A siRNA targeting transcription factor ZNF25 and its application

Abstract

The present invention relates to a siRNA targeting transcription factor ZNF25 and its application, and to the field of biomedical technology. The present invention designs and synthesizes siRNA for inhibiting ZNF25 gene expression, and the siRNA is siZNF25-1 or siZNF25-2; wherein the sequence of the sense strand of siZNF25-1 is shown in SEQ ID NO.1, and the sequence of the antisense strand is shown in SEQ ID NO.2; or the sequence of the sense strand of siZNF25-2 is shown in SEQ ID NO.3, and the sequence of the antisense strand is shown in SEQ ID NO.4. By transfecting siRNA in liver cancer, colorectal cancer, and glioma cells, ZNF25 gene expression can be knocked down, and liver cancer, colorectal cancer, and glioma cell proliferation, growth and migration can be effectively inhibited. The present invention provides a new potential drug for the treatment of liver cancer, colorectal cancer, and glioma, and has a very high clinical practical application prospect and value.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to siRNA targeting transcription factor ZNF25 and application thereof. Background Art

[0002] Since the 1950s, research in oncology has made many breakthroughs: including the discovery and in-depth study of oncogenes, the discovery of the relationship between chromosomal aberrations and oncogene expression, and the regulation of tumor suppressor gene expression. So far, scientists have discovered hundreds of proto-oncogenes and many tumor suppressor genes, confirming that the molecular basis of cancer is the mutation of proto-oncogenes and the inactivation of tumor suppressor genes. Although research on tumor immunity has made significant progress in recent years, the treatment of solid tumors, which account for more than 90% of malignant tumors and are the most serious threat to life and health, has not yet been effectively solved. Therefore, it is imperative to explore the molecular mechanisms of tumor pathogenesis and study new molecular therapeutic targets, which will help to gain a deeper understanding of the pathogenesis of tumors and develop more effective molecular treatment strategies.

[0003] Transcription factors are an important component of gene regulation, mainly promoting or inhibiting gene transcription by recognizing transcription factor binding motifs located in gene enhancer and promoter regions. Transcription factors are closely related to various aspects of tumor cell growth, proliferation, apoptosis, infiltration, metastasis and angiogenesis due to their widespread existence and the diversity of target genes they regulate. With the in-depth study of transcription factors and their mechanisms of action, searching for drugs from different aspects for targeted treatment and prevention of tumor diseases related to transcription factor regulation for transcription factor activation and inhibition has become a new research hotspot today, and is expected to become an effective way to study the mechanism of action of new anti-tumor drugs. In view of the important role of transcription factors, discovering more tumor-related transcription factors is a technical problem that technicians in this field have to solve continuously.

[0004] Zinc finger proteins refer to a class of proteins that contain a stable "finger-like structure". The presence of zinc ions is the key to the regulatory role of zinc finger proteins: when zinc ions are lacking, the specificity of zinc finger proteins binding to DNA / RNA sequences will be significantly inhibited. At the same time, the structural stability of the protein itself will be destroyed, affecting gene expression. According to the different combinations of conservative amino acid residues Cys and His that bind to zinc ions, zinc finger proteins are divided into 8 folding groups, including C2H2-like zinc fingers, knot-like zinc fingers, treble clef zinc fingers, ribbon zinc fingers, Zn2Cys6 zinc fingers, TAZ2-like zinc fingers, zinc ion-binding short-ring zinc fingers and metallothionein zinc fingers; zinc finger structures can also be divided into 9 categories, including C2H2, RING, LIM, and C4, according to their different sequences and functions.

[0005] Among them, the C2H2 type is the most widely studied zinc finger protein, which interacts with nucleic acids in the form of monomers. It can be further divided into KRAB type, SCAN type, BTB / PO Z type, etc. according to its N-terminal domain. These functional domains control subcellular localization, DNA binding and gene expression by regulating the selective binding between TFs or with other cellular components.

[0006] ZNF25, also known as KOX19 or Zfp9, is a C2H2-type transcription factor and a member of the KRAB zinc finger protein family. It contains a KRAB domain at its N-terminus and 12 C2H2-type zinc finger structures at its C-terminus, and is mainly involved in gene transcription regulation. It has been reported that ZNF25 is associated with osteoblast differentiation of human skeletal stem cells. However, there is currently no literature report on the role of ZNF25 in tumor development and its use in the preparation of anti-tumor drugs. Summary of the invention

[0007] In order to solve the above technical problems, the purpose of the present invention is to provide a siRNA targeting transcription factor ZNF25 and its application.

