A molecular marker associated with sheep weight traits and its application

By amplifying the DNA sequence of the sheep TNNT1 gene and detecting its polymorphic sites, especially the C/G polymorphism at 176bp, the problem of unclear association between sheep weight traits was solved, enabling efficient screening of high-weight sheep and improving sheep breeding efficiency and economic benefits.

CN118621022BActive Publication Date: 2026-06-30LANZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU UNIV
Filing Date
2024-06-18
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In existing technologies, sheep weight traits are affected by a variety of factors, and the relationship between the TNNT1 gene and weight traits is unclear, making it difficult to improve sheep growth performance through genetic modification.

Method used

By amplifying the DNA sequence of the sheep TNNT1 gene, detecting its polymorphic sites, especially the C/G polymorphism at 176 bp, and using specific primer pairs and kits for genotyping, high-weight sheep were screened out, and a molecular marker detection method for polymorphic sites was established.

Benefits of technology

This has enabled the effective screening of high-weight sheep, improved the efficiency of sheep breeding, enhanced sheep growth performance, and increased the economic benefits of sheep farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118621022B_ABST
    Figure CN118621022B_ABST
Patent Text Reader

Abstract

This invention provides a molecular marker associated with sheep weight traits and its application. Primers were designed based on the TNNT1 gene sequence to extract DNA from sheep blood. Through PCR amplification, DNA sequencing, and sequence analysis, a G / C polymorphism site was found at 176 bp of the amplified fragment. Further analysis using AQP primers detected the polymorphism site in 918 Hu sheep and established a least-squares model to analyze the association between genotype and weight traits. Ultimately, the TNNT1 gene fragment amplified by this invention was determined to serve as a molecular marker associated with sheep weight traits. By detecting the genotype of this molecular marker, this invention allows for the selection of GG homozygous sheep for breeding in the core herd, which can improve sheep weight and contribute to increased economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker related to sheep weight traits and its application. Background Technology

[0002] The Hu sheep is a short-tailed breed used for both lambskin and meat. It is characterized by rapid growth and high fertility. In sheep, body weight is undoubtedly a key economic indicator for meat production, directly impacting economic benefits. However, body weight is influenced by multiple factors, including breed, sex, nutritional level, genetic factors, and whether the sheep have been castrated. The final body weight of the Abergelle / Barka crossbreed is significantly higher than that of the purebred Abergelle (Bewketu Amare et al. Body weight change of Abergelle breed and Abergelle crossbred goats fed hay supplemented with different levels of concentrate mixture. Tropical Animal Health and Production. 2017 November; 50:613-620.). Males are more productive than females (Fernando Miranda de Vargas Junior et al. The effect of sex and genotype on growth performance, feed efficiency, and carcass traits of local sheep group Pantaneiro and Texel or Santa Inês crossbred finished on feedlot. Trop AnimHealth Prod. 2014 Jun; 46(5):869-75.). Furthermore, sheep with higher average weights reach market target weights more quickly than those with lower average weights, thus increasing economic benefits.

[0003] Myofibril T (TNNT) in mammals is a fibrillary protein that is easily degraded during the maturation of muscle and organ tissues in animals. There are three tissue-specific types in vertebrates, one of which is TNNT1 (troponin T1) (Olson D et al. Relationship of myofibril fragmentation index to measures of beefsteal tenderness. Journal of food science. 1977, 42(2):506-509). The TNNT1 gene is highly expressed in skeletal muscle development and adult slow skeletal muscle, mainly in striated muscle, and plays an important role in muscle contraction function (Sabry et al. Identification of and pattern of transitions of cardiac, slow and slow skeletal muscles. Muscle Res. Cell Motil. 1991, 12:262-270). As a fast skeletal muscle gene, TNNT1 plays an important regulatory role in the growth and development of animal skeletal muscle and is an important functional gene affecting animal slaughter performance. However, it is unclear whether the TNNT1 gene is related to body weight traits, and if so, what that relationship is.

[0004] This invention explores the association between different genotypes of the TNNT1 gene and sheep body weight through sequencing and analysis, aiming to provide genetic material for improving the genetic performance of sheep and accelerate the breeding process of new high-quality meat sheep breeds with independent intellectual property rights. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker associated with sheep body weight traits and its application. This molecular marker is obtained by amplifying and sequencing the DNA sequence of the sheep TNNT1 gene to identify polymorphic sites. By analyzing the correlation between different genotypes of these polymorphic sites and sheep body weight, a method for detecting the molecular marker of these polymorphic sites is established. This molecular marker can then be applied to enhance sheep growth performance, i.e., to improve sheep body weight in the breeding of new breeds.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A molecular marker associated with sheep weight traits, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the R at 176 bp is C or G, and this mutation results in C / G polymorphism of the molecular marker.

