FaHSFB1 gene for promoting ripening and softening of strawberry fruits and application thereof
Patent Information
- Application Number
- CN202410700059.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-31
- Publication Date
- 2026-11-03
- Estimated Expiration
- 2044-05-31
AI Technical Summary
Existing technologies are insufficient to effectively slow down the softening process of strawberries and extend their shelf life without affecting their quality.
The strawberry transcription factor FaHSFB1 gene was cloned and expressed. The expression of the PL gene in strawberry fruit was regulated by constructing the pCAMBIA1302-FaHSFB1-GFP expression vector and using Agrobacterium tumefaciens GV3101 for transient expression.
It promotes the ripening and softening of strawberry fruits, shortens the ripening time, reduces fruit firmness, and increases anthocyanin content, providing genetic resources for molecular breeding.
Smart Images
Figure CN118581104B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular genetic engineering technology, and in particular to a transcription factor that promotes the ripening and softening of strawberry fruit and its application. Technical Background
[0002] The short shelf life of fresh strawberries is a major concern in production. The shelf life of strawberries is primarily determined by changes in fruit firmness during storage and transportation. These changes are mainly due to softening, which is attributed to the degradation of pectin, a cell wall substance, by cell wall enzymes. This degradation reduces cell wall rigidity, making it difficult to maintain the fruit's mechanical properties. The enzyme that directly degrades pectin is pectate lyase (PL, EC4.2.2.2). Inhibiting the expression of the corresponding gene for this enzyme can increase fruit firmness and slow down the softening process without affecting fruit quality (Jiménez-Bermúdez et al., 2002; Santiago-Doménech et al., 2008).
[0003] Transcription factors regulate the transcription initiation and transcription level of the PL gene by binding to its promoter. Zhang et al. (2022) demonstrated that the transcription factor FvWRKY48 binds to the W-box element of the FvPLA promoter, promoting FvPLA expression and reducing fruit firmness. Therefore, identifying transcription factors that positively regulate the PL gene, in order to utilize gene editing technology to lay the foundation for variety breeding and germplasm creation, is a technical problem that needs to be solved. Summary of the Invention
[0004] To address the problems in the prior art, one of the objectives of this invention is to provide a FaHSFB1 gene that promotes the ripening and softening of strawberry fruits. The nucleotide sequence of the FaHSFB1 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the FaHSFB1 gene is shown in SEQ ID NO.2.
[0005] The second objective of this invention is to provide an application of the aforementioned FaHSFB1 gene in promoting the ripening and softening of strawberry fruits.
[0006] A third objective of this invention is to provide an expression vector containing the FaHSFB1 gene as described above.
[0007] Preferably, the expression vector is the pCAMBIA1302-FaHSFB1-GFP expression vector; the pCAMBIA1302-FaHSFB1-GFP expression vector is obtained by using the cDNA of "Sweet Charlie" strawberry as a template to obtain the PCR product of the gene, and then ligating it into the pCAMBIA1302-GFP vector.
[0008] The fourth objective of this invention is to provide an application of the above-mentioned expression vector in promoting the ripening and softening of strawberry fruits.
[0009] The fifth objective of this invention is to provide a host cell containing the FaHSFB1 gene as described above, or containing the expression vector as described above.
[0010] Preferably, the host cell is Agrobacterium tumefaciens GV3101.
[0011] The sixth objective of this invention is to provide an application of the host cell described above in promoting the ripening and softening of strawberry fruit.
[0012] The beneficial effects of this invention are as follows:
[0013] 1) The present invention cloned the strawberry transcription factor FaHSFB1 gene. By transiently expressing it in strawberry fruit, the time from the beginning of ripening to full ripening of strawberry fruit can be shortened, the firmness of ripe strawberry fruit can be reduced, and the anthocyanin content can be increased. That is, the FaHSFB1 gene can promote the ripening and softening of strawberry fruit, and at the same time significantly increase the anthocyanin content in the fruit.