[0008] The technical solution of the present invention to solve the above technical problems is as follows:

[0009] The first object of the present invention is to provide a siRNA targeting the transcription factor ZNF25, wherein the siRNA is siZNF25-1 or siZNF25-2;

[0010] The sequence of the sense strand of siZNF25-1 is shown in SEQ ID NO.1, and the sequence of the antisense strand is shown in SEQ ID NO.2;

[0011] Alternatively, the sequence of the sense strand of the siZNF25-2 is shown as SEQ ID NO.3, and the sequence of the antisense strand is shown as SEQ ID NO.4.

[0012] The beneficial effect of the present invention is that there is currently no report on the role of ZNF25 in the occurrence and development of tumors and its use in the preparation of anti-tumor drugs. The present invention synthesizes siRNA targeting ZNF 25, and proves that the siRNA can effectively regulate and interfere with ZNF25 gene expression in human liver cancer Huh7 cells, human colon cancer HCT116 cells, and human glioma U251 cells, thereby reducing the proliferation, cloning and migration abilities of human liver cancer Huh7 cells, human colon cancer HCT116 cells, and human glioma U251 cells, proving that the siRNA of the present invention can be used to prepare drugs for the treatment of tumor diseases, and has great application prospects.

[0013] The second object of the present invention is to provide an application of siRNA targeting transcription factor ZNF25, and to use the siRNA in the preparation of drugs for treating tumor diseases.

[0014] The beneficial effect of the present invention is that the present invention uses RT-qPCR experiment to detect that siZNF25-1 and siZNF25-2 can specifically knock down the expression of ZNF25 gene. Through CCK-8, clone formation and Transwell cell migration experiments, it is found that after transfecting human liver cancer Huh7 cells, human colon cancer HCT116 cells, and human glioma U251 cells with siZNF25-1 and siZNF25-2 designed and synthesized by the present invention, ZNF25 gene expression can be effectively regulated and interfered with, thereby reducing the proliferation, clone formation and migration ability of human liver cancer Huh7 cells, human colon cancer HCT116 cells, and human glioma U251 cells; therefore, the ZNF25 gene-targeted siZNF25-1 and siZNF25-2 have the function of knocking down the expression of ZNF25, effectively inhibiting the proliferation, growth and migration of liver cancer cells, colon cancer cells, and glioma cells. The present invention provides a new gene target and drug for the treatment of liver cancer, colon cancer, and glioma, and has a high clinical practical application value.

[0015] Furthermore, the siRNA treats tumor diseases by knocking down ZNF25 gene expression.

[0016] Furthermore, the active ingredient of the drug is siRNA.

[0017] Furthermore, the siRNA is at least one of siZNF25-1 and siZNF25-2.

[0018] Furthermore, the drug also includes a pharmaceutically acceptable carrier.

[0019] Furthermore, the vector is a transfection vector.

[0020] Furthermore, the tumor disease is a tumor disease associated with the expression and function of the transcription factor ZNF25.

[0021] Furthermore, the siRNA inhibits the proliferation, growth and migration of tumor cells by knocking down the expression of the ZNF25 gene, thereby treating tumor diseases.

[0022] Furthermore, the tumor disease includes at least one of liver cancer, colorectal cancer, and glioma. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the expression level of the ZNF25 gene according to Example 1 of the present invention;

[0024] Figure 2 This is a cell growth curve experimental diagram of Example 2 of the present invention;

[0025] Figure 3 This is a diagram of a cell cloning experiment in Example 2 of the present invention;

[0026] Figure 4 This is a diagram of a cell migration experiment in Example 2 of the present invention. DETAILED DESCRIPTION

[0027] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0028] Example 1: Detection of ZNF25 gene expression level

[0029] Experimental materials: Huh7 cells (purchased from the Chinese Academy of Sciences), HCT116 cells (purchased from the Chinese Academy of Sciences), U251 cells (purchased from Wuhan Pronocell Company), DMEM medium (purchased from Gibco); fetal bovine serum FBS (purchased from Sigma); penicillin-streptomycin double antibody (PS) (purchased from Gibco); Opti-MEM medium (purchased from Gibco); Lipofectamine TM RNAiMAX Transfection Reagent (purchased from Thermo Fisher Scientific); TRIzol reagent (purchased from Invitrogen); PrimeScript reverse transcription kit for quantitative PCR TM RT reagent Kit with gDNA Eraser (purchased from Takara); PowerSYBR TM Green PCR master mix (purchased from Thermo Fisher Scientific).

