Application of SNP molecular markers for YZCd1 gene related to cadmium content in rice grains

Abstract

The present invention belongs to the technical field of plant molecular breeding, and specifically relates to the application of SNP molecular markers of rice grain cadmium content-related gene YZCd1. The gene of the SNP molecular marker is located at the 2559th nucleotide of SEQ ID No.1 on chromosome 7 of rice, which is T or C. It is proved by experiments that TagSNP-7501871 is a SNP molecular marker related to the cadmium content of rice grains. By detecting the polymorphism or genotype of the SNP site in the rice genome to be tested, the cadmium content of rice grains is identified or assisted in identification according to the genotype. The present invention also provides a primer composition and a method for identifying or assisted in identification of the cadmium content of rice grains using the primer composition, which can be used to predict the cadmium content of rice grains, can be used for early screening of rice to be screened, and is used for rice molecular marker-assisted breeding. The SNP molecular marker provided by the present invention has important application value in the research of exploring rice germplasm resources with low cadmium content in grains and breeding rice varieties with low cadmium content in grains.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular breeding, and in particular relates to the application of a SNP molecular marker of a rice grain cadmium content-related gene YZCd1. Background Art

[0002] In recent years, whole genome association analysis, as an effective gene positioning tool, has become one of the advanced methods for studying biological genomes. Whole genome association analysis is not only applicable to traits controlled by single genes, but also to the study of complex quantitative traits controlled by multiple genes, and has great advantages in quantitative traits. As a third-generation molecular marker detection system, SNP has the advantages of high density, high genetic stability, simple operation, high efficiency and low cost. For complex quantitative traits related to disease resistance, it is very suitable to use the whole genome association analysis method to preliminarily locate the genetic loci related to resistance.

[0003] Heavy metal pollution is complex, hidden, and long-lasting, and it may endanger human health through enrichment in the food chain. Cadmium is one of the most environmentally toxic heavy metal elements, posing a serious threat to the safe production of food crops such as rice. Excessive cadmium content in rice can seriously affect human health, and long-term intake of high-cadmium rice can induce chronic kidney poisoning, osteoporosis, spinal deformity and other diseases. At present, there are few molecular markers that can be used to select new varieties with low cadmium accumulation. The use of these markers requires cumbersome gel electrophoresis detection, with low automation and low throughput. Therefore, it is urgent to discover SNP sites that are simple to use and highly automated to accelerate the selection of new varieties with low cadmium accumulation. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an application of a SNP molecular marker of a rice grain cadmium content-related gene YZCd1.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] The purpose of the first aspect of the present invention is to provide a SNP molecular marker related to the cadmium content in rice grains, wherein the gene of the SNP molecular marker is located at the 2559th nucleotide of SEQ ID No. 1 on chromosome 7 of rice, and the polymorphism is T or C.

[0007] The DNA molecule shown in SEQ ID No. 1 provided by the present invention is used as a detection target. The substance for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as substances for detecting the single nucleotide polymorphism or genotype of other molecular markers related to the cadmium content of rice grains) to prepare a product for identifying the cadmium content of rice grains.

[0008] The second aspect of the present invention aims to provide a product comprising the above-mentioned SNP molecular marker substance related to the cadmium content in rice grains.

[0009] The substance may be a reagent and / or instrument required for determining the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0010] As a preferred technical solution, the product comprises a primer composition for amplifying the above-mentioned SNP molecular marker associated with the cadmium content in rice grains.

[0011] As a preferred technical solution, the primer composition consists of primer A, primer B and primer C.

[0012] The nucleotide sequence of the primer A is shown in SEQ ID No. 2;

[0013] The nucleotide sequence of the primer B is shown in SEQ ID No.3;

[0014] The nucleotide sequence of the primer C is shown in SEQ ID No.4.

[0015] In the above products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight measurement, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleotide sequence of the primer A is shown in SEQ ID No.2; the nucleotide sequence of the primer B is shown in SEQ ID No.3; and the nucleotide sequence of the primer C is shown in SEQ ID No.4. The nucleic acid is directly detected without labeling (e.g., directly reading the sequence). For example, the primer composition may be a primer composition consisting of a single-stranded DNA having a nucleotide sequence of SEQ ID No.5 at positions 22-45, a single-stranded DNA having a nucleotide sequence of SEQ ID No.6 at positions 22-47, and a single-stranded DNA having a nucleotide sequence of SEQ ID No.4. In the sequence list, SEQ ID No.5 consists of 45 nucleotides, nucleotides 1-21 are FAM sequences (as markers), and nucleotides 22-45 are specific sequences; SEQ ID No.6 in the sequence list consists of 47 nucleotides, nucleotides 1-21 are HEX sequences (as markers), and nucleotides 22-47 are specific sequences.