[0008] As described above, the application of molecular markers in the selection of high-weight sheep breeds shows that when the genotype of the polymorphic locus is GG, the sheep's weight is significantly higher than that of the CC and CG genotypes.

[0009] The application of a primer pair for detecting the above-mentioned molecular markers related to sheep weight traits in the screening of high-weight sheep breeding, preferably, the sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] The application of an AQP primer pair for detecting the above-mentioned molecular markers related to sheep weight traits in the screening of high-weight sheep breeding, preferably, the sequence of the AQP primer is shown in SEQ ID NO.4-6.

[0011] The application of a kit for detecting the above-mentioned molecular markers related to sheep weight traits in the screening of high-weight sheep breeding, preferably, the kit includes ordinary PCR primer pairs or AQP sequence pairs, the sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the sequences of the AQP primers are shown in SEQ ID NO.4-6.

[0012] A method for detecting the above-mentioned molecular markers related to sheep body weight traits includes the following steps:

[0013] 1) Amplify sheep genomic DNA using the above-mentioned ordinary PCR primer pairs, AQP primer pairs, or kits containing the above primer pairs;

[0014] 2) The polymorphic sites of the amplification products obtained in step 1) are identified by typing.

[0015] In step 2), the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0016] Furthermore, preferably, when using ordinary PCR primer pairs for amplification, the polymorphic sites of the amplification products are identified by direct sequencing.

[0017] Furthermore, preferably, when using AQP primer pairs for amplification, the fluorescence signal is detected and the genotyping results are viewed using a C1000 Touch Thermal Cycler instrument.

[0018] The above-described method is applied to the screening of high-weight sheep. By analyzing the types of polymorphic sites, the weight of sheep can be determined, and high-weight sheep can be screened out. When the genotype of the polymorphic site is GG, its weight is significantly higher than that of the CC and CG genotypes.

[0019] The application of the molecular marker PCR primer pairs, AQP primers, or kits described above in sheep breeding involves amplifying and detecting the genomic DNA of sheep using these primer pairs or kits to determine the genotype of the molecular markers in the sample to be tested, thereby enabling the selection of high-weight sheep breeds.

[0020] The beneficial effects of this invention are as follows:

[0021] This invention provides molecular markers related to sheep weight traits and their C / G polymorphic sites. By detecting the genotype of this polymorphism, it is possible to effectively identify whether a sheep is of a higher weight type, providing an effective detection method for the breeding of fast-growing sheep.

[0022] This invention, through the detection of molecular markers and the genotype of the polymorphic site, can be used to select sheep with the GG homozygous gene as breeding stock for breeding purposes, thereby increasing sheep weight and helping to improve the economic benefits of sheep farming. Attached Figure Description

[0023] Figure 1 This is a gel electrophoresis image of the sheep TNNT1 gene amplification in Example 1.

[0024] Figure 2 The sequencing results are for the g.5544C>G mutation site in the sheep TNNT1 gene in Example 1.

[0025] Figure 3 The AQP typing results of the TNNT1 gene in sheep in Example 2 are shown. Detailed Implementation

[0026] This invention analyzed the relationship between single nucleotide polymorphisms (SNPs) of the TNNT1 gene in Hu sheep and body weight traits. Furthermore, the expression levels of the TNNT1 gene in sheep with different genotypes were investigated. This invention can provide valuable molecular markers for sheep breeding.

[0027] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0028] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0029] Example 1: Amplification of the TNNT1 gene

[0030] Using sheep TNNT1 gene DNA (GenBank accession number: NC_056078.1) as a template, a pair of primers, RF and RR, were designed using Oligo 7.0 software. The primer sequences are as follows:

[0031] RF is SEQ ID NO.2: 5'-CGTCAATCCCGCCAACTCTTGC-3'

[0032] RR is SEQ ID NO.3: 5'-AGCATCAACTTGGGTGCGAT-3'

[0033] (2) Amplification and sequencing of the TNNT1 gene

[0034] Genomic DNA was extracted from sheep blood using a DNA extraction kit and used as a DNA template. The total volume of the PCR reaction was 35 μL, including: 17.4 μL of 2×PCR Master Mix, 1.1 μL of 10 μmol / L upstream primer RF, 1.1 μL of 10 μmol / L downstream primer RR, 1.4 μL of DNA template, and 14 μL of ddH2O.

