A is the growth of the underground part of tomatoes, B is the fresh weight level of tomato roots, C is the decrease ratio of fresh weight of tomato roots of the three materials under salt stress, D is the dry weight level of tomato roots, and E is the decrease ratio of root biomass of tomatoes of the three materials under salt stress.

[0078] Figure 7 The relative conductivity levels of leaves of the wild-type plants, the overexpressing plants MYB52-OE and the mutant myb52 plants in Example 1 of the present invention after 7 days of normal and salt stress treatments.

[0079] Figure 8 This is the change in the maximum photochemical efficiency (Fv / Fm) of leaf PSII of the wild-type plants, overexpressing plants MYB52-OE and mutant myb52 plants in Example 1 of the present invention after 7 days of normal and salt stress treatment.

[0080] Fig. 9 These are the statistical results of tomato lateral bud growth phenotype, number of lateral buds, and length of wild-type plants, overexpressing plants MYB52-OE, and mutant myb52 plants under normal growth conditions (without salt stress) in Example 1 of the present invention; wherein A is the lateral bud phenotype shooting result, B is the statistical result of the total lateral bud length, and C is the number of lateral buds per plant. DETAILED DESCRIPTION

[0081] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0082] Significance description: The data of the following examples of the present invention are expressed as mean ± standard deviation (n = 4), * and different letters represent significant differences between treatments (P < 0.05, Student's t test or Tukey's test), where * is Student's t test and letters are Tukey's test.

[0083] Example 1 Construction of S1MYB52 gene overexpression vector

[0084] The SlMYB52 gene is derived from tomato, and its number in the tomato genome database (https: / / solgenomics.net / ) is Solyc03g093890, and its nucleic acid sequence is shown in SEQ ID NO: 1. To explore the effect of SlMYB52 overexpression on tomato salt stress resistance, the SlMYB52 gene was first cloned from the tomato genome. According to the sequence analysis of the coding region, specific primers SlMYB52-F and SlMYB52-R were designed, and restriction enzyme sites (AscI and KpnI) were added to the primers, respectively. The sequence of SlMYB52-F is: ttacaattaccatggggcgcgccATGCCAAGGGTACAACAACAGC (5'-3', SEQ ID NO: 2); the sequence of SlMYB52-R is: aacatcgtatgggtaggtaccGATATTTCCAAGTACATCAATCCAGAA (5'-3', SEQ ID NO: 3). The SlMYB52 fragment was amplified by PCR with KOD high-fidelity enzyme, and then the PCR amplified fragment and the vector were digested, and the SlMYB52 fragment was connected to pFGC1008-HA to obtain the plant overexpression vector pFGC1008::SlMYB52-HA. The above recombinant plasmid was sent to Youkang Company for sequencing confirmation, and the nucleotide sequence of the obtained gene SlMYB52 is shown in SEQ ID NO: 1. The results showed that the cloned sequence was consistent with the sequence published in Solgenomics (Solyc03g093890), and the positive plasmid was extracted for use and named pFGC1008::SlMYB52-HA.

[0085] Example 2 Construction of S1MYB52 CRISPR / Cas9 gene knockout vector

[0086] In order to explore the effect of SlMYB52 gene deletion on tomato salt tolerance, the target gene sequence of SlMYB52 was designed in this example, the pCAMBIA1301-U6-26-sgRNA1-SlMYB52-35S-cas9SK vector was constructed by enzyme ligation, and the SlMYB52 gene knockout material was constructed using CRISPR / Cas9 technology for research.

