Use of chchd2 in the preparation of a product for promoting proliferation and differentiation of neural stem cells

By regulating the expression of the CHCHD2 gene and its protein, the problem of insufficient proliferation and differentiation capacity of neural stem cells was solved, achieving efficient proliferation and differentiation of neural stem cells, providing new treatment options and bioactive factors, and promoting the repair of central nervous system diseases.

CN118599984BActive Publication Date: 2025-12-09THE FIRST AFFILIATED HOSPITAL OF JINAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410486591.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-22
Publication Date
2025-12-09
Estimated Expiration
2044-04-22

AI Technical Summary

Technical Problem

In current technologies, the proliferation and differentiation capacity of neural stem cells is limited, and there is a lack of effective regulation methods, which affects the therapeutic effects on neurodevelopmental diseases, neurodegenerative diseases, and the repair of damage to the central nervous system.

Method used

By regulating the expression of the CHCHD2 gene and its encoded protein in neural stem cells, and using overexpression or knockdown methods, mouse and human neural stem cell models were used to verify the role of the CHCHD2 gene and its protein in promoting the proliferation and differentiation of neural stem cells.

Benefits of technology

It significantly improved the proliferation and differentiation capacity of neural stem cells, providing new bioactive factors and therapeutic targets for the treatment of developmental defects of the central nervous system, neurodegenerative diseases, cerebrovascular diseases, and craniocerebral and spinal cord injuries, and promoted neural repair.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118599984B_ABST
    Figure CN118599984B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biomedical science and neurology, and particularly relates to application of CHCHD2 gene and a protein coded by the CHCHD2 gene in preparation of a product for promoting proliferation and differentiation of neural stem cells. The application proves that the CHCHD2 gene and the protein coded by the CHCHD2 gene are highly expressed in in-vivo neural development and in-vitro neural differentiation process; and that knocking down or over-expressing the CHCHD2 gene or the protein coded by the CHCHD2 gene has a certain regulating effect on proliferation and differentiation of neural stem cells. The application provides a new scheme for preparation of a product for promoting proliferation and differentiation of neural stem cells, and provides a new target for drug research and development of neural regeneration and repair treatment of central nervous system development deficiency diseases, neurodegenerative diseases, cerebrovascular diseases, craniocerebral and spinal cord injuries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and neuroscience, specifically involving the application of the CHCHD2 gene and its encoded protein in the preparation of products that promote the proliferation and differentiation of neural stem cells. Background Technology

[0002] Neural stem cells are a type of progenitor cell in the nervous system with self-renewal capacity and proliferative potential. They can proliferate on their own and differentiate into specific neurons or glial cells under different environments, integrating into the nervous system. Current research has identified several neurogenic regions in the mammalian and adult brain, such as the subependymal region of the lateral ventricle and the subgranular region of the dentate gyrus of the hippocampus. However, neural stem cells in these regions are mostly in a quiescent state, with very limited proliferative and differentiation capabilities. Therefore, finding products that can regulate the proliferation and differentiation of neural stem cells is of great significance in treating neurodevelopmental diseases, neurodegenerative diseases, promoting the repair of central nervous system damage, and exploring the mechanisms of brain tumor formation.

[0003] The CHCHD2 (coiled-coil-helix-coiled-coil-helix domain 2) gene is closely related to neurological diseases, such as being a pathogenic gene for Parkinson's disease; interacting with the HTT gene, a pathogenic gene for Huntington's disease; and exhibiting multiple mutation forms in diseases like Lewy body dementia. Current research on the functions of the CHCHD2 gene mainly focuses on the following aspects: 1. Maintaining mitochondrial structure and metabolism. 2. Inhibiting apoptosis. 3. Antioxidant stress effects. However, the effects of CHCHD2 on the proliferation and differentiation of neural stem cells have not yet been reported.

[0004] We discovered that the expression of the CHCHD2 gene is increased during neural stem cell differentiation, and that specific intervention in the expression of this gene can affect the proliferation and differentiation of neural stem cells. Therefore, it is necessary to provide a new target for regulating the proliferation and differentiation of neural stem cells. Summary of the Invention

[0005] To overcome the shortcomings and disadvantages of existing technologies, the primary objective of this invention is to apply the regulation of the CHCHD2 gene and its encoded protein in the preparation of products that promote the proliferation and differentiation of neural stem cells.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] Application of the CHCHD2 gene and its encoded protein in the preparation of products that promote the proliferation and differentiation of neural stem cells.

[0008] The CHCHD2 gene mentioned is either mouse-derived CHCHD2 or human-derived CHCHD2;

[0009] The nucleotide sequence of the mouse-derived CHCHD2 is as shown in SEQ ID NO:1

[0010] The nucleotide sequence of the human CHCHD2 is as follows: SEQ ID NO:2 or SEQ ID NO:3.

[0011] The application of the CHCHD2 gene and its encoded protein in the preparation of products that promote the large-scale in vitro expansion of neural stem cells and neural differentiation.