[0014] 2) This invention utilizes biochemistry, molecular biology, and transgenic technology to explore the molecular regulatory mechanism of FaHSFB1 gene in regulating strawberry fruit ripening and softening, providing new gene resources for molecular breeding to promote strawberry fruit ripeness and firmness. Attached Figure Description
[0015] Figure 1 This is a diagram showing the distribution of the FaHSFB1 combined elements on the FaPL1 promoter.
[0016] Figure 2 This is a PCR gel electrophoresis image of the FaHSFB1 gene clone in Example 1 of the present invention.
[0017] Figure 3 This is a map of the plant overexpression plasmid pCAMBIA1302-GFP used in Example 2 of this invention.
[0018] Figure 4 This is a plasmid map of TRV2 in the VIGS system of Embodiment 2 of the present invention.
[0019] Figure 5 This is a graph showing the expression level of FaHSFB1 in injected strawberry fruit in Example 3 of the present invention.
[0020] Figure 6 This is a graph showing the expression level of FaHSFB1 in injected strawberry fruit in Example 3 of the present invention.
[0021] Figure 7This is a comparison diagram of fruit phenotypes after injection in Example 3 of the present invention.
[0022] Figure 8 This is a comparison chart of fruit firmness in Example 3 of the present invention.
[0023] Figure 9 This is a graph showing the activity of pectin lyase in Example 3 of the present invention. Detailed Implementation
[0024] To facilitate understanding, the technical solution of the present invention will be described in more detail below with reference to embodiments:
[0025] Example 1
[0026] Cloning of the strawberry MYB transcription factor FaHSFB1 gene
[0027] A yeast one-hybrid system was constructed using the 137 bp pFaPL1 promoter, which exhibits differential promoter activity. The "bait" vector pFaPL1-pAbAi was then used to screen strawberry fruits at different developmental stages using cDNA libraries and compared against the strawberry genome database to identify the transcription factor FaHSFB1. Full-length primer pairs were designed based on its sequence.
[0028] FaHSFB1-F: GA AGATCT AATGGCGCAAAGGTCAGTTCCA;
[0029] FaHSFB1-R: CGG ACTAGT TTAGTTGCACACCTTCCCGC;
[0030] The underlined areas represent the enzyme cleavage sites, namely BglⅡ and SpeⅡ.
[0031] RNA was extracted from the fruit of the 'Sweet Charlie' strawberry during the ripening stage. The reverse transcribed cDNA was used as a template and amplified in a high-fidelity enzyme KOD-PLUS system. The amplification program was as follows: 95℃ for 5 min; 95℃ for 30 sec, 56℃ for 40 sec, 72℃ for 1 min, 35 cycles; 72℃ for 10 min. The FaHSFB1 gene fragment was obtained and ligated into the pMD19-T vector. The nucleotide sequence of the 'Sweet Charlie' FaHSFB1 gene was then determined by sequencing.
[0032] Figure 1 The diagram shows the distribution of the FaHSFB1 binding element on the FaPL1 promoter, where the diamonds represent the positions of the HSF binding element on the FaPL1 differential promoter.
[0033] Figure 2The image shows a PCR gel electrophoresis image of the FaHSFB1 gene clone. The open reading frame of the FaHSFB1 gene sequence is 873 bp in length. The nucleotide sequence of the FaHSFB1 gene is shown in SEQ ID NO.1. The FaHSFB1 gene encodes 291 amino acids, and the amino acid sequence is shown in SEQ ID NO.2.
[0034] Example 2
[0035] Construction of FaHSFB1 binary expression vector and VIGS vector
[0036] 1) Construction of FaHSFB1 binary expression vector: Using the FaHSFB1-pMD19-T plasmid DNA from Example 1, the DNA was double-digested with BglII and SpeI, and the digested gene fragment (873 bp) was recovered using a gel extraction kit. This fragment was fused into the pCMABIA1302 vector fragment, which had been double-digested (BglII and SpeI) and recovered, using T4 ligase to obtain the pCAMBIA1302-FaHSFB1-GFP expression vector; Figure 3 This is a plasmid map of the plant overexpression vector pCAMBIA1302-GFP carrying the GFP tag.