[0087] First, the target sequence of the SlMYB52 gene was designed using the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The specific sequence was sgRNA1: GGAGGCGATCATAAAGAAGG (5'-3', SEQ ID NO: 4). The synthesized sgRNA1 sequence (single strand) was annealed to form a double-stranded sgRNA1, and both ends of the double-stranded sgRNA1 had BbsI restriction endonuclease cleavage sites. The formed sgRNA1 was connected to the AtU6-26SK vector digested with BbsI restriction endonuclease, and the positive plasmid was extracted for standby use, named U6-26-sgRNA1-SlMYB52-SK. The U6-26-sgRNA1-SlMYB52-SK and 35S-Cas9SK vectors were double-digested with KpnI and SalI restriction endonucleases at the same time, and the respective digestion products were recovered and the digested U6-26-sgRNA1-SlMYB52-SK fragments were connected to the 35S-Cas9SK vector that was also digested. The bacterial liquid PCR detection primers are, U6-26-F: GACGGCCAGTGAATTGTA (5'-3', SEQ ID NO: 5), U6-26-R: TATCTAAGCGATGTGGGACT (5'-3', SEQ ID NO: 6), sequencing verified the positive clones, extracted the positive plasmid for standby use, and named it U6-26-sgRNA1-SlMYB52-35S-cas9SK. KpnI and XbaI restriction endonucleases were used to simultaneously perform double enzyme digestion on U6-26-sgRNA1-SlMYB52-35S-cas9SK and pCAMBIA1301 vector, and a band of about 6 kb was recovered from U6-26-sgRNA1-SlMYB52-35S-cas9SK, i.e., U6-26-sgRNA1-SlMYB52- The 35S-cas9 fragment was connected to the pCAMBIA1301 vector that had been digested. The ligation product was transformed into E. coli DH5α competent cells, and a single colony was picked and cultured overnight at 37°C and 200rpm in a liquid LB medium containing 50 mg / L kanamycin (Kan). Primers were designed at the 5' end of the pCAMBIA1301 vector for bacterial liquid PCR detection (~550bp), and the upstream and downstream primers were U6-26-Cas9-F: GCTCGTATGTTGTGTGGAAT (5'-3', SEQ ID NO: 7), U6-26-Cas9-R: TATCTAAGCGATGTGGGACT (5'-3', SEQ ID NO: 8). The positive clones were verified by sequencing by Youkang Company, and the positive plasmids were extracted for standby use, named pCAMBIA1301-U6-26-sgRNA1-SlMYB52-35S-cas9.

[0088] Example 3 Obtaining S1MYB52 transgenic plants

[0089] The plant overexpression vector pFGC1008::SlMYB52-HA and the gene editing vector pCAMBIA1301-U6-26-sgRNA1-Sl MYB52-35S-cas9 were transformed into Agrobacterium GV3101 by electroporation, and wild-type (Ailsa Craig) tomato cotyledons were infected. Tissue culture seedlings were obtained by inducing callus, inducing resistance differentiation and rooting culture, and single plant verification and harvesting were performed. The verification method is as follows: Fluorescence quantitative experiments and Western Blot were used to verify the SlMYB52 overexpression positive transgenic plants. The results of the fluorescence quantitative experiment showed that the expression of the SlMYB52 gene in the overexpression strain was significantly upregulated compared with the wild type (such as Figure 1 The results of Western Blot experiments showed that there was no SlMYB52-HA protein band in the wild type, and obvious SlMYB52-HA bands appeared in the overexpression plants (as shown in Figure 1 (as shown in B). The primer sequences used in the fluorescence quantitative experiment are as follows: RT-SlMYB52-F:CCAACCACATTCCATTCCCC (5'-3', SEQ ID NO: 9), RT-SlMYB52-R:AACTAGGACCTGCACATGGG (5'-3', SEQ ID NO: 10), RT-SlACTIN2-F:TGTCCCTATTTACGAGGGTTATGC (5'-3', SEQ ID NO: 11), RT-SlACTIN2-R:CAGTTAAATCACGACCAGCAAGAT (5'-3', SEQ ID NO: 12), RT-SlUBI3-F:GCCGACTACAACATCCAGAAGG (5'-3', SEQ ID NO: 13), RT-SlUBI3-R:TGCAACACAGCGAGCTTAACC (5'-3', SEQ ID NO: 14).

[0090] The positive SlMYB52 mutant transgenic plants (plants transferred with the pCAMBIA1301-U6-26-sgRNA1-SlMYB52-35S-cas9 vector prepared in Example 2) were verified by plant tissue DNA extraction, PCR and sequencing technology. The sequencing results showed that the mutant myb52 plants (SlMYB52 CRISPR / Cas9 knockout strains) were missing 1 base (such as Figure 2As shown in A in the figure, and due to the base deletion, the stop codon appears early to stop translation, thereby achieving the effect of inactivating the MYB52 protein function. This example also detects the expression level of the MYB52 gene in the leaves of the wild type and the mutant myb52. The results show that compared with the wild type, the expression of the MYB52 gene in the mutant shows a sharp decrease trend, and the expression of the MYB52 gene in the mutant myb52 material is almost undetectable (as shown in Figure 1). Figure 2 (shown in B).