[0012] The application of the CHCHD2 gene and its encoded protein in the preparation of bioactive products that promote the survival of in vitro neural stem cells during in vivo transplantation.

[0013] The application of the CHCHD2 gene and its encoded protein in the preparation of products for the prevention and treatment of developmental defects of the central nervous system.

[0014] The application of the CHCHD2 gene and its encoded protein in the preparation of products for treating neurodegenerative diseases.

[0015] The application of the .CHCHD2 gene and its encoded protein in the preparation of neuroprotective or neurorepair products for acute cerebrovascular disease or sequelae of cerebrovascular disease.

[0016] Application of the CHCHD2 gene and its encoded protein in the preparation of products that promote nerve repair after traumatic brain injury and spinal cord injury.

[0017] SEQ ID NO:1:

[0018] AACTTCGTAACTTCCGGGCCTAGGACGCTGAGTCCAGGCTCTGCCCATTACTGAT

[0019] ATCTCCTTTGTCCAATAACCTTTAGCGCCCGAGCTTTTCCTGATTTCTTATTGGT

[0020] TGCCCGGTGAGGTACCGCCTCCACCCTTCCTCTCCTTGGTAGAAATTGCTGGA

[0021] CGCTTCTGTACGTTTCGCAGTTTGTCTTCGCTGATCGGTGAGACTTCGAGCAGTT

[0022] AGGATGCCCGTGGAAGCCGAAGCCGCACTTCCCGGGTGACTCCTCCGGCCAGCC

[0023] GGGCCCCTCAGATGAGGGCTGCTCCCCGAAGAGCACCTGCAGCTCAGCCTCCAGC

[0024] AGCAGCTGCGCCATCTGCAGTTGGCTCACCTGCCGCTGCGCCCCGGCAGCCAGGC

[0025] CTGATGGCCCAGATGGCTACCACCGCGGCCGGTGTGGCTGTGGGCTCTGCAGTGGG

[0026] GACACACCCTGGGTCACGCCATCACTGGGGCTTCAGCGGAGGTGGCAGTGCTGA

[0027] GCCCGCAAAGCCCGACATCACTTACCAGGAGCCTCAGGGAGCCCAGCTGCAGAAC

[0028] CAGCAGTCTTTTGGACCTTGCTCTCTAGAGATCAAGCAGTTTCTGGAGTGTGCTC

[0029] AGAACCAGAGCGATGTCCAAGCTCTGTGAGGGCTTCAACGAGGTGCTGCGGCAGTG

[0030] CAGGATTGCAAATGGTTTAATGTAATCAAGAAATTCAAGCTGAAGAGATGTAACA

[0031] TTGGTTCTGTATAATTGATAGTACAAGTGTGGACCCTTATATTCTTAACAGTTCA

[0032] TTGCTTTGGAATGGCGTGAAAGAGATCTAACTGTGGATGCTTACTGAGGCTTGT

[0033] ATGTAGTGTTGGTTACTGGGGAAGTGTTTGGCCTCCTTGGACTGTGTTGTGATTGTGAGTTAAAAAAAATAAATTGGTTATTCTG;

[0034] SEQ ID NO:2

[0035] AGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCT

[0036] TACCTAGGATGCCGCGTGGAAGCCGAAGCCGCACCTCCCGCATGGCCCCTCCGGC

[0037] CAGCCGGGCCCCTCAGATGAGAGCTGCACCCAGGCCAGCACCAGTCGCTCAGCCA

[0038] CCAGCAGCGGCACCCCCATCTGCAGTTGGCTCTTCTGCTGCTGCGCCCCGGCAGC

[0039] CAGGTCTGATGGCCCAGATGGCAACCACTGCAGCTGGCGTGGCTGTGGGCTCTGC

[0040] TGTGGGGCACACATTGGGTCACGCCATTACTGGGGGCTTCAGTGGAGGAAGTAAT

[0041] GCTGAGCCTGCGAGGCCTGACATCACTTACCAGGAGCCTCAGGGAACCCAGCCAG

[0042] CACAGCAGCAGCAGCCTTGCCTCTATGAGATCAAACAGTTTCTGGAGTGTGCCCA

[0043] GAACCAGGGTGACATCAAGCTCTGTGAGGGTTTCAATGAGGTGCTGAAACAGTGC

[0044] CGACTTGCAAACGGTAGGATTGGCCTAATGAAGAAGTTCAACCTGGAGAGATGGA

[0045] AAATCAGCTCTCATAACTAAGTTAATTTAGTATAAAAATAGAATTGATAGTGAGG

[0046] GTATAAAGTGTAACCATCAGTTAAACCTCTCCTGTCATTCCTGGCTTCCTTGCTT

[0047] CAGAATTGAAATGGAAGTGGGGGTGTCCCTACTCTGTAGAATCTGGGACTGGGCA

[0048] AATGTTTGTGTGGCCTCCTTAAACTAGCTGTTATGTTATGATTTTATTCTTTGTGAGTTAATTAGAATAAAGTCATTTTCTTCCAA;