[0030] Experimental instruments: CO2 cell culture incubator (model Thermo3111; manufacturer Thermo Fisher Scientific); small refrigerated centrifuge (model 5424R; manufacturer Eppendorf); NanoDrop micro-spectrophotometer (model NanoDropLite Plus; manufacturer Thermo Fisher Scientific); fluorescence quantitative PCR instrument (model LightCycler96; manufacturer Roche).

[0031] (1) Design and synthesis of siRNA sequences

[0032] According to the bioinformatics method, the ZNF25 mRNA sequence (LOCUS NM_001329647) was obtained from Genebank, and the nucleotide sequence of the ZNF25 coding region SEQ ID NO.5 was selected, and the siRNA sequence was designed using the DSIR design website. The siRNA design principles proposed in the past were summarized, and the GC content, the free energy size at both ends, the requirements of siRNA for base preference, etc. were comprehensively analyzed. The evaluation of the designed siRNA series was further evaluated using the BLAST software provided by NCBI GenBank (compiled by the National Library of Medicine and the National Institutes of Health of the United States) to perform homology analysis on the selected target sequence to exclude the possibility that siRNA non-specifically inhibits other gene fragments. The target gene sequence selected by siZNF25-1 is GGAAATGCTTCTACCAGAAGT, and the target gene sequence selected by siZNF25-2 is GAAGCAAGATACCAGGAAAGC. In addition, the hanging base dTdT was designed at the end of the sequence to increase the stability of siRNA. The designed sequence was sent to Shanghai Shenggong Bioengineering Co., Ltd. for synthesis, and the negative control siCtrl was provided by the company.

[0033] The sense strand sequence of siCtrl is UUCUCCGAACGUGUCACGUTT, and the antisense strand sequence is ACGUGACACGUUCGGAGAATT. The sense strand sequence of siZNF25-1 is shown in SEQ ID NO.1, and the antisense strand sequence is shown in SEQ ID NO.2. The sense strand sequence of siZNF25-2 is shown in SEQ ID NO.3, and the antisense strand sequence is shown in SEQ ID NO.4.

[0034] (2) Cell transfection

[0035] a. Cell culture: Add 2 mL of DMEM medium containing 10% FBS and 1% penicillin-streptomycin double antibody to a 6-well cell culture plate, take Huh7, HCT116, and U251 cells in the logarithmic growth phase, and culture them at 1.5×10 6 pcs / hole, 2×10 6 pcs / hole, 1.5×10 6 The cells were seeded in a 6-well cell culture plate at a density of 100 cells / well. After mixing, the 6-well cell culture plate was placed in a cell culture incubator at 37°C and 5% CO2. The next day, when the cells reached a confluence of 60-80%, Huh7, HCT116, and U251 cells were transfected with siCtrl, siZNF25-1, and siZNF25-2, respectively.

[0036] b. Cell transfection: The transfection method of siCtrl, siZNF25-1, and siZNF25-2 was carried out according to the instruction manual of Lipofect amineRNAiMAX Transfection Reagent. The specific steps are as follows:

[0037] Dilute 7.5 μL with 125 μL Opti-MEM medium RNAiMAX transfection reagent, use 125μL Opti-MEM medium to dilute siCtrl, siZNF25-1, si ZNF25-2 (the final concentration of siCtrl, siZNF25-1, siZNF25-2 after adding to cells is 25nM), add the diluted siCtrl, siZNF25-1, siZNF25-2 to the diluted The mixture was mixed with RNAiMAX transfection reagent at a volume ratio of 1:1 and incubated at room temperature for 5 min to obtain siCtrl-liposome complex, siZNF25-1-liposome complex, and siZNF25-2-liposome complex;

[0038] c. Add 250 μL of siCtrl-liposome complex, siZNF25-1-liposome complex, and siZNF25-2-liposome complex to Huh7, HCT116, and U251 cells, respectively; mix well and culture in a cell culture incubator at 37°C and 5% CO2 for 48 hours, and the transfection is successful.