[0091] Effect Example 1 Evaluation of Salt Tolerance of S1MYB52 Transgenic Plants

[0092] 1. Experimental Materials

[0093] The tomato varieties selected for the experiment were wild-type Ailsa Craig and the SlMYB52 overexpression and SlMYB52 CRISPR / Cas9 knockout strains obtained in Example 3.

[0094] 2. Experimental methods

[0095] Tomato seeds were sterilized by soaking in 55°C hot water for 15 min, and then transferred to a shaking incubator at 28°C and 200 rpm for germination for 2 days. When about 80% of the seeds turned white, they were sown in a 72-hole tray filled with a mixture of peat and vermiculite (2:1, v / v) for seedling cultivation in a plant factory. The growth conditions were: room temperature of 25°C / 20°C, photosynthetic photon flux density of 300 μmol·m -2 ·s -1 , the photoperiod is 12 / 12h (day / night). After germination, water the substrate according to the moisture content to keep the substrate moist. Hogland nutrient solution (PH1782, PHYGENE) is used throughout the process. When the tomato seedlings grow to 3 leaves and 1 heart (about 15 days after sowing), the seedlings are transplanted into nutrient pots with a diameter of 10cm and a depth of 9cm and planted in the plant factory.

[0096] Salt stress treatment and control: When the tomato seedlings grow to five leaves and one heart, salt stress treatment is carried out: 200mL of Hoagland nutrient solution (PH1782, PHYGENE) containing 250mM NaCl per plant is used as salt stress treatment, and the same volume (200mL) of Hoagland nutrient solution containing 0mM NaCl is used as control. Root irrigation treatment is carried out respectively, and treatment is carried out once every three days. After 7 days of salt stress treatment, phenotypic photography, dry weight, maximum photochemical efficiency of photosystem II and relative conductivity are calculated; for gene and protein experiments under salt stress response, RNA and protein sampling are carried out at 0h, 6h, 12h, 24h, 48h, and 72h of salt stress treatment.

[0097] Extraction of tomato total RNA, cDNA synthesis and gene expression analysis: RNA was extracted from young tomato leaves treated with salt stress for 0h, 6h, 12h, 24h, 48h and 72h. After the plant leaf tissue was ground with liquid nitrogen, the total RNA of the tissue was extracted using the Plant Total RNA Extraction Kit (Tiangen, Beijing) according to the instructions. After confirming the concentration and quality of the RNA sample with Nanodrop, the RNA was reverse transcribed into cDNA using the ReverTraAce qPCR RT Kit (Toyobo) (containing genomic DNA removal enzyme) according to the instructions. Real-time fluorescence quantitative PCR used the SYBR fluorescent dye kit (Takala) and the PCR reaction was performed on the Roche light cycler480PCR instrument. Tomato ACTIN2 and UBI3 (ubiquitin 3) genes were used as internal references, and the relative expression of the genes was calculated according to the method of (Livak and Schmittgen., 2001).

[0098] Protein extraction and Western-blot detection of tomato leaves: For the extraction of total tomato protein, young tomato leaves treated with salt stress for 0h, 6h, 12h, 24h, 48h, and 72h were taken. About 0.1g was ground into powder in liquid nitrogen, and 0.2-0.3mL of extraction solution (100mM HEPES, pH 7.5, 5mM EDTA, 5mM EGTA, 10mM DTT, 10mM NaVO3, 10mM NaF, 50mM-glycerophosphate, 10% (v / v) glycerol, 1mM PMSF and 5% (w / v) PVPP) was added. After vortex mixing, centrifugation was performed at 13000rpm and 4℃ for 20min. The supernatant was the obtained protein. The protein content was quantified using Coomassie Brilliant Blue, and the supernatant was mixed with 2× loading buffer (250mM Tris-HCl, pH 6.8, 10% (w / v) SDS, 0.5% (w / v) bromophenol blue, 50% (v / v) glycerol, 10mM DTT) were mixed in equal volumes and heated at 95°C for 10 min. 80 or 100 μg of total protein were separated by 10% (w / v) SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane. TBST (20mM Tris, pH 7.5, 30mM NaCl, 0.05% (v / v) Tween 20) containing 5% (w / v) BSA was used as the blocking solution and blocked at room temperature for 1 hour, and then the membrane was washed 3-5 times with TBST, each time for 5 minutes.