[0049] SEQ ID NO:3

[0050] AGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCT

[0051] TACCTAGGATGCCGCGTGGAAGCCGAAGCCGCACCTCCCGCATGGCCCCTCCGGC

[0052] CAGCCGGGCCCCTCAGATGAGAGCTGCACCCAGGCCAGCACCAGTCGCTCAGCCA

[0053] CCAGCAGCGGCACCCCCATCTGCAGTTGGCTCTTCTGCTGCTGCGCCCCGGCAGC

[0054] CAGGTCTGATGGCCCAGATGGCAACCACTGCAGCTGGCGTGGCTGTGGGCTCTGC

[0055] TGTGGGGCACACATTGGGTCACGCCATTACTGGGGGCTTCAGTGGAGGAAGTAAT

[0056] GCTGAGCCTGCGAGGCCTGACATCACTTACCAGGAGCCTCAGGGAACCCAGCCAG

[0057] CACAGCAGCAGCAGCCTTGCCTCTATGAGATCAAACAGTTTCTGGAGTGTGCCCA

[0058] GAACCAGGGTGACATCAAGCTCTGTGAGGGTTTCAATGAGGTGCTGAAACAGTGC

[0059] CGACTTGCAAACGGATTGGCCTAATGAAGAAGTTCAACCTGGAGAGATGGAAAT

[0060] CAGCTCTCATAACTAAGTTAATTTAGTATAAAAATAGAATTGATAGTGAGGGTAT

[0061] AAAGTGTAACCATCAGTTAAACCTCTCCTGTCATTCCTGGCTTCCTTGCTTCAGA

[0062] ATTGAAATGGAAGTGGGGGTGTCCCTACTCTGTAGAATCTGGGACTGGGCAAATG

[0063] TTTGTGTGGCCTCCTTAAACTAGCTGTTATGTTATGATTTTATTCTTTGTGAGTTAATTAGAATAAAGTCATTTTCTTCCAA;

[0064] The principle of this invention

[0065] (1) This invention uses qRT-PCR and Western Blot experimental techniques to analyze the expression level of the CHCHD2 gene and its encoded protein during in vitro differentiation of mouse and human neural stem cells and embryonic neural development.

[0066] (2) This invention regulates the expression of CHCHD2 in mouse neural stem cells or human neural stem cells by overexpression or knockdown, and explores the effects of this gene and its encoded protein on the proliferation and differentiation of neural stem cells.

[0067] This invention mainly elucidates the correlation between the CHCHD2 gene and its encoded protein and the proliferation and differentiation capacity of neural stem cells, as well as its application in neuroprotection and repair of neural development, neurodegenerative diseases, cerebrovascular diseases, and craniocerebral and spinal cord injuries.

[0068] The present invention has the following advantages and effects compared with the prior art:

[0069] (1) The present invention found that the CHCHD2 gene and its encoded protein are both expressed at elevated levels during the in vitro neural differentiation of neural stem cells and during the neural development of fetal rats, indicating that the CHCHD2 gene and its encoded protein can serve as biomarkers for the proliferation and differentiation capacity of neural stem cells.

[0070] (2) This invention confirms that overexpression of CHCHD2 increases the proliferation and differentiation capacity of neural stem cells, while knockdown of CHCHD2 decreases both the proliferation and differentiation capacity of neural stem cells. These results indicate that the CHCHD2 gene and its encoded protein have the ability to regulate the proliferation and differentiation of neural stem cells, providing new bioactive factors or biological agents for the preparation of products promoting neural stem cell proliferation and differentiation, offering new solutions for the prevention and treatment of developmental defects of the central nervous system, and providing new targets for the development of drugs for the regeneration and repair of neurodegenerative diseases, cerebrovascular diseases, and craniocerebral and spinal cord injuries. Attached Figure Description

[0071] Figure 1 This is a diagram showing the phenotypic identification results of neural stem cells and their differentiation into neural cells. A: Immunofluorescence staining identifies murine neural stem cells (Nestin / Sox2) differentiating into neurons (TUJ1), astrocytes (GFAP), and oligodendrocytes (O4), with a scale bar of 50 μm. B: Immunofluorescence staining identifies human pluripotent induced cellular stem cells (OCT4) differentiating into human neural stem cells (Nestin / Pax6), with a scale bar of 200 μm; subsequently differentiating into neurons (MAP2), with a scale bar of 200 μm.