[0039] (3) RT-qPCR detection

[0040] 48 hours after Huh7, HCT116, and U251 cells were transfected with siCtrl, siZNF25-1, and siZNF25-2, RNA was extracted. Total RNA in cells was extracted using Trizol reagent. The specific extraction method is as follows:

[0041] a. Take out the cells cultured in the 6-well plate from the incubator, discard the culture medium, add 1 mL of TRI zol reagent to lyse the cells to obtain cell lysate, pipette and mix well, transfer the cell lysate to a centrifuge tube, add 200 μL of chloroform, shake and mix well for 20 seconds, let stand at room temperature for 5 minutes, and then centrifuge at 4°C and 12,000 rpm for 15 minutes;

[0042] b. Transfer 500 μL of the upper aqueous phase containing RNA to a new centrifuge tube, add 500 μL of isopropanol, shake and mix thoroughly, let stand at room temperature for 5 minutes, and centrifuge at 4°C, 12000 rpm for 10 minutes. After centrifugation, discard the supernatant, retain the RNA precipitate, add 1 mL of 75% ethanol to wash twice, centrifuge at 4°C, 12000 rpm for 2 minutes, discard the supernatant, air-dry the precipitate, and add 30 μL of enzyme-free water to dissolve the RNA;

[0043] c. Detect RNA concentration using NanoDrop micro-spectrophotometer. Take 1 μg RNA and use PrimeScript reverse transcription kit for quantitative PCR. TM RT reagent Kit with gDNA Eraser instructions for genome removal and reverse transcription synthesis of cDNA. The cDNA obtained by reverse transcription was diluted 10 times and referred to Power SYBR TM Green PCR premix operating instructions for qPCR analysis. The specific steps are as follows:

[0044] The PCR reaction system is:

[0045]

[0046] d. Each group of experiments was performed with 3 replicate wells, and the primer and template concentrations of the 3 replicate wells were exactly the same. After the sample addition, affix the transparent sealing film, centrifuge at low speed 2-3 times and then operate the machine. Set the quantitative PCR reaction program, and the amplification reaction parameters are: 95℃ pre-denaturation for 10min, 1 cycle; 95℃ denaturation for 15s, 60℃ annealing and extension for 1min, and a total of 40 cycles.

[0047] The primer sequences used were: ZNF25-F: 5'-TCACCTTGTCTCAGTGGGTTACC-3'; ZNF25-R: 5'-AATGCTCCATAGGTCTTCAGGG-3'. The sequences of the internal reference gene ACTB were: ACTB-F: 5'-GGCACCCAGCACAATGAAG-3, ACTB-R: 5'-TCCTGCTTGCTGATCCACAT-3'.

[0048] The relative expression was calculated according to the ΔΔCt algorithm, and the expression of the target gene relative to the internal reference gene was calculated as follows: RNA expression levels were normalized by ACTB mRNA, and relative expression levels were compared by setting the control to 1.

[0049] Relative expression level = 2 -ΔΔCt

[0050] Where ΔΔCt=(Ct目的基因 -Ct 内参基因 )Experimental group-(Ct 目的基因 -Ct 内参基因 ) Control group

[0051] The experiment was repeated three times, and the results are expressed as the mean ± SD of three independent experiments, with *p < 0.05; **p < 0.01; ***p < 0.001.

[0052] The results are as follows Figure 1 As shown:

[0053] Using ACTB as the internal reference gene, RT-qPCR experiments were performed to detect the knockdown effect of ZNF25. The results showed that two siRNAs targeting ZNF25 (siZNF25-1 and siZNF25-2) could significantly reduce the expression level of ZNF25 RNA in Huh7, HCT116, and U251 cells.

[0054] Example 2: Knockdown of ZNF25 gene expression inhibits proliferation, growth and migration of liver cancer, colorectal cancer and glioma cells

[0055] Experimental materials: siCtrl (sense chain sequence: UUCUCCGAACGUGUCACGUTT; antisense chain sequence: ACGUGACACGUUCGGAGAATT), siZNF25-1, and siZNF25-2 were synthesized by Shanghai Biotechnology Co., Ltd.; Huh7 cells (purchased from the Chinese Academy of Sciences); HCT116 cells (purchased from the Chinese Academy of Sciences); U251 cells (purchased from Wuhan Pronocell Company); DMEM medium (purchased from Gibco); fetal bovine serum FBS (purchased from Sigma); Opti-MEM medium (purchased from Gibco); (penicillin-streptomycin double antibody (PS) (purchased from Gibco); Lipofectamine TM RNAiMAX Transfection Reagent (purchased from Thermo Fisher Scientific); CCK8 detection kit (purchased from White Shark Biotechnology Co., Ltd.); 4% paraformaldehyde (purchased from Solebol); 1% crystal violet dye (purchased from Shanghai Bio-Technology Co., Ltd.); transwell chamber (8 μm) PC membrane (purchased from corning).