[0099] For MYB52 protein: Incubate with 0.1% (v / v) HA polyclonal antibody (Abcam, ab18181, Cambridge, MA, USA) at room temperature for 1 hour, wash and incubate with anti-mouse-HRP conjugated antibody (Abcam, ab205719, Cambridge, MA, USA) at room temperature for 1 hour. Wash the membrane with TBST 5 times, 5 minutes each time. Finally, use the high-sensitivity chemiluminescence kit (Perkin Elmer, Massachusetts, USA) according to the manufacturer's instructions to observe the signal on the blot. Plant actin monoclonal antibody (Plant actin Monoclonal Antibody, Q30, Cat#YM3034) was used as a control for Western-blot analysis.

[0100] The relative conductivity of plants is determined as follows: cut the tomato leaves after treatment into strips of appropriate length (avoiding the main veins), quickly weigh 3 portions of fresh samples, 0.2 g each, and place them in graduated centrifuge tubes filled with 20 mL of deionized water, cover them with lids, and place them in a 28°C shaker for 1.5 h-2 h. Use a conductivity meter to measure the conductivity R1 of the extract, then heat it in a boiling water bath for 15 min, cool it to room temperature, shake it well, and measure the conductivity R2 of the extract again. Relative conductivity = R1 / R2*100%.

[0101] The specific method for determining the maximum photochemical efficiency of photosystem II is as follows: after the plants are placed in a dark environment for 30 minutes, a chlorophyll fluorescence imager (IMAG-PAM; Heinz Walz, Germany) is used to irradiate the plants with detection light (<0.5 μmol m- 2 s -1 ), the minimum fluorescence Fo was measured, and then saturation pulse light (4000 μmol m -2 s -1 ), and measure the maximum fluorescence Fm.

[0102] Calculation method of fluorescence parameters: PSⅡ maximum photochemical efficiency (Fv / Fm) = (Fm-Fo) / Fm.

[0103] The observation and statistical methods of tomato lateral branch phenotype were as follows: the three materials of tomatoes were grown under the above normal conditions (no salt stress treatment) for about 50 days (10-12 leaf stage), the lateral bud phenotype was observed and photographed, and the length and number of lateral buds were counted. The total lateral bud length of the three materials was counted from the bottom to the top of the lateral bud length of 10 nodes starting from the first true leaf, and the sum was the total length of the lateral bud; the number of lateral buds per plant was counted according to the length of the lateral bud at each node greater than 0.3 cm, 15 replicates were added for each treatment, and the independent experiment was repeated 3 times.

[0104] 2. Experimental results

[0105] 1) Tomato SlMYB52 responds to salt stress

[0106] The tomato varieties selected for the experiment were wild-type Ailsa Craig and the SlMYB52 overexpression and SlMYB52 CRISPR / Cas9 knockout strains obtained in Example 3. The seeds were sown in plastic pots filled with a 3:1 peat and vermiculite composite cultivation matrix. After emergence, water was applied according to the moisture content of the matrix to keep the matrix moist. Hoagland nutrient solution was used throughout the process. When the tomato seedlings grew to five leaves and one heart, salt stress treatment was carried out: 200 mL of Hoagland nutrient solution (PH1782, PHYGENE) containing 250 mM NaCl per plant was used for salt stress treatment, and an equal volume (200 mL) of Hoagland nutrient solution containing 0 mM NaCl was used as the control. Root irrigation treatment was performed respectively, and the treatment was performed once every three days. After 7 days of salt stress treatment, phenotypic photography was performed, and the dry weight, maximum photochemical efficiency of photosystem II and relative conductivity were calculated. For gene and protein experiments under salt stress response, RNA and protein sampling were performed at 0h, 6h, 12h, 24h, 48h and 72h of salt stress treatment.