[0037] The ligation product was introduced into *E. coli* using a heat shock method and plated with LB + 50 mg / L solution. -1 Kanamycin. Positive clones were identified by PCR and sequenced to obtain positive single clones whose nucleotide sequences completely matched those in Example 1. The plasmid DNA of the positive single clone was extracted and transformed into Agrobacterium tumefaciens GV3101 to obtain Agrobacterium tumefaciens containing the recombinant vector 1302-FaPHL (positive single clone 1302-FaHSFB1).
[0038] 2) VIGS vector construction: Primer pairs were designed to amplify the PCR product at positions 337-561 bp, avoiding conserved regions (19-297 bp) of the FaHSFB1 gene sequence and located near the 5' end.
[0039] FaHSFB1-TRVF:CG TCTAGA GAAAAATCCGGCGGAGACAC;
[0040] FaHSFB1-TRVR:CG GGATCC TCAGAAACGCCACAAGCTCA; the underlined parts are the restriction enzyme sites XbaⅠ and BamHⅠ, respectively.
[0041] Using the FaHSFB1-pMD19-T plasmid DNA from Example 1 as a template, PCR amplification was performed using primer pairs FaHSFB1-TRVF and FaHSFB1-TRVR. The purified PCR product was ligated into the pMD18-T vector. Positive single clones matching the sequence of Example 1 were identified by PCR detection and sequencing. The plasmid DNA of this single clone was double-digested with enzymes (XbaⅠ and BamHI), and the recovered digested fragments were ligated into the TRV2 vector. After obtaining positive single clones matching the sequence of Example 1 by PCR detection and sequencing, the plasmid DNA of this clone was transformed into Agrobacterium tumefaciens GV3101 competent cells to obtain the positive single clone FaHSFB1-TRV2. Figure 4 This is a plasmid map of TRV2 in the VIGS system.
[0042] Example 3
[0043] Transient expression of the FaHSFB1 gene in strawberry fruit and its effect on strawberry ripening and softening.
[0044] Using single colonies of pCMABIA1302-FaHSFB1 and FaHSFB1-TRV2 from Example 2, single-celled bacteria were injected into strawberry fruits during the green-to-white stage using disposable syringes. This resulted in transient overexpression of FaHSFB1 in strawberry fruits (pCMABIA1302-FaHSFB1) and inhibition of its expression (FaHSFB1-TRV2). Overexpression phenotype observation involved injecting pCMABIA1302-FaHSFB1 and pCMABIA1302 (empty vector) onto opposite sides of the sun-facing side of the fruit, respectively. Inhibition phenotype observation involved injecting FaHSFB1-TRV2 and TRV1+TRV2 (empty vector control) onto opposite sides of the sun-facing side of the fruit, respectively. Fruits for firmness analysis were injected at the pedicel. Ten replicates were performed for each treatment, and four fruits with significantly upregulated or downregulated FaHSFB1 gene expression were selected for subsequent indicator analysis.
[0045] The specific steps are as follows:
[0046] 1) Agrobacterium tumefaciens carrying pCMABIA1302-FaHSFB1, pCMABIA1302, FaHSFB1-TRV2, and TRV1+TRV2 were respectively inoculated into a solution containing 50 mg·L⁻¹. -1 Kanamycin + 50 mg / L -1 In 20 mL of LB medium containing rifampicin, shaken at 28°C and 200 rpm until the OD600 is approximately 0.6-0.8.
[0047] 2) Centrifuge at 6000 rpm at room temperature for 3 minutes, discard the supernatant, and collect the colonies.
[0048] 3) Use the infiltration solution (1.0 mol·L⁻¹) -1 MES + 1.0 mol·L -1 MgCl2+ 1.0 mol·L -1 The colonies collected by resuspending acetylsuccinyl syringone are the injection solution.