[0072] Figure 2 This figure shows the results of the expression level analysis of the CHCHD2 gene and its encoded protein during the in vitro neural differentiation of neural stem cells and the neural development of fetal mice. A: Western blotting analysis of the protein expression levels and quantification of CHCHD2 and TUJ1 in the cerebral cortex of fetal mice at E10.5, E12.5, and Day 1; B: qRT-PCR analysis of the expression levels of CHCHD2, TUJ1 (neuronal marker), and GFAP (astrocytocyte marker) at days 0, 3, and 5 (d, 3, and 5) of mouse-derived neural stem cell in vitro differentiation; mean ± SEM, *p<0.05, **p<0.01, ***p<0.05. C: qRT-PCR detection of the expression levels of TUJ1, GFAP, and CNPase during the induction of hiPSC neural differentiation; D: qRT-PCR detection of the expression level of CHCHD2 in human pluripotent induced stem cells, human neural stem cells, and human neurons; n = 3, mean ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001;

[0073] Figure 3This is a graph showing the results of detecting CHCHD2 expression levels; where A: Western Blot analysis of CHCHD2 protein expression levels and quantification in murine neural stem cells in the CHCHD2 overexpression group, n=4; B: qRT-PCR analysis of CHCHD2 expression levels in murine neural stem cells in the CHCHD2 overexpression group, n=3; C: Western Blot analysis of CHCHD2 protein expression levels and quantification in murine neural stem cells in the CHCHD2 knockdown group, n=6; D: qRT-PCR analysis of CHCHD2 expression levels in murine neural stem cells in the CHCHD2 knockdown group, n=5; E: qRT-PCR analysis of CHCHD2 expression levels in human neural stem cells after CHCHD2 overexpression, n=6; mean±SEM, *p<0.05, ****p<0.0001;

[0074] Figure 4 This is a graph showing the results of detecting the effect of CHCHD2 expression regulation on the proliferation capacity of neural stem cells; A: qRT-PCR detection of the effect of CHCHD2 overexpression on the in vitro proliferation of murine neural stem cells, n=3; B: Immunofluorescence staining technique detection of the expression of the cell proliferation marker (Ki67) during CHCHD2 overexpression; C: Image J: Statistical analysis of the mean fluorescence intensity of CHCHD2 and the relative number of Ki67-positive cells in immunofluorescence staining, n=18; mean±SEM, **p<0.01, ***p<0.001, ****p<0.0001, scale bar 20μm; D: qRT-PCR detection of Ki67 expression in murine neural stem cells after CHCHD2 knockdown, n=4; EF: Statistical analysis of the mean fluorescence intensity of CHCHD2 and the relative number of Ki67-positive cells in murine neural stem cells after CHCHD2 knockdown, n=18; mean±SEM, **p<0.01, ***p<0.001, scale bar 50μm;

[0075] Figure 5This is a graph analyzing the effect of CHCHD2 overexpression on the in vitro differentiation ability of murine neural stem cells. A: qRT-PCR detection showed that CHCHD2 overexpression promoted the expression of NeuroD1 (neuronal marker), GFAP (astrocytocyte marker), and CNPase (oligodendrocyte marker) during in vitro differentiation of murine neural stem cells (n=3); B: Western blotting showed that CHCHD2 overexpression promoted the increase of TUJ1 expression during in vitro differentiation of murine neural stem cells (n=5); C: Immunofluorescence staining detected that CHCHD2 overexpression promoted the differentiation of murine neural stem cells into neurons (n=18); D: Quantitative statistical results from immunofluorescence staining; mean±SEM, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, scale bar 50μm.

[0076] Figure 6 This is a graph analyzing the effect of CHCHD2 knockdown on the in vitro differentiation capacity of murine neural stem cells. A: Immunofluorescence staining was used to detect the change in the number of murine neural stem cells differentiating into TUJ1-positive cells after CHCHD2 knockdown. B: qRT-PCR was used to detect the expression levels of NeuroD1, TUJ1, GFAP, and CNPase after CHCHD2 knockdown during the in vitro differentiation of murine neural stem cells. n=3; mean±SEM, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, scale bar is 50μm.

[0077] Figure 7 This is an analysis of the results of detecting the ability of human neural stem cells to differentiate into neurons in vitro after overexpression of CHCHD2. The results show the changes in the ability of human neural stem cells to differentiate into neurons in vitro after overexpression of CHCHD2 by qRT-PCR. n=3, mean±SEM, *p<0.05, **p<0.01, ***p<0.001. Detailed Implementation

[0078] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Figure 1-7As shown, the specific steps for the application of CHCHD2 in the preparation of products promoting the proliferation and differentiation of neural stem cells are as follows: Step 1: Identify murine neural stem cells, human neural stem cells, and their derived neurons and glial cells using immunofluorescence technology. Step 2: Detect the expression levels of the CHCHD2 gene and its encoded protein at different developmental stages in fetal mice and during the in vitro differentiation of murine and human neural stem cells using Western blotting and qRT-PCR. Step 3: Construct mouse neural stem cell lines overexpressing and knocking down CHCHD2, and overexpressing human neural stem cell lines using lentiviruses, and verify successful construction using Western blotting and qRT-PCR. Step 4: Verify using qRT-PCR and immunofluorescence that high expression of CHCHD2 promotes the proliferation of mouse neural stem cells, while low expression of CHCHD2 inhibits their proliferation. Step 5: Verify using qRT-PCR, Western blotting, and immunofluorescence that high expression of CHCHD2 promotes the differentiation of mouse neural stem cells. Step 6: Verify using qRT-PCR and immunofluorescence that low expression of CHCHD2 inhibits the differentiation of mouse neural stem cells. Step 7: Verify using qRT-PCR that high expression of CHCHD2 promotes the differentiation of human neural stem cells.