[0107] First, wild-type Ailsa Craig tomato seedlings that had grown to five leaves and one heart were treated with salt stress by applying 200 mL of Hoagland nutrient solution containing 250 mM NaCl to each plant. RNA and protein samples were collected at 0 h, 6 h, 12 h, 24 h, 48 h, and 72 h after salt stress treatment, and related tests were performed. The transcription results of the SlMYB52 gene are shown in Figure 2. Figure 3 As shown in A, the expression results of SlMYB52 protein are as follows Figure 3 As shown in B. Salt stress can significantly induce the transcription of SlMYB52 and the accumulation of MYB52 protein. With the increase of salt stress treatment time, the transcription of SlMYB52 gene showed a trend of first increasing significantly and then gradually decreasing. The highest expression level of SlMYB52 gene was induced by salt stress treatment for 6 hours. As the salt stress treatment time increases, MYB52 protein also shows a trend of first gradually accumulating and then decreasing. Salt stress treatment for 24 hours promotes the accumulation of SlMYB52 protein. The above results show that tomato SlMYB52 responds to salt stress.

[0108] 2) Effects of SlMYB52 on tomato phenotype

[0109] Then, the five-leaf and one-heart wild-type tomato seedlings (WT), the SlMYB52 gene overexpression strain (MYB52-OE) obtained in Example 3, and the mutant strain (myb52) were treated with salt stress: 200 mL of Hoagland's nutrient solution containing 250 mM NaCl per plant was used as salt stress treatment, and an equal volume (200 mL) of Hoagland's nutrient solution containing 0 mM NaCl was used as control. Root irrigation was performed respectively, once every three days, and the growth phenotype and salt damage phenotype of the wild-type, overexpression and mutant tomato plants were observed after one week.

[0110] The actual shooting results of the aboveground growth of tomatoes are as follows Figure 4 As shown in A, the fresh weight of the aboveground parts is as follows Figure 4 As shown in B, the aboveground fresh weight of tomatoes of the three materials decreased by Figure 4 As shown in C, the aboveground dry weight is as follows Figure 4 As shown in D, the aboveground biomass of tomatoes in the three materials decreased by more than Figure 4 As shown in E. The effect of salt stress on the growth and development of individual plants can be manifested in many aspects, among which the change in plant biomass is an intuitive reflection of the plant's tolerance to salt stress. It is also a direct indicator of plant tolerance, and to a certain extent can reflect the plant's growth status and ability to resist salt stress. The results showed that after the wild-type tomato plants were subjected to salt stress, the leaves turned yellow, and the aboveground fresh weight and biomass decreased significantly, with a decrease of 32.1% and 42.4%, respectively. The mutant myb52 plants had the worst tolerance to salt stress. After salt stress, the leaves at the base of the aboveground stems of the myb52 plants turned yellow severely and fell off and died (such as Figure 4 In addition, the myb52 mutant plants had the largest decrease in fresh weight and dry weight after salt stress, with a decrease of 51.5% and 62.8%, respectively. However, the MYB52-OE plants had the strongest tolerance to salt stress. Under salt stress, the leaves of the MYB52-OE plants remained bright green without yellowing. Moreover, the MYB52-OE plants had the smallest decrease in fresh weight and biomass after salt stress, with a decrease of 19% and 34.8%, respectively (as shown in Figure 2A). Figure 4 (shown in BE).

[0111] The statistical results of tomato plant height phenotype are as follows Figure 5 The statistical results of tomato plant height are shown in Figure 5 As shown in A, the height of tomatoes in the three materials decreased by more than Figure 5As shown in B. The study found that under normal growth conditions, the maximum plant height of the mutant myb52 plant was 25.1 cm, which was significantly higher than that of the WT and MYB52-OE plants, while the plant height of the plant overexpressing SlMYB52 was significantly reduced compared with the wild-type plant, only 12.3 cm. Crop salt tolerance can be identified with the help of indicators such as plant dry matter and plant height, among which plant height is one of the more sensitive indicators of salt stress. The study also found that under salt stress treatment, the plant height of the three plants of WT, MYB52-OE and myb52 was significantly reduced, but the plant height reduction ratio of MYB52-OE plants under salt stress was the lowest at 23.3%, and the plant height reduction ratio of myb52 mutant plants was the highest at 40.8%, which further proved that MYB52-OE plants have a strong tolerance to salt stress.