[0049] 4) Inject the injection solution into the strawberry fruit during the green-white stage using a 1mL sterile syringe. For fruits used to determine firmness, the injection is performed at the fruit stalk, while for observing phenotypic changes, the syringe needle is inserted 0.5cm into the fruit from the surface.
[0050] 5) Samples were taken 3 days later for real-time quantitative analysis; fruit phenotypic changes were observed during the strawberry color change period within 7-15 days; after full ripening, firmness analysis was performed using a texture analyzer.
[0051] Experimental results:
[0052] See Figures 5-9 . Figure 5 To analyze the expression level of the FaHSFB1 gene in injected strawberry fruits using real-time quantitative PCR, the empty vector controls were pCMABIA1302 empty vector and TRV1+TRV2 infected fruits, respectively. 1302-FaHSFB1 represented fruits with transient FaHSFB1 overexpression, while FaHSFB1-TRV2 represented fruits with suppressed FaHSFB1 expression. In fruits with 1302-FaHSFB1 overexpression, the expression level of the FaHSFB1 gene was significantly increased, while in fruits with FaHSFB1-TRV2, the expression level of the FaHSFB1 gene was significantly downregulated.
[0053] Figure 6 This image shows the expression level of the FaHSFB1 gene in injected strawberry fruits for real-time quantitative PCR analysis.
[0054] In fruits overexpressing 1302-FaHSFB1, the expression level of the FaHSFB1 gene was significantly downregulated compared to fruits injected with the pCMABIA1302 empty vector, while in fruits with FaHSFB1-TRV2, the expression level of the FaHSFB1 gene was significantly upregulated.
[0055] Figure 7 The images show a comparison of fruit phenotypes after injection, taken on day 10. It can be seen that the fruit injected with 1302-FaHSFB1 turned red earlier than the fruit injected with the empty pCMABIA1302 vector, while the injection of FaHSFB1-TRV2 delayed fruit coloring.
[0056] Figure 8The fruit firmness comparison chart shows that the firmness of the 1302-FaHSFB1 fruit is lower than that of the fruit injected with the pCMABIA1302 empty vector, while the firmness of the FaHSFB1-TRV2 fruit is higher than that of the control TRV1+TRV2.
[0057] Figure 9 The graph shows the pectin lyase activity detection. It can be seen that the pectin lyase activity of 1302-FaHSFB1 fruit is higher than that of fruit injected with pCMABIA1302 empty vector, while the pectin lyase activity of FaHSFB1-TRV2 fruit is lower than that of the control TRV1+TRV2.
[0058] This indicates that the FaHSFB1 gene provided by this invention may act as a transcription factor that inhibits the transcription of the PL gene, and when overexpressed, it can promote the ripening and softening of strawberry fruits.
[0059] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Application of overexpression of FaHSFB1 gene in promoting ripening and softening of strawberry fruit, wherein the nucleotide sequence of FaHSFB1 gene is shown in SEQ ID NO.
1.
2. The application as described in claim 1, characterized in that, The amino acid sequence encoded by the FaHSFB1 gene is shown in SEQ ID NO.
2.
3. Application of the expression vector overexpressing the FaHSFB1 gene in promoting the ripening and softening of strawberry fruit, wherein the nucleotide sequence of the FaHSFB1 gene is shown in SEQ ID NO.
1.
4. The application as described in claim 3, characterized in that, The expression vector is pCAMBIA1302-FaHSFB1-GFP expression vector; the pCAMBIA1302-FaHSFB1-GFP expression vector is obtained by using cDNA of 'Sweet Charlie' strawberry as a template to obtain the PCR product of the gene and then ligating it into the pCAMBIA1302-GFP vector.
5. The application of a host cell in promoting the ripening and softening of strawberry fruit, wherein the host cell contains an overexpression vector of the FaHSFB1 gene, the nucleotide sequence of which is shown in SEQ ID NO.
1.
6. The application as described in claim 5, characterized in that, The host cell was Agrobacterium tumefaciens GV3101.