[0079] The specific implementation steps of step one of this invention are as follows:

[0080] 1. Prepare the culture medium for the proliferation and differentiation of neural stem cells. The formula is as follows:

[0081] Table 1. Culture medium for the proliferation of mouse-derived neural stem cells

[0082]

[0083]

[0084] Table 2. Differentiation culture medium for mouse-derived neural stem cells

[0085]

[0086] Table 3. Culture medium for the proliferation of human neural stem cells

[0087]

[0088]

[0089] Table 4. Culture medium for differentiation of human neural stem cells

[0090]

[0091] 2. Isolation and culture of murine neural stem cells:

[0092] Sample collection: ICR pregnant mice at 12.5 days of gestation were selected, and their necks were severed after anesthesia;

[0093] Isolation of the cerebral cortex: Disinfect the abdominal skin of the pregnant mouse, separate the peritoneum layer by layer, remove the embryo and place it in DMEM / F12 basal culture medium with 2% concentration of penicillin and cytotoxic anti-inflammatory drugs. Under a microscope, use forceps to peel off the fetal mouse cerebral cortex layer by layer and remove the vascular membrane attached to its surface.

[0094] Preparation of single-cell suspension: A block of cerebral cortex tissue was repeatedly and gently pipetted. Appropriate amounts of DNase and trypsin were added, and the mixture was digested in a 37°C cell culture incubator for 10 minutes. An equal volume of DMEM / F12 medium was added to reduce the digestive capacity of the trypsin. The mixture was then filtered through a 70μm cell sieve to obtain a single-cell suspension, which was centrifuged at 1000 rpm for 5 minutes at room temperature to obtain a cell pellet.

[0095] Culture of mouse neural stem cells: Resuspend the cells in the prepared mouse neural stem cell proliferation medium to obtain a cell suspension, and seed the cells into 10cm cell culture dishes and culture them in a 37°C, 5% CO2 cell culture incubator.

[0096] 3. Induction and Acquisition of Human Neural Stem Cells

[0097] Human neural stem cell resuscitation: Human neural stem cells induced to differentiate by hiPSCs (ND36997, NINDS hiPSCRepository at Coriell Institute) were removed from liquid nitrogen and rapidly thawed in a 37°C water bath. The thawed cell suspension was then rapidly transferred to centrifuge tubes containing DMEM / F12 basal medium and centrifuged at 1000 rpm for 5 minutes at room temperature to obtain cell pellet. The pellet was then resuspended in human neural stem cell proliferation medium and seeded into 10 cm cell culture dishes for incubation at 37°C in a 5% CO2 incubator.

[0098] 4. Neural stem cells and differentiation identification

[0099] Mouse-derived neural stem cells (MDSCs) and human-derived neural stem cells (HSCs) were seeded into 24-well plates containing climbing sheets and cultured in appropriate proliferative cell cultures. After reaching suitable cell densities, the cells were removed from the incubator. Immunofluorescence staining was used to detect the expression of neural stem cell markers Nestin and SOX2 for phenotypic identification of mouse-derived MDSCs; the expression of stem cell marker OCT4 for phenotypic identification of hiPSCs; the expression of neural stem cell markers Nestin and PAX6 for phenotypic identification of human-derived MDSCs; the expression of neuronal markers TUJ1, astrocyte marker GFAP, and oligodendrocyte marker O4 for phenotypic identification of mouse-derived MDSCs differentiating into different neural cell types; and the expression of neuronal marker MAP2 for phenotypic identification of human-derived MDSCs differentiating into neurons (results are shown in [link to results]). Figure 1 ).

[0100] The specific steps for implementing cell immunofluorescence staining technology are as follows:

[0101] Fixation: Discard the original culture medium and gently rinse the wells twice with D-PBS buffer. Next, fix the cells with 4% paraformaldehyde solution, and finally rinse three more times with D-PBS solution for 10 minutes each time.

[0102] Permeabilization: Add 0.25% Triton X-100 to the well plate and incubate at room temperature for 10 minutes.

[0103] Blocking: Add 10% donkey serum to the well plate and block at room temperature for 1 hour.

[0104] Apply primary antibody: Prepare primary antibody solution using 5% donkey serum according to the recommended ratio in the antibody instructions, add it to the well plate, and incubate overnight at 4 degrees Celsius.