[0016] The third aspect of the present invention provides a kit comprising the primer combination shown above.

[0017] The fourth aspect of the present invention provides the use of the above-mentioned SNP molecular marker related to the cadmium content in rice grains, the above-mentioned product, and the above-mentioned kit in any one of (1) to (8):

[0018] (1) Identify or assist in identifying the cadmium content in rice grains;

[0019] (2) Screening or breeding rice plants, strains, lines or varieties with low cadmium content in rice grains;

[0020] (3) Screening or breeding rice plants, strains, lines or varieties with high cadmium content in rice grains;

[0021] (4) Rice breeding;

[0022] (5) Preparing products for identifying or assisting in identifying the cadmium content in rice grains;

[0023] (6) preparing products for screening or breeding rice plants, lines, strains or varieties with low cadmium content in grains;

[0024] (7) preparing products for screening or breeding rice plants, strains, lines or varieties with high cadmium content in their grains;

[0025] (8) Preparing rice breeding products.

[0026] The fifth aspect of the present invention provides a method for identifying or assisting in identifying the cadmium content of rice grains, detecting the genotype of the SNP molecular marker related to the cadmium content of rice grains in the genome of the rice to be tested, and identifying or assisting in identifying the cadmium content of rice grains according to the genotype of the rice to be tested:

[0027] The rice to be tested whose SNP genotype is CC is or is a candidate rice with low cadmium content in rice grains;

[0028] The rice to be tested whose SNP genotype is TT is or is a candidate rice having a high cadmium content in rice grains.

[0029] As a preferred technical solution, the method for detecting the genotype of the SNP molecular marker related to the cadmium content of rice grains in the rice genome to be tested is:

[0030] (1) using the genomic DNA of the rice to be tested as a template and using the primer combination in the above kit to perform KASP;

[0031] (2) After the KASP detection PCR reaction program is completed, fluorescence detection is performed to determine the genotype of the SNP molecular marker related to the cadmium content in the rice grains to be tested. Specifically, after the KASP detection PCR reaction program is completed, the 96-well plate is placed on the Omega fluorescence signal reader and Araya to convert the fluorescence signal into an analyzable value, and then the analysis software Kraken provided by LGC is used. TM Perform genotype analysis.

[0032] As a preferred technical solution, the reaction system of KASP is: 1.5 μL of template solution, 0.0417 μL of primer working solution, 0.75 μL of 2×Master mix, and 0.75 μL of sterile ultrapure water; wherein the primer working solution is: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O, and the concentration of the three primers is 100 mM.

[0033] The reaction procedure of KASP is:

[0034] Step 1: pre-denaturation at 94°C for 15 min;

[0035] Step 2: 94℃20s, 61℃60s, 94℃20s, 60.4℃60s, 94℃20s, 59.8℃60s, 94℃20s, 59.2℃60s, 94℃20s, 58.6℃60s, 94℃20s, 58℃60s, 94℃20s, 57.4℃60s, 94℃20s, 56.8℃60s, 94℃20s, 56.2℃60s, 94℃20s, 55.6℃60s;

[0036] Step 3: denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for 5 cycles; if typing is not obvious, add 5 more cycles for expansion; Step 4: 94°C for 20 s, annealing at 57°C for 60 s, for 26 cycles.

[0037] The sixth aspect of the present invention aims to provide a rice breeding method, which comprises detecting the genotype of the above-mentioned SNP in the rice genome, selecting rice with a genotype of CC of the SNP as a parent for breeding, wherein CC is a homozygous type of the SNP site being C, and breeding rice with a low cadmium content in the grain; and selecting rice with a genotype of TT of the SNP as a parent for breeding, wherein TT is a homozygous type of the SNP site being T, and breeding rice with a high cadmium content in the grain.