[0112] The actual shooting results of the underground growth of tomatoes are as follows Figure 6 As shown in A, the fresh weight of underground parts is as follows Figure 6 As shown in B, the fresh weight of tomato roots of the three materials decreased by Figure 6 As shown in C, the root dry weight measurement results are as follows Figure 6 As shown in D, the root biomass of tomatoes in the three materials decreased by more than Figure 6 As shown in E. Salt stress can significantly inhibit the growth of tomatoes, resulting in dwarf plants, yellowing leaves, and poor root development. Root changes are also one of the indicators to measure salt stress resistance. The study found that the root system of WT tomato plants was significantly inhibited under salt stress, the number of roots decreased, and the fresh weight and dry weight of the roots were significantly reduced. Compared with the control without salt stress, the decrease ratios were 34.8% and 32.5%, respectively. The mutant myb52 plants were most severely inhibited by salt stress, had the shortest and least roots, and the fresh weight and dry weight of the roots were most significantly reduced, with a decrease ratio of 49.9% and 41.4%, respectively. Under salt stress, the root system of MYB52-OE plants was the least inhibited, and the fresh weight and dry weight of the roots were the smallest, with a decrease ratio of 25.3% and 19.6%, respectively. It can be seen that the root system of MYB52-OE plants was the least affected by salt stress and had the strongest tolerance to salt stress.

[0113] Overall, MYB52-OE plants had the strongest tolerance to salt stress. Their leaves remained dark green without yellowing or falling off. Their roots were long and had many lateral roots. They were basically not inhibited. The percentage of decline in aboveground and root biomass was the lowest, and they were able to accumulate more biomass under salt stress.

[0114] The conductivity measurement results of tomato leaves are as follows Figure 7As shown. Under normal circumstances, plant cell membranes have the ability to selectively permeate substances. When plants are affected by stressful environments, the cell membranes are damaged, the membrane permeability increases, and electrolytes in the cells leak out, resulting in an increase in the conductivity of the cell extract. Therefore, the greater the relative conductivity, the greater the degree of damage to the plant tissue and the more serious the leakage of cellular molecular substances. The results showed that under normal circumstances, there was no significant difference in the leaf conductivity content of the three materials; however, the leaf conductivity content of the wild-type (WT) tomato plants increased significantly after suffering salt stress, which was 134.0% higher than that of the control without salt stress; the leaf conductivity content of the myb52 mutant plants increased sharply after suffering salt stress, which was 177.1% higher than that of the control without salt stress; however, the proportion of increase in leaf conductivity content of MYB52-OE plants suffering from salt stress was the lowest, which was 71.8%, and the leaf conductivity content of MYB52-OE plants under salt stress was significantly lower than that of the wild-type (WT) and myb52 mutant strains. It can be seen that overexpression of the MYB52 gene can significantly improve the salt tolerance of tomatoes.

[0115] In addition, the maximum photochemical efficiency of photosystem II (PS II) of tomato plants was measured as follows Figure 8 As shown. The maximum photochemical efficiency of PSⅡ Fv / Fm is the most basic parameter in chlorophyll fluorescence parameters. It reflects the potential maximum photosynthetic capacity of plants and is an effective indicator for measuring the degree of light inhibition. The Fv / Fm of plant leaves that have not been subjected to adverse stress and have undergone sufficient dark adaptation is generally constant between 0.70 and 0.85. After suffering from adverse stress, the Fv / Fm of plant leaves will show a significant downward trend. Fv / Fm is the best indicator for measuring adverse stress. The results showed that under normal conditions (no salt stress control group), there was no significant difference in Fv / Fm in leaves of WT, MYB52-OE and myb52 materials, all of which were around 0.81; while the Fv / Fm in leaves of wild-type tomato (WT) obtained under salt stress showed a significant downward trend, from 0.81 to 0.53; the Fv / Fm in leaves of myb52 mutant plants decreased most significantly under salt stress, from 0.81 to 0.26; however, the Fv / Fm in leaves of MYB52-OE plants decreased the least under salt stress, from 0.81 to 0.63; the maximum photochemical quantum yield (Fv / Fm) of PSII in leaves of MYB52-OE plants under salt stress was significantly higher than that of wild-type tomato (WT), while the Fv / Fm in leaves of myb52 mutant plants under salt stress was the lowest. It can be seen that MYB52-OE plants have the strongest tolerance to salt stress, and their light absorption capacity is closer to the normal level after suffering from salt stress.

[0116] Next, wild-type tomato seedlings (WT), the SlMYB52 gene overexpression line (MYB52-OE) obtained in Example 3, and the mutant line (myb52) were grown under the above-mentioned normal conditions (without salt stress treatment) for about 50 days (10-12 leaf stage), the lateral bud phenotype was observed and photographed, and the length and number of lateral buds were counted.