[0105] Secondary antibody application: Prepare a secondary antibody solution matching the primary antibody using 5% donkey serum according to the antibody instructions, add it to the well plate, and incubate at room temperature in the dark for 1 hour.

[0106] DAPI staining: Add an appropriate amount of DAPI staining solution to the well plate and incubate at room temperature in the dark for 10 minutes.

[0107] Mounting: Add an appropriate amount of anti-fluorescence quenching mounting medium to the glass slide, remove the slide from the well plate and invert it onto the anti-fluorescence quenching medium, fix the slide with nail polish or similar material, observe and photograph under a microscope, process the images with ImageJ software, and perform statistical analysis with Prism software.

[0108] The specific implementation steps of step two of this invention are as follows:

[0109] 1. Detection of CHCHD2 expression levels in the cerebral cortex of mice at different stages of pregnancy.

[0110] ICR mice with gestational ages of 10.5, 12.5, and one day after birth were selected. Western blotting was used to detect the expression levels of the protein encoded by the CHCHD2 gene and the expression levels of various neuronal markers (results are shown in...). Figure 2 A).

[0111] The specific implementation steps of Western Blot technology are as follows:

[0112] Material collection: The fetal mouse cerebral cortex was isolated and placed in an EP tube, following the same procedure as the extraction of mouse neural stem cells.

[0113] Lysis: Add protein lysis buffer, protease inhibitor, and phosphatase inhibitor to the EP tube containing the tissue block, and shake in a tissue homogenizer for 30 seconds. Then, place the EP tube in a cell sonicator for further lysis. After lysis, centrifuge at 12,000 rpm for 20 minutes at 4 degrees Celsius to obtain a clear supernatant, which is the protein suspension.

[0114] Protein quantification: The concentration of the extracted protein suspension was determined according to the instructions of the BCA kit.

[0115] Sample preparation: Set the protein sample concentration to 5 μg / μL, and dilute the protein suspension to the set concentration using 5× loading buffer and ultrapure water. After preparing the protein sample of a certain concentration, heat it in a metal bath for 10 minutes to complete the preparation of the protein sample for loading.

[0116] Gel electrophoresis: Prepare the gel of the required concentration according to the instructions of the gel preparation kit. Add the protein marker and protein sample to the sample well in sequence. Set the electrophoresis conditions to constant voltage 70V for 30 minutes, and then change the electrophoresis conditions to constant voltage 120V for 60 minutes.

[0117] Transfer: Remove the gel from the clamp after electrophoresis. Place the gel on the electrotransfer clamp in the following order: filter paper-gel-PVDF membrane-filter paper from bottom to top. After correctly placing the electrodes, set the electrotransfer conditions to a constant current of 290mA for about 60-80 minutes. After the electrotransfer is completed, remove the transferred membrane and place it in TBST solution.

[0118] Sealing: Place the electroporated PVDF membrane in a 5% skim milk powder solution and seal at room temperature for 1 hour.

[0119] Primary antibody preparation: Prepare the primary antibody solution according to the dilution ratio recommended in the antibody instructions. Cut the blocked PVDF membrane according to the protein molecular weight indicated by the protein marker and place it in the internal control and target antibody solutions. Incubate overnight at 4 degrees Celsius on a shaker.

[0120] Secondary antibody incubation: Prepare a secondary antibody solution corresponding to the primary antibody according to the dilution ratio recommended in the antibody instructions. Place the band of the incubated primary antibody into the secondary antibody solution and continue to incubate slowly on a shaker at room temperature for 1 hour.

[0121] Development and statistical analysis: The developing solution was prepared according to the ECL kit, and the protein bands were developed sequentially. ImageJ software was used to process the protein development images, and Prism software was used for statistical analysis.

[0122] 2. Detection of CHCHD2 expression during in vitro neural differentiation of neural stem cells.

[0123] Mouse neural stem cells differentiated in vitro for 0, 3, and 5 days, and human neural stem cells differentiated in vitro for 1, 7, and 14 days, were selected. The expression level of CHCHD2 during the in vitro neural differentiation of neural stem cells was detected using qRT-PCR (results are shown in [link to results]). Figure 2 BD).

[0124] The specific steps for implementing qRT-PCR technology are as follows:

[0125] RNA extraction from cells: Total RNA was extracted from cells using the Yishan Bio RNA Rapid Extraction Kit according to the instructions.

[0126] RNA concentration determination: The concentration of total RNA extracted from cells was determined sequentially using a Nanodrop2000 instrument.