[0038] The present invention has the following advantages:

[0039] (1) The present invention discloses a SNP molecular marker of a gene YZCd1 related to cadmium content in rice grains, wherein the gene of the SNP molecular marker is located at the 2559th nucleotide of SEQ ID No. 1 on chromosome 7 of rice, which is T or C. Experiments have shown that the average cadmium content in the grains of rice varieties with a genotype of CC is 0.29 mg / kg, and the average cadmium content in the grains of rice varieties with a genotype of TT is 0.60 mg / kg, and the cadmium content in the grains of rice varieties with a genotype of CC is significantly lower than that in the grains of rice varieties with a genotype of TT, indicating that TagSNP-7501871 of the present invention is a SNP molecular marker related to cadmium content in rice grains.

[0040] (2) The present invention also provides a primer combination and a method for identifying or assisting in identifying the cadmium content of rice grains using the primer combination. The method established by the present invention can be used to predict the cadmium content of rice grains, can be used for early screening of rice to be screened, can be used for rice molecular marker-assisted breeding, and has important application value in the research of discovering rice germplasm resources with low cadmium content in grains and breeding rice varieties with low cadmium content in grains. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with embodiments, and the protection scope of the present invention is not limited to the following:

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0043] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0044] The 427 domestic and foreign rice varieties in the following examples are provided by the Rice Germplasm Resources, Genomics and Molecular Breeding (RGGMB) Laboratory of the Plant Genetics and Breeding Department of the College of Agronomy and Biotechnology of China Agricultural University. The germplasm resources can be obtained from the China Crop Germplasm Resources Information Network (http: / / icgr.caas.net.cn / pztest.htm), and the specific information of some materials can be found in the formal publication (Research and Utilization of Chinese Rice Seed Resources and Its Core Germplasm, Li Zichao, China Agricultural University Press; 1st edition, May 1, 2013), and the detailed information of the varieties is shown in Table 1. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0045] Example 1: TagSNP-7501871 is a SNP molecular marker associated with cadmium content in rice grains

[0046] 1. Discovery of TagSNP-7501871

[0047] Based on the cadmium content in the grains of 427 domestic and foreign rice varieties and their genome sequencing results, a SNP site related to the cadmium content in rice grains was screened out. Taking the Nipponbare genome sequence as the reference genome, the SNP site is located at 7501871bp on chromosome 7 of Nipponbare rice, and the SNP site is named TagSNP-7501871. TagSNP-7501871 is a di-allelic polymorphic SNP site of the 2559th nucleotide of SEQ ID No.1 on chromosome 7 of rice. The nucleotide at the 2559th position of SEQID No.1 is T or C, and the genotype of this SNP site is as follows: TT or CC. Genotype CC is the homozygous type of TagSNP-7501871 site C, and genotype TT is the homozygous type of TagSNP-7501871 site T. SEQ IDNo.1 corresponds to positions 7499312-7503051 of chromosome 7 of Nipponbare rice. The gene associated with the SNP site is named YZCd1 gene, and the SNP site is located on the promoter of the YZCd1 gene. The nucleotide sequence of chromosome 7 of the rice variety Nipponbare is derived from the Oryza sativa v7.0 genome (Phytozome genome ID: 323) in the phytozome database. SEQ ID No.1 corresponds to positions 7499312-7503051 of chromosome 7 of Nipponbare rice. In the sequence table, y in SEQ ID NO.1 represents t or c.

[0048] SEQ ID NO.1:

[0049]

[0050] 2. Convert SNP markers to KASP markers and design primer sets for detecting the markers

[0051] The SNP markers were converted into KASP markers for use in molecular marker-assisted selection breeding.

[0052] A primer set for detecting KASP markers based on KASP technology was designed, referred to as KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C).

[0053] The nucleotide sequence of primer A is shown in SEQ ID No. 2, and the sequence of primer A with a fluorescent label (bases underlined are straight lines) is shown in SEQ ID No. 5.

[0054] SEQ ID No.2: 5'-ATGTGCCCATTAAGCAAGGAATTC-3';

[0055] SEQ ID No.5:

[0056] 5'- GAAGGTGACCAAGTTCATGCT ATGTGCCCATTAAGCAAGGAATTC-3'.