[0035] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles, and finally 72℃ extension for 10 min.

[0036] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M represents a 3000-molecule marker, and lanes 1-10 represent the TNNT1 gene amplification results. The amplified PCR fragment was sequenced, and its nucleotide sequence, as shown in SEQ ID NO.1, is 378 bp. Using Chromas software, a polymorphic site was found in this fragment: R at position 176 bp is either C or G. This indicates that the amplified TNNT1 gene fragment (SEQ ID NO.1) exhibits C / G polymorphism at position 176 bp (see [link to SEQ ID NO.1]). Figure 2 ).

[0037] Among them, SEQ ID NO.1: CGTCAATCCCGCCAACTCTTGCGGTCCAGGG GTCCCCTCCTGACGCTTCTCAGAGGTGCTGCGGGGCTGGCGCCTTCTCGGGGTATCACCTGGGGATGACCAGGCTCCCGCCTCTCGTCCCCCAGGACATCCACCGGAAGCGCATGGAAAAGGACCTGCTGGAGCTGCAGACGCTRATCGACGTCCACTTTGAGCAGCGGAAGAA AGAGGAAGAGGAGCTGGTGGCGCTGAAAGAGCGCATCGTGAGTGGAGGGCGGTGGGCTTCCCCCAGCTCGCCGCTTGCCTCCCAGCCTCTGGGTCCTGGGAGATACGGAGCACGGTCGCCGTCCGGGGCAGACCCAAGGCTGAAACTTTCCCGATCGCACCCAAGTTGATGCT.

[0038] DNA sequence homology retrieval and identification:

[0039] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the sheep TNNT1 gene DNA (GenBank accession number: NC_056067.1).

[0040] Example 2: Establishment of a Genotyping Detection Method

[0041] 1. Primer sequence design

[0042] AQP primer pairs were designed targeting the C / G polymorphism site of the amplified fragment in Example 1 for the specific detection of this polymorphism site. The nucleotide sequences of the optimized AQP primer pairs include:

[0043] The forward primer A1 used to detect AlleleC is shown in SEQ ID NO.4, wherein:

[0044] SEQ ID NO.4:

[0045] GAAGGTGACCAAGTTCATGCTTGCTGGAGCTGCAGACGCTC;

[0046] The forward primer A2 used to detect AlleleG is shown in SEQ ID NO.5, wherein:

[0047] SEQ ID NO.5:

[0048] GAAGGTCGGAGTCAACGGATTTGCTGGAGCTGCAGACGCTG;

[0049] The universal reverse primer C is shown in SEQ ID NO.6, wherein:

[0050] SEQ ID NO. 6: CTCCTCTTCCTCTTTCTTCCGC.

[0051] The primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the AQP primer pair was diluted to 100 μmol / L and mixed with sterile water in a volume ratio of primer A1:primer A2:primer C:stere water of 12:12:30:46 (12:12:30:46) to prepare a primer mixture.

[0052] 2. Extracted genomic DNA and subjected to quality control.

[0053] Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then subjected to quality testing using 1% agarose gel electrophoresis and Nanodrop 2100. The extracted DNA must meet the following requirements: (1) Agarose gel electrophoresis shows a single DNA band without significant diffusion. (2) Nanodrop 2100 detection shows A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. DNA that does not meet these requirements needs to be extracted again until it meets the requirements. Based on the AQPTM detection technology and genome size calculation from Beijing Jiacheng Biotechnology Co., Ltd., the required DNA dosage is calculated to be 2–50 ng / sample. The extracted genomic DNA is then diluted to a concentration of 2–50 ng / μL as a DNA template.

[0054] 3. Perform genotyping

[0055] First, mix each primer (100 μmol / L) of the above AQP primer pair with sterile water in a volume ratio of 12:12:30:46 (primer A1: primer A2: primer C: sterile water) to prepare a primer mixture for later use.

[0056] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2×Probe Mix, and 2 μL of diluted DNA template (2–50 ng / μL) to each well of a 384-well plate. After adding the primer mixture, seal the plate, centrifuge with shaking, and then place it on a C1000Touch™ Thermal Cycler instrument for PCR amplification. The specific procedure is as follows:

[0057] Pre-denaturation at 95℃ for 10 minutes;

[0058] 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle;

[0059] 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.

[0060] After amplification, fluorescence signals were detected and genotyping was performed using a C1000 Touch™ Thermal Cycler instrument at 37°C. Some results are shown below. Figure 3 As shown in the figure. FAM is the horizontal axis and HEX is the vertical axis. Each graph in the figure represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "CC"; the green triangle near the middle indicates that the locus is heterozygous genotype "CG"; and the orange dot near the right indicates that the locus is homozygous genotype "GG".