[0127] Reverse transcription: AG Biotech's Evo M-MLV reverse transcription reagent premix was used for reverse transcription. The reaction mixture must be prepared on ice. The specific reaction mixture preparation is as follows:

[0128]

[0129]

[0130] Reaction conditions: 37 degrees Celsius for 15 minutes

[0131] 85 degrees for 5 seconds

[0132] 4 degrees +∞

[0133] qRT-PCR: The experiment was performed using the AG Bio SYBR Green Pro Taq HS premixed qPCR kit. The specific steps are as follows:

[0134] (1) Preparation of the reaction system:

[0135]

[0136] (2) Set reaction conditions: First, react at 95 degrees Celsius for 30 seconds, then enter a cycle (react at 95 degrees Celsius for 5 seconds, anneal at 60 degrees Celsius for 30 seconds, for a total of 40 cycles), then react at 95 degrees Celsius for 10 minutes, react at 65 degrees Celsius for 5 seconds, and finally stop the reaction by increasing the temperature by 0.5 degrees Celsius to 95 degrees Celsius. Fluorescence signals were collected and analyzed during the third step (60 degrees Celsius for 30 seconds) of each cycle.

[0137] (3) Results analysis: The 2-ΔΔCt algorithm was used to calculate and analyze the data results.

[0138] (4) Primer sequences used in qRT-PCR experiments

[0139]

[0140]

[0141] The specific implementation steps of step three of this invention are as follows:

[0142] 1. Constructing mouse neural stem cell lines that overexpress and knock down CHCHD2

[0143] Mouse-derived neural stem cells were infected with a CHCHD2 murine overexpression and knockdown lentivirus (purchased from Jikai Gene) at MOI=50. After approximately 5 days of culture, puromycin was added to the culture medium at a concentration of 1 μM for screening, resulting in stable overexpression or knockdown neural stem cell lines. Finally, the expression levels of the CHCHD2 gene and its encoded protein were detected using the aforementioned Western blotting and qRT-PCR techniques, verifying the successful construction of the overexpression and knockdown neural stem cell lines (results are shown in [link to results]). Figure 3 AD).

[0144] 2. Construction of a CHCHD2-overexpressing human neural stem cell line

[0145] Human neural stem cells were infected with a self-constructed human CHCHD2-overexpressing lentivirus. The success of the CHCHD2-overexpressing human neural stem cell line was detected by qRT-PCR (results are shown in [link to results]). Figure 3 E).

[0146] The specific steps involved in the self-construction of lentiviruses are as follows:

[0147] (1) Coating: Take two T75 bottles, prepare PLL coating solution with D-PBS solution to make the final concentration 0.1 mg / ml, and incubate in a 37-degree incubator for 30 minutes.

[0148] (2) Cell plating: HEK293 cells were evenly plated in T75 cell culture flasks at a density of 10 million.

[0149] (3) Transfection: After 10 hours of plating, the culture medium was replaced with a culture medium without antibiotics. The viral vector plasmid and the target plasmid (Lenti-vector, Lenti-CHCHD2, VSV-G, pMDL, pRev) were added according to the Lipofectamine 2000 instructions. The culture was placed in a 37-degree cell culture incubator. The culture medium was replaced with a culture medium containing antibiotics the next day.

[0150] (4) First virus harvest: Remove cells from the incubator, collect the culture medium from the culture flask using a 15ml centrifuge tube, and add fresh culture medium containing antibiotics to continue culturing. Centrifuge the 15ml centrifuge tube containing the recovered culture medium at 1000 rpm for 5 minutes. Then filter the virus solution through a 0.45μm PVDF cell filter and aliquot it for storage at -80°C.

[0151] (5) Second collection of virus solution: Same as in step (4), collect the virus solution again, aliquot and store in a -80 degree freezer.

[0152] The specific steps involved in lentiviral infection of human neural stem cells are as follows:

[0153] (1) Cell plating: Human neural stem cells were evenly plated in 6-well plates at a density of 500,000 and cultured in a cell culture incubator.

[0154] (2) Viral infection: Remove cells from the incubator and observe their density and state under a regular optical microscope. Remove the virus from the -80°C freezer and thaw it on ice. Discard the old culture medium, add the virus solution, and incubate for about 16 hours, then replace it with normal cell culture medium.

[0155] (3) Overexpression verification: After 4 to 5 days of viral infection, remove the product from the incubator and detect the expression of CHCHD2 according to the steps of the above qRT-PCR technique.

[0156] The specific implementation steps of step four of this invention are as follows:

[0157] 1. Verify that overexpression of CHCHD2 promotes the proliferation of murine neural stem cells.

[0158] qRT-PCR validation: Mouse neural stem cells with successful CHCHD2 overexpression (i.e., Lenti-vector mouse neural stem cells and Lenti-CHCHD2 mouse neural stem cells) were seeded at the same density in 6-well plates. One day after cell attachment, the cells were removed from the incubator. Following the detailed qRT-PCR procedure described above, the expression levels of CHCHD2 and the cell proliferation marker Ki67 in Lenti-vector and Lenti-CHCHD2 mouse neural stem cells were detected (results are shown in [link to results]). Figure 4 A).