[0057] The nucleotide sequence of primer B is shown in SEQ ID No.3, and the sequence of primer B with a fluorescent label (bases underlined are straight lines) is shown in SEQ ID No.6,

[0058] SEQ ID No.3:

[0059] 5'-ATATGTGCCCATTAAGCAAGGAATTT-3';

[0060] SEQ ID No.6:

[0061] 5' -GAAGGTCGGAGTCAACGGATT ATATGTGCCCATTAAGCAAGGAATTT-3'.

[0062] The nucleotide sequence of primer C is shown in SEQ ID No.4.

[0063] 5'-CCTACTAGCTCTAGCTAGAGCTTCAT-3'.

[0064] TagSNP-7501871 is located at nucleotide 2559 of the DNA molecule shown in Sequence 1 of the sequence listing in the rice genome.

[0065] Primer A with a FAM fluorescent tag sequence (bases underlined as straight lines) at the 5' end and primer C amplify the fragment with TagSNP-7501871 as C. The fluorescent signal of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0066] Primer B with a HEX fluorescent tag sequence (bases underlined as straight lines) at the 5' end and primer C amplify the fragment with TagSNP-7501871 as T. The fluorescent signal of the HEX group can be read by an ELISA reader or a fluorescent quantitative PCR instrument.

[0067] 3. Genotyping of rice TagSNP-7501871 locus

[0068] 3.1. Extract genomic DNA from the leaves of the rice to be tested and dilute to obtain a template solution. The DNA concentration in the template solution is 5-50 ng / μL.

[0069] 3.2. Conduct KASP.

[0070] Primer working solution: First dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution according to the following formula: primer A 12μL, primer B 12μL, primer C 30μL, ddH2O 46μL.

[0071] KASP V4.0 2X Mastermix 96 / 384 is a product of LGC (Cat. No. KBS-1016-003). KASP V4.0 2X Mastermix 96 / 384 contains fluorescent probe A, fluorescent probe B, quenching probe A, quenching probe B, high-fidelity Taq enzyme, dNTP, Mg 2+ wait.

[0072] Reaction system of KASP: In the above method, the reaction system of KASP can be: 1.5 μL of template solution, 0.0417 μL of primer working solution, 0.75 μL of 2×Master mix, and 0.75 μL of sterile ultrapure water.

[0073] KASP was performed on a high-throughput PCR instrument (Soellex) using a touch down PCR amplification procedure.

[0074] In the above method, the reaction procedure of KASP is:

[0075] Step 1: pre-denaturation at 94°C for 15 min;

[0076] Step 2: 94℃20s, 61℃60s, 94℃20s, 60.4℃60s, 94℃20s, 59.8℃60s, 94℃20s, 59.2℃60s, 94℃20s, 58.6℃60s, 94℃20s, 58℃60s, 94℃20s, 57.4℃60s, 94℃20s, 56.8℃60s, 94℃20s, 56.2℃60s, 94℃20s, 55.6℃60s;

[0077] Step 3: denaturation at 94℃ for 20s, annealing at 55℃ for 60s, 5 cycles. If the typing is not obvious, add 5 more cycles for expansion;

[0078] Step 4: 94°C for 20 s, annealing at 57°C for 60 s, 26 cycles.

[0079] A blank control (NTC) in which no template DNA is added to the reaction system is also set up in the experiment, and 2 or more blank controls are set up for each plate.

[0080] 3.3. Perform fluorescence scanning.

[0081] After completing step 2, place the 96-well plate on the Omega fluorescence signal reader and Araya to convert the fluorescence signal into analyzable values, and then use the analysis software Kraken provided by LGC TM Perform genotype analysis.

[0082] The excitation wavelength of FAM is 485nm, and the emission wavelength is 520nm. The excitation wavelength of HEX is 535nm, and the emission wavelength is 556nm. The excitation wavelength of the system reference fluorescence ROX is 575nm, and the emission wavelength is 610nm.

[0083] If only the fluorescence signal of the HEX group is displayed, the genotype of TagSNP-7501871 of the rice to be tested is TT (i.e., TagSNP-7501871 in the genome is homozygous for T); if only the fluorescence signal of the FAM group is displayed, the genotype of TagSNP-7501871 of the rice to be tested is CC (i.e., TagSNP-7501871 in the genome is homozygous for C).