[0117] The actual shooting results of the growth of the aboveground lateral branches of tomatoes are as follows Fig. 9 As shown in A, the total length of the lateral buds is as follows Fig. 9 As shown in B, the number of lateral buds per plant is as follows Fig. 9 As shown in C. The results showed that the SlMYB52 gene was involved in regulating the number and length of tomato lateral buds. The number and length of lateral buds in MYB52-OE plants were significantly higher than those in WT plants and mutant myb52 plants. Mutant myb52 plants had the shortest and fewest lateral buds.

[0118] In summary, the SlMYB52 gene has important value in the field of modern tomato agriculture. For normal environmental breeding, tomato plants with the SlMYB52 gene knocked out have higher plant height and fewer side buds. There are many side branches in the tomato planting process, cumbersome pruning and high labor costs. Therefore, tomato plants with the SlMYB52 gene knocked out can reduce tomato pruning and promote light and simplified cultivation. In addition, MYB52-OE plants have the characteristics of dwarfing. At present, dwarfing is an important part of facility tomato cultivation. Appropriate dwarfing can increase light intensity, promote fruit growth and development, and increase yield. Therefore, using tomato plants that overexpress the SlMYB52 gene can promote tomato dwarfing and dense planting. Dwarfing and dense planting of tomatoes is a simple and easy cultivation method with high economic benefits. It has the advantages of early fruiting and high yield, is easy to manage mechanically, can reduce the production cost of tomatoes, improve land utilization rate, and improve economic benefits. Its yield can be increased by about 20%, and the harvest is concentrated. Due to early maturity and concentrated listing, the economic benefits are considerable, and it is very beneficial to the appropriate leisure and rotation of land. However, this cultivation technology has very high requirements for the selection of tomato varieties, and it is necessary to select strong resistance, early maturity and the characteristics of dwarf plant height suitable for dense planting. Therefore, the present invention first discovered that the SlMYB52 gene can regulate the plant height of tomatoes. The SlMYB52 gene provided by the present invention provides gene resources for cultivating new dwarf tomato varieties, and has good potential application value. In the field of modern agricultural industry, the cultivation of new dwarf tomato germplasm can not only promote the promotion and application of early spring dwarf dense planting cultivation technology, but also have important significance for early fruiting, concentrated listing, improving land utilization rate, reducing input, increasing yield, and promoting efficient cultivation of tomatoes. It can also be of great significance and wide application value for promoting the commercialization and modernization of tomato breeding process.

Claims

1. Application of overexpression of SlMYB52 gene in promoting dwarf cultivation of tomato; The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO:

1.

2. Use of biological materials related to overexpression of SlMYB52 gene in at least one of b1) to b2): b1) reduce the plant height of tomatoes; b2) preparing a product for reducing the plant height of tomatoes; The biological material related to overexpression of the SlMYB52 gene comprises at least one of c1) to c12): c1) a nucleic acid molecule that overexpresses the S1MYB52 protein; c2) an expression cassette containing the nucleic acid molecule described in c1); c3) a recombinant vector containing the nucleic acid molecule described in c1); c4) a recombinant vector containing the expression cassette described in c2); c5) a recombinant cell containing the nucleic acid molecule described in c1); c6) a recombinant cell containing the expression cassette described in c2); c7) a recombinant cell containing the recombinant vector described in c3); c8) a recombinant cell containing the recombinant vector described in c4); c9) a recombinant microorganism containing the nucleic acid molecule described in c1); c10) a recombinant microorganism containing the expression cassette described in c2); c11) a recombinant microorganism containing the recombinant vector described in c3); c12) a recombinant microorganism containing the recombinant vector described in c4); The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO:

1.

3. A method comprising: the step of increasing the expression level of SlMYB52 protein in tomatoes; The method is a method for reducing the plant height of tomatoes; The step of increasing the expression level and / or activity of the SlMYB52 protein in tomatoes is to introduce the nucleic acid molecule for overexpressing the SlMYB52 gene as described in claim 2 into tomato tissues or tomato cells; The SlMYB52 gene is numbered Solyc03g093890 in the tomato genome database https: / / solgenomics.net / , and the nucleotide sequence is shown in SEQ ID NO: 1.

Images