[0056] Experimental instruments: CO2 cell culture incubator (model Thermo3111; manufacturer Thermo Fisher Scientific); fully automatic cell counter (model CellDrop BF; manufacturer Denovix); continuous wavelength multifunctional microplate detector (model Spark; manufacturer TECAN); inverted fluorescence microscope (model CKX53; manufacturer OLYMPUS).

[0057] (1) Cell proliferation assay

[0058] a. Huh7, HCT116, and U251 cells were cultured using the cell culture method of Example 1;

[0059] b. Huh7, HCT116, and U251 cells were transfected with siCtrl, siZNF25-1, and siZNF25-2. The transfection method was the same as that in Example 1, except for the culture time: 250 μL of siRNA-liposome complex was added to Huh7, HCT116, and U251 cells, mixed, and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h;

[0060] c. Use 500 μL of trypsin to digest the above cells. After observing the cells becoming round under an inverted fluorescence microscope, add 2 mL of DMEM medium containing 10% FBS and 1% penicillin-streptomycin double antibody to terminate the digestion and count the cells;

[0061] d. Use DMEM medium containing 10% FBS and 1% penicillin-streptomycin to adjust the cell number of each group of Huh7, HCT116, and U251 to 3.5×10 4 / mL, 4×10 4 / mL, 3×10 4 / mL, and then inoculate 100μL into 96-well plates, with 3 replicates per group. The cell viability on days 1, 2, 3, 4, and 5 was detected by CCK-8 kit;

[0062] During the detection, 10 μL of CCK-8 reagent was added to each well, and the cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 1 hour. The absorbance (OD) at 450 nm was measured by a continuous wavelength multifunctional microplate detector. The blank culture medium reading was deducted from the measured value as a background signal, and the absorbance value of siCtrl cells on the first day was used for normalization. The growth changes of Huh7, HCT116, and U251 cells were calculated. The experiment was repeated three times, and the results were expressed as the mean ± standard deviation of three independent experiments, where *p<0.05; **p<0.01; ***p<0.001.

[0063] The results are as follows Figure 2 As shown:

[0064] After knocking down ZNF25, the proliferation ability of Huh7, HCT116, and U251 cells was weakened, indicating that siZN F25-1 and siZNF25-2 downregulated ZNF25 and inhibited the proliferation of Huh7, HCT116, and U251 cells.

[0065] (2) Clone formation experiment

[0066] a. Huh7, HCT116, and U251 cells were cultured using the cell culture method of Example 1;

[0067] b. Huh7, HCT116, and U251 cells were transfected with siCtrl, siZNF25-1, and siZNF25-2, and the transfection method was the same as that of Example (1);

[0068] c. Add 500 μL of trypsin to digest the cells. After observing the cells becoming round under an inverted fluorescence microscope, add 2 mL of DMEM medium containing 10% FBS and 1% penicillin-streptomycin to terminate the digestion and count the cells.

[0069] d. Add 2 mL of DM EM medium containing 10% FBS and 1% penicillin-streptomycin double antibody to the 6-well plate. The transfected Huh7, HCT116, and U251 cells in each group were evenly planted in the 6-well cell culture plate at a density of 800, 500, and 800 cells / well, respectively. Fresh medium was replaced every 3 days. After 15 days of cell culture, 1 mL of 4% paraformaldehyde was added and fixed at room temperature for 10 minutes. Add 2 mL of PBS to wash twice, discard PBS, stain with 1% crystal violet for 5 minutes, discard the staining solution, and finally wash 2-3 times with PBS buffer until the background is colorless, discard PBS, dry at room temperature, take pictures, and perform statistical analysis on the number of clones formed.

[0070] The experiment was repeated three times, and the results are expressed as the mean ± SD of three independent experiments, with *p < 0.05; **p < 0.01; ***p < 0.001.

[0071] The results are as follows Figure 3 As shown:

[0072] After knocking down ZNF25, the clone-forming ability of Huh7, HCT116, and U251 cells was significantly reduced, indicating that downregulation of ZNF25 by siZNF25-1 and siZNF25-2 inhibited the continuous growth of Huh7, HCT116, and U251 cells.