[0084] 4. Cadmium content testing of rice grains of 427 rice varieties

[0085] 427 domestic and foreign rice varieties were provided by the Rice Germplasm Resources, Genomics and Molecular Breeding (RGGMB) Laboratory, Department of Plant Genetics and Breeding, College of Agronomy and Biotechnology, China Agricultural University. Their germplasm resources can be obtained from the China Crop Germplasm Resources Information Network (http: / / icgr.caas.net.cn / pztest.htm). The detailed information of the varieties is shown in Table 1.

[0086] The collected rice grain samples were dried in the sun or placed in an oven at 60°C for 3 days, and then husked with a rice husker after the mass was constant. The obtained brown rice samples were placed in 5 ml centrifuge tubes. The brown rice samples were then crushed using a high-throughput silent tissue grinder for subsequent cadmium content determination.

[0087] The cadmium content of rice grains was determined by single acid digestion method. The instrument used was a far-infrared temperature-controlled digestion furnace and the container was a glass digestion tube. The specific steps are briefly described as follows: (1) Weighing: Accurately weigh 0.2000g (accurate to 0.0001g) of crushed rice grain sample and put it into a glass digestion tube to prevent the powder from sticking to the wall. (2) Adding acid: Add 1ml of high-grade pure nitric acid and cold digest overnight. (3) Digestion: Cover with a bent-neck funnel and digest at 200℃ for 6h until the digestion liquid is colorless and transparent or slightly yellow. (4) Make up the volume: Wash the digestion liquid in the tube with distilled water, transfer the washing liquid to a 15ml constant volume tube, and make up to 15ml. (5) Filtration: After shaking well, use a 0.45μm water filter membrane to filter the liquid after making up to 10ml into a centrifuge tube for testing. Quality control: Two blank controls and three rice flour component analysis standard substances (national standard substances, GBW100349, Gangyan Nake Testing Technology Co., Ltd.) were set up for each batch of digestion to ensure that the cadmium content of rice grains was accurate and reliable. All sample measurements were repeated 3 times. The cadmium content of rice grains was determined by inductively coupled plasma mass spectrometry. The results of the determination of the cadmium content of rice grains and the genotype of TagSNP-7501871 are shown in Table 1, and the cadmium content of rice grains of 427 rice varieties according to the genotype of TagSNP-7501871 is shown in Table 2.

[0088] Table 1: Cadmium content in rice grains and genotypes of TagSNP-7501871 of 427 rice varieties

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] Table 2: Cadmium content in rice grains of 427 rice varieties according to the genotype of TagSNP-7501871

[0104]

[0105] 5. Identification of cadmium content in rice grains using TagSNP-7501871

[0106] The genotype of TagSNP-7501871 of the rice to be tested was detected according to the method in step 3. The cadmium content of the rice grains to be tested was identified according to the genotype results. The genotype detection results of each rice variety are shown in Table 1.

[0107] In Table 1, the genotype of TagSNP-7501871 of rice materials with TT is TT, and the genotype of TagSNP-7501871 of rice materials with CC is CC. Among the 427 rice varieties, the genotype of SNP molecular marker site TagSNP-7501871 of 228 rice varieties is CC, and the genotype of SNP molecular marker site TagSNP-7501871 of 199 rice varieties is TT. From Table 2, it can be seen that the average cadmium content of grains of 228 rice varieties with CC genotype is 0.29 mg / kg; the average cadmium content of grains of 199 rice varieties with TT genotype is 0.60 mg / kg.

[0108] An independent sample T test was performed on the cadmium content of grains of 427 rice varieties according to the TagSNP-7501871 genotype. The results are shown in Table 3. The cadmium content of grains of 228 rice varieties with genotype CC was significantly lower than that of rice grains of 199 rice varieties with genotype TT (α=0.05, P<0.05). This indicates that TagSNP-7501871 of the present invention is a SNP molecular marker related to the cadmium content of rice grains. In the breeding of rice with low cadmium content, it is best to select rice with a genotype of CC at the TagSNP-7501871 locus as a parent for breeding.

[0109] Table 3: Differences in cadmium content in rice grains of 427 rice varieties according to genotype analysis of TagSNP-7501871

[0110]

[0111] In summary, TagSNP-7501871 of the present invention, as a SNP molecular marker related to cadmium content in rice grains, can be used for early prediction and screening of cadmium accumulation in rice grains, and can also be used for rice molecular marker-assisted selection breeding and breeding of low-cadmium rice varieties.