[0159] Immunofluorescence verification: Lenti-vector mouse neural stem cells and Lenti-CHCHD2 mouse neural stem cells were evenly seeded at the same density in 24-well plates containing climbing slides. After one day of culture, the plates were removed and immunofluorescence staining was performed (the steps were the same as above). After staining, the staining of CHCHD2 and Ki67 was observed under a microscope. Microscope parameters were set, and images were taken at specific parameters. 6-8 fields of view were randomly selected from each climbing slide for photography. Finally, positive staining was counted using ImageJ software. The ratio of Ki67 positive cells to DAPI was used as the statistical value, and statistical analysis was performed using Prism software to obtain the final results (see results below). Figure 4 BC).

[0160] 2. Verify that knockdown of CHCHD2 inhibits the proliferation of murine neural stem cells:

[0161] Mouse neural stem cells from the shControl and shCHCHD2 knockdown groups were used in the experiment. Following the same steps as described above for promoting the proliferation of mouse neural stem cells by overexpression of CHCHD2, two experimental techniques—qRT-PCR and immunofluorescence—were used to verify that knockdown of CHCHD2 inhibited the proliferation of mouse neural stem cells (results are shown in [link to results]). Figure 4 DF).

[0162] The specific implementation steps of step five of this invention are as follows:

[0163] 1. Verify that overexpression of CHCHD2 promotes in vitro differentiation of murine neural stem cells.

[0164] qRT-PCR validation: Lenti-vector mouse neural stem cells and Lenti-CHCHD2 mouse neural stem cells were evenly seeded at the same density in 6-well plates. The next day, the mouse neural stem cell proliferation medium was replaced with mouse neural stem cell differentiation medium to begin in vitro differentiation of neural stem cells. After 5 days of differentiation, the cells were removed from the incubator, and the expression levels of CHCHD2, neuronal markers TUJ1 and NeuroD1, astrocyte GFAP, and oligodendrocyte CNPase in the mouse neural stem cells were detected according to the detailed qRT-PCR procedure described above (results are shown in [link to results]). Figure 5 A)

[0165] Western Blot Validation: Lenti-vector mouse neural stem cells and Lenti-CHCHD2 mouse neural stem cells were evenly seeded at the same density in 6-well plates. The next day, the mouse neural stem cell proliferation medium was replaced with mouse neural stem cell differentiation medium to begin in vitro differentiation of neural stem cells. After 5 days of differentiation, the cells were removed from the incubator, and the expression levels of CHCHD2 and neuronal markers TUJ1, NeuroD1, astrocyte GFAP, and oligodendrocyte CNPase in the mouse neural stem cells were detected according to the detailed Western Blot procedure described above (results are shown in [link to results]). Figure 5 B)

[0166] Immunofluorescence verification: Lenti-vector mouse neural stem cells and Lenti-CHCHD2 mouse neural stem cells were evenly seeded at the same density in 24-well plates containing climbing slides. After differentiation for 5 days, the cells were removed and subjected to immunofluorescence staining (the procedure was the same as above). After staining, the expression of CHCHD2 and various neural cell markers was observed under a microscope. Microscope parameters were set, and images were taken at specific parameters. 6-8 fields of view were randomly selected from each climbing slide for photography. Finally, positive staining counts were performed using ImageJ software, and the ratio of positive neural marker cells to DAPI was used as the statistical value. Statistical analysis was performed using Prism software to obtain the final results (see [see results]). Figure 5 C).

[0167] Step six of this invention verifies that knocking down CHCHD2 inhibits the in vitro differentiation of mouse neural stem cells. The specific implementation steps are as follows:

[0168] Cells from the shControl and shCHCHD2 knockdown groups were used in the experiment. Following the same steps as the verification of CHCHD2 overexpression promoting in vitro differentiation of murine neural stem cells, three experimental techniques—qRT-PCR, Western blotting, and immunofluorescence—were used to verify that CHCHD2 knockdown inhibited in vitro differentiation of murine neural stem cells (results are shown in [link to results]). Figure 6 AB).

[0169] The specific implementation steps of step seven of this invention, verifying the effect of CHCHD2 overexpression on the in vitro differentiation of human neural stem cells, are as follows:

[0170] Human neural stem cell lines overexpressing CHCHD2 were uniformly seeded at the same density. On the second day of culture, the human neural stem cell proliferation medium was replaced with human neural stem cell differentiation medium to induce differentiation. After 14 days of differentiation, the expression levels of CHCHD2, neuronal marker TUJ1, astrocyte GFAP, and oligodendrocyte CNPase were detected by qRT-PCR (results are shown in [link to results]). Figure 7 ).

[0171] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. Use of a reagent overexpressing a CHCHD2 gene in the preparation of a product for promoting proliferation of neural stem cells in vitro and differentiation of neural stem cells in vitro into neurons. The neural stem cells are selected from the group consisting of mouse embryonic cortex-derived neural stem cells or neural stem cells differentiated from human induced pluripotent stem cells.

Citation Information

Patent Citations

  • Compositions for treating neurological disease

    WO2023147058A2