[0073] (3) Transwell cell migration assay

[0074] a. Huh7, HCT116, and U251 cells were cultured using the cell culture method of Example 1, and the cell culture method was the same as that of Example 1;

[0075] b. Huh7, HCT116, and U251 cells were transfected with siCtrl, siZNF25-1, and siZNF25-2, and the transfection method was the same as that of Example (1);

[0076] c. Add 500 μL of trypsin to digest the cells. After observing the cells becoming round under an inverted fluorescence microscope, add 2 mL of DMEM medium containing 10% FBS and 1% penicillin-streptomycin to terminate the digestion and count the cells.

[0077] d. Use DMEM medium containing 1% FBS to adjust the density of Huh7, HCT116, and U251 cells to 2×10 5 / mL, add 800μL of DMEM medium containing 20% ​​FBS to the lower chamber of the 24-well plate, take 100μL of Huh7, HCT116, and U251 cell suspensions from each group and add them to the Transwell chamber. Remove the bubbles, then put the chambers into the culture plate and culture them in a 37℃, 5% CO2 cell culture incubator for 48h;

[0078] e. Take out the Transwell chamber, discard the culture medium in the well, and wash twice with 1×PBS. Add 4% paraformaldehyde to cover the cell surface and fix at room temperature for 10 minutes. Discard the fixative, wash twice with PBS, discard PBS, add 1% crystal violet to stain for 10 minutes, wash 2-3 times with PBS, and gently wipe off the upper layer of non-migrated cells with a cotton swab.

[0079] An inverted fluorescence microscope was used to photograph and count the cells that migrated to the lower layer of the microporous membrane. Five fields of view were selected for each sample to take photos and calculate the number of migrated cells.

[0080] The experiment was repeated three times, and the results are expressed as the mean ± SD of three independent experiments, with *p < 0.05; **p < 0.01; ***p < 0.001.

[0081] The results are as follows Figure 4 As shown:

[0082] After knocking down ZNF25 by siZNF25-1 and siZNF25-2, the number of migrating Huh7, HCT116, and U251 cells was significantly reduced, indicating that downregulation of ZNF25 by siZNF25-1 and siZNF25-2 inhibited the migration of Huh7, HCT116, and U251 cells.

[0083] In summary, the siZNF25-1 and siZNF25-2 designed and synthesized by the present invention can effectively regulate and interfere with the expression of the ZNF25 gene after transfection of human liver cancer Huh7 cells, human colon cancer HCT116 cells, and human glioma U251 cells, thereby reducing the proliferation, cloning, and migration formation abilities of human liver cancer Huh7 cells, human colon cancer HCT116 cells, and human glioma U251 cells; therefore, the ZNF25 gene-targeted siZNF25-1 and siZNF25-2 have the function of knocking down the expression of ZNF25, and effectively inhibiting the proliferation, growth, and migration of liver cancer cells, colon cancer cells, and glioma cells.

[0084] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. An application of siRNA targeting transcription factor ZNF25, characterized in that: Using the siRNA in the preparation of a drug for treating tumor diseases; The tumor disease is at least one of liver cancer, colorectal cancer, and glioma; The siRNA is siZNF25-1 or siZNF25-2; The sequence of the sense strand of siZNF25-1 is shown in SEQ ID NO.1, and the sequence of the antisense strand is shown in SEQ ID NO.2; Or the sequence of the sense strand of the siZNF25-2 is shown in SEQ ID NO.3, and the sequence of the antisense strand is shown in SEQ ID NO.4; The tumor disease is a tumor disease related to the expression and function of transcription factor ZNF25.

2. The use of a siRNA targeting transcription factor ZNF25 according to claim 1, characterized in that: The siRNA treats tumor diseases by knocking down the expression of ZNF25 gene.

3. The use of a siRNA targeting transcription factor ZNF25 according to claim 2, characterized in that: The active ingredient of the drug is siRNA.

4. The use of a siRNA targeting transcription factor ZNF25 according to claim 3, characterized in that: The medicament further includes a pharmaceutically acceptable carrier.

5. The use of a siRNA targeting transcription factor ZNF25 according to claim 4, characterized in that: The vector is a transfection vector.

6. The use of a siRNA targeting transcription factor ZNF25 according to claim 1, characterized in that: The siRNA inhibits the proliferation, growth and migration of tumor cells by knocking down the expression of the ZNF25 gene, thereby treating tumor diseases.

Images