[0112] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which are all covered by the protection scope of the present invention.

Claims

1. Use of a SNP molecular marker associated with cadmium content in rice grains in any one of (1) to (6): the SNP molecular marker is a nucleotide sequence shown in SEQ ID No. 1, wherein the nucleotide sequence has a T / C polymorphism at position 2559 from the 5' end; (1) Identify or assist in identifying the cadmium content in rice grains; (2) Screening or breeding rice plants, lines, strains or varieties with low cadmium content in rice grains; (3) Screening or breeding rice plants, strains, lines or varieties with high cadmium content in rice grains; (4) Preparation of products for identification or auxiliary identification of cadmium content in rice grains; (5) Preparing products for screening or breeding rice plants, strains, lines or varieties with low cadmium content in their grains; (6) Preparation of products for screening or breeding rice plants, plant lines, strains or varieties with high cadmium content in their grains.

2. A method for identifying or assisting in identifying the cadmium content of rice grains, characterized in that: Detecting the genotype of a SNP molecular marker related to the cadmium content of rice grains in the genome of the rice to be tested, wherein the SNP molecular marker is a nucleotide sequence shown in SEQ ID No. 1, wherein the nucleotide sequence has a T / C polymorphism at position 2559 from the 5' end, and identifying or assisting in identifying the cadmium content of rice grains according to the genotype of the rice to be tested: The rice to be tested whose SNP genotype is CC is or is a candidate rice with low cadmium content in rice grains; The rice to be tested whose SNP genotype is TT is or is a candidate rice having a high cadmium content in rice grains.

3. The method according to claim 2, characterized in that The method for detecting the genotype of the SNP molecular marker related to the cadmium content of rice grains in the rice genome to be tested is: (1) Using the genomic DNA of the rice to be tested as a template, KASP was performed using a primer combination of SNP molecular markers related to the cadmium content in rice grains; The primer composition consists of primer A, primer B and primer C. The nucleotide sequence of the primer A is shown in SEQ ID No. 2; The nucleotide sequence of the primer B is shown in SEQ ID No.3; The nucleotide sequence of the primer C is shown in SEQ ID No.4; (2) After the KASP detection PCR reaction program is completed, fluorescence detection is performed to determine the genotype of the SNP molecular marker related to the cadmium content in the rice grains.

4. The method according to claim 3, characterized in that The reaction system of KASP is: 1.5 μL template solution, 0.0417 μL primer working solution, 0.75 μL 2×Master mix, and 0.75 μL sterile ultrapure water; wherein the primer working solution is: 12 μL primer A, 12 μL primer B, 30 μL primer C, and 46 μL ddH2O, and the concentration of the three primers is 100 mM. The reaction procedure of KASP is: Step 1: pre-denaturation at 94°C for 15 min; Step 2: 94℃ 20s, 61℃ 60s, 94℃ 20s, 60.4℃ 60s, 94℃ 20s, 59.8℃ 60s, 94℃ 20s, 59.2℃ 60s, 94℃ 20s, 58.6℃ 60s, 94℃ 20s, 58℃ 60s, 94℃ 20s, 57.4℃ 60s, 94℃ 20s, 56.8℃ 60s, 94℃ 20s, 56.2℃ 60s, 94℃ 20s, 55.6℃ 60s; Step 3: denaturation at 94°C for 20 s, annealing at 55°C for 60 s, 5 cycles; if typing is not obvious, add 5 more cycles for expansion; Step 4: 94°C for 20 s, annealing at 57°C for 60 s, 26 cycles.

5. A rice breeding method, characterized in that: The genotype of SNP in the rice genome is detected, the SNP molecular marker is the nucleotide sequence shown in SEQ ID No.1, wherein the nucleotide sequence has a T / C polymorphism at the 2559th position from the 5' end, and the rice with the genotype of the SNP being CC is selected as the parent for breeding, wherein the CC is the homozygous type of the SNP site being C, and the rice with low cadmium content in the grain is bred; the rice with the genotype of the SNP being TT is selected as the parent for breeding, wherein the TT is the homozygous type of the SNP site being T, and the rice with high cadmium content in the grain is bred.

Images