[0061] 4. Application of the molecular markers of this invention in sheep body weight correlation analysis

[0062] The experiment examined the polymorphism of 918 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and weight trait.

[0063] Y ijk =μ+G i +P j +S k +F l +ε ijkl

[0064] Among them, Y ijk Here, G represents the observed body weight, μ is the population mean, and G is the weight of the population. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, F l For the field effect, ε ijkl Assuming random error, let ε ijkl They are mutually independent and follow N(0, σ). 2 )distributed.

[0065] Genotyping results showed that among 918 individuals, 157 had the CC genotype, 229 had the CG genotype, and 532 had the GG genotype. The association analysis between genotype and body weight is shown in Table 1. Body weight was measured and its average value was calculated at 80, 100, 120, 140, 160, and 180 days of age in sheep.

[0066] Table 1 Association analysis of TNNT1 gene polymorphism and body weight ( / kg) in sheep

[0067]

[0068] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while the same superscript indicates no significant differences (P>0.05).

[0069] The results showed that the mutation site at position 176 bp shown in SEQ ID NO.1 was significantly associated with sheep body weight. Sheep carrying the GG genotype had a significantly higher body weight than sheep carrying the CC genotype at 100 days of age (P<0.05). This indicates that the G allele is the dominant allele. The C>G mutation site in the TNNT1 gene can serve as a potential molecular marker affecting sheep body weight (P<0.05). Selecting the GG genotype for breeding during the preservation of sheep can increase their body weight and result in a superior flock with higher body weight.

[0070] Subsequently, 475 rams were selected for genotyping using the method described above. Similarly, the association between genotype and body weight was analyzed using the method established above. The results are shown in Table 2.

[0071] Table 2 Association analysis of TNNT1 gene polymorphism with body weight ( / kg) in 475 sheep

[0072]

[0073] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while the same superscript indicates no significant differences (P>0.05).

[0074] The results are shown in Table 2. The verification results are the same as those before. The body weight of sheep carrying the GG genotype is significantly greater than that of sheep carrying the CC genotype and the CG genotype, indicating that the results are reliable. The molecular marker of the mutation site at position 176bp as shown in SEQ ID NO.1 can be applied to the breeding of rams and fattening sheep. GG homozygous individuals can be selected to enter the core group to improve the weight of sheep and provide a detection technique for identifying whether a sheep is of high weight performance in breeding.

Claims

1. The application of a primer pair for detecting molecular markers associated with the weight trait of Hu sheep in screening for high-weight Hu sheep, characterized in that, The sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at 176bp is C or G, and this mutation leads to C / G polymorphism of the molecular marker; when the genotype of the polymorphic site is GG, its body weight is significantly higher than that of CC and CG.

2. The application of an AQP primer pair for detecting molecular markers associated with the weight trait of Hu sheep in screening for high-weight Hu sheep, characterized in that, The sequences of the AQP primer pairs are shown in SEQ ID NO.4-6; the nucleotide sequences of the molecular marker are shown in SEQ ID NO.1, wherein R at 176bp is C or G, and this mutation leads to C / G polymorphism of the molecular marker; when the genotype of the polymorphic site is GG, its body weight is significantly higher than that of CC and CG.

3. The application of a kit for detecting molecular markers associated with the weight trait of Hu sheep in screening for high-weight Hu sheep, characterized in that, The kit includes a standard PCR primer pair or an AQP sequence pair. The sequences of the standard PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.

3. The sequences of the AQP primer pairs are shown in SEQ ID NO.4-6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at 176 bp is C or G, and this mutation leads to C / G polymorphism of the molecular marker. When the genotype of the polymorphic site is GG, its body weight is significantly higher than that of CC and CG.

4. The application of a method for detecting molecular markers associated with the weight trait of Hu sheep in screening for high-weight Hu sheep, characterized in that, It includes the following steps: 1) For the molecular marker, the genomic DNA of the Hu sheep was amplified using ordinary PCR primer pairs or AQP primer pairs; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at 176bp is C or G, and this mutation leads to the C / G polymorphism of the molecular marker; 2) The polymorphic site at 176 bp of the amplification product obtained in step 1) is identified by typing. When the genotype of the polymorphic site of the molecular marker is GG, its body weight is significantly higher than that of CC and CG.

Citation Information

Patent Citations

  • Sheep meat quality SNP (single nucleotide polymorphism) marker and liquid chip formed by same

    CN108707677A